help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2007-0825
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Henke, A.
Right arrow Articles by Gromoll, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Henke, A.
Right arrow Articles by Gromoll, J.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Hazardous Substances DB
*CHORIONIC GONADOTROPIN
Endocrinology Vol. 148, No. 12 6062-6072
Copyright © 2007 by The Endocrine Society

Chorionic Gonadotropin ß-Subunit Gene Expression in the Marmoset Pituitary Is Controlled by Steroidogenic Factor 1, Early Growth Response Protein 1, and Pituitary Homeobox Factor 1

Alexander Henke, C. Marc Luetjens, Manuela Simoni and Jörg Gromoll

University Clinic Münster, Institute of Reproductive Medicine, D-48129 Münster, Germany

Address all correspondence and requests for reprints to: Prof. Dr. Jörg Gromoll, Institute of Reproductive Medicine, Domagkstrasse 11, D-48129 Münster, Germany. E-mail: joerg.gromoll{at}ukmuenster.de.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In most mammals, the gonads are under the control of the pituitary gonadotropins LH and FSH. However, in the common marmoset monkey Callithrix jacchus, no LH is detectable in the pituitary but chorionic gonadotropin (CG) instead, normally produced in the placenta. This study investigated the mechanism of CGß subunit activation in the pituitary and why humans do not express CG in the pituitary. 5'-Rapid amplification of cDNA ends, EMSA, and promoter-driven luciferase assays performed with the gonadotropic LßT2 cells showed that marmoset monkey CGß is GnRH responsive and activated similar to human LHß by the transcription factors steroidogenic factor 1 (SF1), early growth response protein 1 (Egr1), and pituitary homeobox factor 1 (Pitx1) and displayed a transcriptional start site 7 bp upstream of exon 1. In contrast, the human CGß promoter displayed in the binding elements for pituitary homeobox factor 1 and early growth response protein 1 three consensus sequence mismatches, leading to very low activity that could be drastically increased by mutation to the consensus sequences. Vice versa, marmoset CGß promoter activity was reduced after introduction of the human CGß mismatches. An in vivo study in pregnant marmoset monkeys showed that during pregnancy, there is no significant decrease of pituitary CG production, contrasting human LH down-regulation. In conclusion, pituitary CG production is lacking in humans due to the absence of appropriate DNA-binding elements, which are present in marmosets, thereby enabling GnRH activation of expression. However, during pregnancy of marmosets, pituitary CG expression is not inhibited.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
VERTEBRATE REPRODUCTION IS governed by the hypothalamic decapeptide GnRH that stimulates the pituitary to release FSH and LH, which act on the gonads. A third glycoprotein hormone, chorionic gonadotropin (CG), is exclusive for Anthropoidea within the order of primates and includes New World monkeys, Old World monkeys, great apes, and humans and is produced mainly by placental trophoblasts (1). CG is essential to establish a pregnancy because it rescues the corpus luteum and thereby stimulates the release of progesterone, which inhibits the release of FSH and LH (2). Furthermore, during pregnancy, CG is crucial for male development in humans (3).

FSH, LH, and CG consist of heavily glycosylated, noncovalently linked, heterodimeric peptide chains. The {alpha}-subunit is common to all three hormones, whereas the ß-subunit is specific for each hormone (2).

According to Talmadge and colleagues (4), the CGß gene derived from LHß by gene duplication and subsequent point mutation, which led to a frame-shift mutation and read-through into the formerly 3'-untranslated region (3'-UTR), giving rise to an additional 24 amino acid residues that form the carboxyl-terminal peptide (CTP). The CTP is prone to heavy glycosylation, which in comparison with LH leads to a greater molecular weight, much prolonged circulatory half-life (8–16 h vs. 20–40 min), and apical rather than basolateral route of secretion of the mature protein (5).

In the pituitary of a New World monkey, the common marmoset (Callithrix jacchus), no LH expression was observed but an intensive CG expression instead (6). In addition, the glycosylation pattern of pituitary marmoset CGß resembles more the pattern of human LHß than placental CGß (7). For these reasons, it was suggested that in marmosets, CG took over the role of LH in the pituitary parallel to its role in the placenta (6).

In humans, there is a cluster of six CGß genes and one LHß gene on chromosome 19p3.32 (8, 9). The LHß transcription starts 9 bp upstream of exon 1 and another 150 bp contain the most important regulatory elements (10). Human CGß1 and -2 possess no known function (11), CGß7 is expressed in breast tissue, hCGß3, -5, and -8 are expressed in the placenta to various degrees with hCGß5 being the most abundant isoform (64%) before hCGß3 and -5 (each 18%) (12, 13). Transcription starts 366 bp upstream of exon 1 so that the hCGß 5'-UTR encompasses the region that would serve as a regulatory region in paralogous LHß. In contrast, CGß is a single-copy gene in New World monkeys (1), so that in the marmoset monkey, a single-copy CGß gene is expressed in the pituitary and the placenta.

In this study, we investigated the mechanism of high marmoset monkey CGß expression and low human CGß expression in the pituitary, using the cell line LßT2 as model gonadotropes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning experiments and in vitro mutagenesis
A plasmid containing a genomic sequence of marmoset monkey CGß was used for the promoter studies. This genomic fragment encompassed 666 bp of the promoter and 0.8 kb of the CGß gene and was a generous gift from Dr. Amato and Dr. Simula (Medical School, University of Adelaide, Australia). The promoter sequence is available from the Callithrix jacchus genome trace archive under ti 1063492599. Its promoter sequence was aligned with the homologous regions of the human LHß and CGß genes, using ClustalW (14). The human sequences were obtained from the contig NG000019, which comprises the complete human LHß/CGß gene cluster.

Human promoter sequences (relative to the translational start site) of CGß5 –709/+84 nucleotides and human LHß –704/+48 nucleotides were PCR amplified from genomic DNA using QIAGEN Taq DNA polymerase (QIAGEN, Hildesheim, Germany) and cloned into pGEM- Teasy (Promega, Mannheim, Germany). These plasmids were used as template for subsequent PCR amplification of promoter sequences. PCR products were purified and cloned into the pCR2.1TOPO vector (Invitrogen, Karlsruhe, Germany) and subcloned via the KpnI/XhoI restriction sites into the luciferase gene reporter vector pGL3basic (Promega). Sequence identity was confirmed by sequencing, and primers are listed in Table 1Go.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Primers used in the experiments

 
For promoter activity studies, the following promoter regions were cloned into the pGL3basic luciferase reporter vector: marmoset monkey CGß –264/–1, –666/–1, and –666/–284 bp upstream of exon 1; human LHß –264/–1, –681/–1, and –681/–301; and human CGß5 –264/–1, –685/–1, and –685/–301.

In vitro mutagenesis (IVM) was performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, Amsterdam, The Netherlands) according to the manual. Plasmid DNA was amplified in heat-shock-transformed Escherichia coli XL1 Blue and isolated with the HiSpeed Plasmid Midi Kit (QIAGEN). Dilutions at 0.1 µg/µl were stored at –20 C until further use.

Cell culture
The immortalized mouse gonadotrope cell line LßT2 was received from Dr. P. Mellon (La Jolla, CA) (15) and maintained at 37 C in humidified air and 5% CO2 in DMEM (Invitrogen) plus 10% heat-inactivated fetal calf serum (FCS) and 1% antibiotics. The monkey kidney cell line COS7 was kept at 37 C in humidified air and 5% CO2 in DMEM plus 10% FCS and 1% antibiotics.

Transient transfections
For transfection of LßT2 cells in six-well plates, one million cells per well were seeded and transfected the following day in 1 ml serum-free DMEM using 2.0 µg construct-DNA, 0.05 µg Renilla luciferase expression vector pRLSV40 for normalization of transfection efficiency (Promega), and 10 µl Lipofectamine (Invitrogen) for 6 h according to the manufacturer’s instructions. After lipofection, medium was changed to 2 ml/well DMEM high glucose plus 10% heat-inactivated and charcoal-stripped FCS. The day after transfection, half of the cells were stimulated for 6 h with 100 nM GnRH (Sigma-Aldrich, Steinheim, Germany) and after another 6 or 18 h were lysed with 400 µl 1x passive lysis buffer per well (Promega) and scraping. Lysates were stored at –20 C until further use.

Luciferase activity was measured with the Dual-Luciferase Reporter Assay (Promega) by using 20 µl lysate and 50 µl each of reaction buffers I and II. Firefly and Renilla luciferase activity was measured with the 96-well plate reader MicrolumatPlus LB 96 (Berthold Technologies, Bad Wildheim, Germany). Transfections were performed in duplicates or triplicates.

EMSA
Nuclear extracts were prepared from confluent dishes of LßT2 cells and from LßT2 cells that were stimulated for 2 h with 100 nM GnRH before harvest and from COS7, aliquoted, and stored at –80 C. Protein concentration was determined as described above. DNA oligos (indicated in Table 1Go) were purchased from MWG Biotech (Eberstadt, Germany), diluted to 1 pmol/µl, dimerized by incubating cDNA for 4 min at 50 C, and stored at –20 C. Radioactive labeling was performed using 13 µl H2O, 7.5 µl double-stranded DNA, 2.5 µl 10x T4 polynucleotide kinase buffer, 1 µl T4 polynucleotide kinase (New England Biolabs, Frankfurt am Main, Germany), and 1 µl [{gamma}-32P]ATP (10 µCi/µl) (GE Healthcare, Munich, Germany) and incubated 30 min at 37 C and purified with G-25 SpinColumns (GE Healthcare). Gels for PAGE ranged from 3.0–4.0% acrylamide/bisacrylamide and ran at 4 C and 150 V. For each sample, DNA oligonucleotides with approximately 60,000 cpm, 12.5–15 mg protein, 1 µg poly(dI:dC) (GE Healthcare), 2x binding buffer [20 mM Tris, 100 mM NaCl, 2 mM EDTA, 2 mM dithiothreitol, 10% (vol/vol) glycerol], and if necessary, 100-fold cold oligo were mixed. For EMSA experiments, we used oligonucleotides equal to the sequence of human LHß and CGß5 and marmoset CGß at position –139/–101 bp before exon 1, containing the transcription factor binding sites (TFBS) for steroidogenic factor 1 (SF1), early growth response protein 1 (Egr1), and pituitary homeobox factor 1 (Pitx1), as indicated in Fig. 1Go.


Figure 1
View larger version (30K):
[in this window]
[in a new window]

 
FIG. 1. Sequence alignment of proximal promoters of LHß and CGß of human (Hs), marmoset (Cj), and rat (Rn). The numbers indicate the nucleotides upstream of the protein-coding region. The TFBS for SF1, Egr1, and Pitx1 are indicated by boxes. Three nucleotides within TFBS were different between human and marmoset CGß and are indicated by white font with black background and named M1, M2, and M3. The mismatches M2 and M3 were also present in marmoset LHß. Gray background indicates the oligonucleotides used for EMSA and asterisks indicate conserved sites.

 
Animals
Fourteen female marmoset monkeys were divided randomly into two age-matched groups. The six animals of the control group were housed together with castrated males, and their menstrual cycle was monitored by progesterone measurement. Animals were killed during the follicular/preovulatory phase, and organs were dissected and either snap-frozen in liquid nitrogen or fixed in Bouin’s solution.

The other eight individuals were housed together with fertile males. Menstrual cycles and the occurrence of pregnancy were monitored by progesterone measurement and ultrasonography of the uterus and compared with reference data (16, 17, 18). Because the serum CG reaches a peak at wk 8–10 of 20 wk for a full-term pregnancy, animals were killed at this time, and organs were either snap-frozen in liquid nitrogen or fixed in Bouin’s solution. A list showing the animal identification (ID) numbers, age, and days after conception is given in Table 2Go. Animal experiments were conducted according to German federal law on the use of laboratory animals with approval of local authorities, license no. G64/01.


View this table:
[in this window]
[in a new window]

 
TABLE 2. Marmoset monkeys used in the study

 
Hormone measurement
Progesterone of peripheral blood serum was measured with the RIA kit Coat-A-Count Progesterone (125I) (DPC Biermann GmbH, Bad Nauheim, Germany) in duplicates according to the manual. Bioactive CG of peripheral blood serum and aqueous protein solutions was measured with an in-house established Leydig cell assay against World Health Organization standard 78/549 (NIBSC, Potters Bar, UK) according to Luetjens et al. (18) and Wickings et al. (19).

Native protein isolation
To be able to measure bioactive CG, we performed nondegenerative protein isolation by overlaying the tissue sample with 100 µl saccharose buffer (0.25 M saccharose, 0.14 M NaCl), adding 10 µl protease-inhibitor mix (Sigma, Steinheim, Germany) per 20 µg tissue, and homogenizing tissue mechanically and by ultrasonication. An additional 900 µl saccharose buffer was added and samples centrifuged for 1 h at 4 C and 35,000 x g. The supernatant was measured for its protein concentration and stored at –20 C until further use.

Protein concentration was measured using the Bio-Rad DC protein assay (Bio-Rad Laboratories GmbH, Munich, Germany) (20).

Real-time PCR
Total RNA was isolated from tissues with Ultraspec (AMS Biotechnology Europe, Wiesbaden, Germany), based on the methodology of Chomczynski and Sacchi (21). RT of RNA was performed using Superscript II reverse transcriptase (Invitrogen) and RNasin (Promega). A marmoset CGß-specific set of primers and a FAM-labeled, exon-gapping probe were purchased from Applied Biosystems (Darmstadt, Germany) as Assays-by-Design. Primer sequences were in the 5' to 3' direction, CCATCTGTGCCGGCTACTG and GGTAAGGGCGGTAAGATGGT, and probe sequence was CAGCACCCGTACCATGC. Results were normalized for eukaryotic 18S rRNA endogenous control (Applied Biosystems). Reactions were performed using 10 µl TaqMan Universal MasterMix (Applied Biosystems), 1 µl primer/probe mixture, cDNA, and sterile H2O was added at 20 µl total volume on an ABI Prism SDS 7000 (Applied Biosystems) with one cycle of 1 min at 50 C and 10 min at 95 C, 40 cycles of 15 sec at 95 C and 1 min at 60 C, and one cycle of 1 min at 60 C. Results were analyzed with ABI Prism SDS 7000 software version 1.1 (Applied Biosystems).

Statistics
Statistical analysis was performed using SigmaStat 2.03 Software (SPSS, San Rafael, CA) and GraphPad Prism (GraphPad Software, Inc., San Diego, CA), using t test, one-way ANOVA, and Pearson’s test where appropriate.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Comparison of marmoset monkey CGß to human LHß and CGß promoter sequence
Because human CGß5 is the most expressed isoform in the placenta, its promoter was chosen as representative promoter for all in vitro experiments. Marmoset monkey CGß nucleotides –666/–1 relative to exon 1 had an identity of 78% in comparison to human LHß and 77% to human CGß5, whereas identity was 89% between human LHß and human CGß5. Considering only the more proximal region, the marmoset monkey CGß –264/–1 showed an 80% identity to human LHß and 81% to human CGß5.

In silico prediction of TFBS and transcriptional start site (TSS) of the marmoset CGß promoter
Mammalian LHß core promoters comprise the proximal region 150 bp upstream of exon 1, and transcription starts 9–12 bp upstream of exon 1, depending on the species. However, the human CGß TSS is 365 bp upstream of exon 1, and its promoter comprises the region –680/–350 bp. Thus, the 5'-UTR of human CGß mRNA encompasses the region that serves as core promoter in the paralogous LHß gene (22).

5'-Rapid amplification of cDNA ends (5'-RACE) for CGß with mRNA isolated from the pituitary of an adult male marmoset showed that the TSS was 7 bp upstream of exon 1, similar to human and rodent LHß.

The mammalian LHß core promoter contains essential TFBS for Egr1, SF1, and Pitx1 and also a TATA box. To analyze whether the marmoset CGß gene promoter also contained these elements, the software MatInspector was used for TFBS prediction (23). Two Egr1-binding sites at positions –120/–111 and –57/–49 bp and two SF1-binding sites at –137/–129 and –67/–59 bp were predicted. An orthodenticle-like homeobox protein (Otx)-binding site was predicted at –111/–96 bp and a TATA box at –40/–33 bp. The predicted sites matched well with the sites known for mammalian LHß, and the predicted Otx-binding site matched well the actual Pitx1-binding site. For marmoset LHß, the following relevant elements were identified: SF1 at –137/–129 and –66/–59 bp, Egr1 at –57/–49 bp, and TATA box at –40/–32 bp. Egr{alpha} was predicted for –120/–111 bp, a transcription factor belonging to the same family as Egr1. No homeobox factor binding to the position –100/–110 bp, which would have been the position for Pitx1, was predicted.

The proximal promoter of LHß and CGß is highly active in LßT2 cells
The promoter constructs were transiently transfected in LßT2 cells, which were stimulated with either GnRH or vehicle, and luciferase activity was measured. The proximal and full-length promoters of human LHß and marmoset CGß showed the highest activity (Fig. 2Go). In comparison with vehicle treatment, the GnRH stimulation led to a significant (t test, P ≤ 0.05) luciferase increase for all proximal and whole promoter constructs but not for distal promoter parts.


Figure 2
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 2. Activity of promoters and parts of promoters of CGß and LHß, cloned upstream of a luciferase reporter gene, transiently transfected in gonadotropic LßT2 cells. Either proximal (P) (nucleotides –264/–1), distal (D) (nucleotides –670/–300), or full-length (P+D) (nucleotides ~–670/–1) promoters were investigated of the human (Hs) and marmoset monkey (Cj) LHß and CGß gene promoters, represented by blank boxes on the left side of the figure, whereas the gray boxes symbolize the luciferase gene (Luc). Empty luciferase vector pGL3basic served as negative control and for normalization among different transfections. For each construct, the fold induction in comparison with the empty control vector is given plus SEM of at least three independent transfections, each performed at least in duplicate. Cells were harvested 6 h after the end of the GnRH treatment (100 nM for 6 h), which is represented by black bars and caused a significant (t test; P ≤ 0.05) activity increase of proximal and full-length promoters (*). Marmoset CGß and human LHß were significantly (one-way ANOVA; P ≤ 0.05) higher induced than human CGß but not marmoset LHß (P = 0.128 and P = 0.132, respectively). RLU, Relative light units.

 
Although the human CGß5 proximal promoter showed some activity as well, this was 4-fold lower compared with the marmoset CGß proximal promoter and the human LHß promoter. The marmoset LHß promoter showed an activity intermediate between human LHß and CGß5 and half as much as marmoset CGß, differing significantly neither from human LHß or CGß5 nor from marmoset CGß.

Thus, we demonstrated that the marmoset monkey CGß promoter is active in a gonadotropic cell line and had a core promoter region (–264/–1 bp) and a TSS (–7 bp) similar to human LHß promoter. Furthermore, the activity of the marmoset monkey CGß promoter was as GnRH responsive as the human LHß promoter.

Identification of the elements responsible for pituitary CGß expression
Sequence alignment showed three nucleotide differences between human and marmoset CGß; nucleotides –119 and –112 within the TFBS for Egr1 and nucleotide –106 within the TFBS for Pitx1 were different and indicated as M1, M2, and M3, respectively (Fig. 1Go).

To explore their functional relevance, these sites were mutated by IVM using the luciferase constructs with the promoter regions –264/–1 as templates. We exchanged the nucleotides at position M1 (T->C), M2 (C->G) or M3 (G->A) from the human to the marmoset monkey sequence and vice versa. One construct contained all three mutations together (M1,2,3). Thus, four mutated marmoset CGß and four mutated human CGß constructs were generated and tested in reporter assays.

In the marmoset CGß promoter, each of the three mutations led to a partial loss of function, resulting in a 37–60% decrease. When mutated simultaneously, a synergistic effect was observed because activity was decreased by 82% (Fig. 3Go). In contrast, the activity of the human CGß5 proximal promoter was doubled by mutation M2 but remained unchanged by mutations M1 and M3. However, all three mutations together appeared to have also a synergistic effect, because the activity rose 3.7-fold to the level of wild-type (WT) marmoset CGß. Thus, in gonadotrope LßT2 cells, it was possible to decrease marmoset CGß promoter activity to the level of human CGß5 promoter activity by introducing three human-specific nucleotides changes, and vice versa, human CGß5 promoter activity was enhanced by marmoset-specific nucleotide changes.


Figure 3
View larger version (11K):
[in this window]
[in a new window]

 
FIG. 3. Activity of WT and mutated promoters of human and marmoset CGß, cloned upstream of a luciferase reporter gene, in gonadotropic LßT2 cells after transient transfection. M1, M2, and M3 are the mutations according to Fig. 1Go. M1,2,3 was a promoter construct bearing all three mutations together. The means and SEM were calculated from duplicates of at least two independent transfections with (black columns) and without (white columns) GnRH treatment. Cells were harvested 18 h after GnRH treatment.

 
EMSA suggest identical transcription factor binding for marmoset CGß and human LHß promoter
In the previous transfection experiments, it was possible to change the activity profiles of human and marmoset CGß promoter activity by three nucleotide exchanges. To elucidate whether this was reflected in EMSA experiments, the protein-binding behavior of human and marmoset CGß oligonucleotides with the WT sequences were compared with oligonucleotides bearing the mutations M1, M2, and M3. An EMSA experiment is shown in Fig. 4Go.


Figure 4
View larger version (40K):
[in this window]
[in a new window]

 
FIG. 4. Comparison of WT and mutated human and marmoset monkey CGß promoters in EMSA. The binding of protein complexes to the human CGß proximal region (A) and the marmoset CGß proximal region (B) are compared between the WT forms (lanes 1–4 and 9–12) and the mutated forms (lanes 5–8 and 13–16), which contained all three mutations described for the luciferase constructs. Nuclear extracts of LßT2 cells without (–) and with (+) GnRH stimulation were used, and cold oligonucleotides with identical sequence to the labeled oligonucleotides were employed in 100-fold molar excess. The acrylamide/bisacrylamide percentage of the gel was 4%.

 
The comparison of WT human CGß5 (Fig. 4Go, lanes 1 and 2) and its mutated form (lanes 5 and 6) showed the five bands (d, e, f, g, and h) for the WT and the three bands (e, f, and h) for the mutated form. Two DNA-protein complexes appeared in both WT and mutated forms (Fig. 4AGo, lanes 1 and 2 vs. 5 and 6, arrows f and h). In both WT and mutated forms, complex f was present but was weaker in lanes loaded with extracts of GnRH-stimulated cells. Mutations caused a weakening of signal strength for complex f (Fig. 4AGo, lane 1 vs. 5 and lane 2 vs. 6), and led to a signal loss for complexes d, e, and g (Fig. 4AGo, lane 2 vs. 6). Protein-DNA complex c was not present when the WT oligonucleotide was used but appeared when the mutated oligonucleotide was used, and its signal strength was even enhanced by extracts from cells treated with GnRH (Fig. 4AGo, lanes 5 and 6). The use of a 100-fold excess of unlabeled oligonucleotides resulted in complete signal loss (Fig. 4AGo, lanes 3, 4, 7, and 8).

Marmoset monkey WT CGß oligonucleotide bound five protein complexes (Fig. 4AGo, lanes 9 and 10, arrows a, b, c, e, and f) and also the mutated form bound five (Fig. 4AGo, lanes 9 and 10, arrows b, e, f, g, and h). However, mutations caused loss of complex a and weakening of signal strength of complexes b and f and the appearance of g and h.

To analyze whether the observed changes in banding patterns might relate to specific transcription factors, we employed a displacement method for which we used unlabeled short oligonucleotides as competitors that matched the binding sequences for Egr1 in human LHß/CGß promoter sequences (TGGGGGCG) and the consensus sequences for Pitx1 [G(A/C)TTA] (24) or SF1 (YCAAGGYCR) (25).

The binding pattern of proteins to mutated human CGß5 (Fig. 5AGo) and WT marmoset CGß (Fig. 5BGo) showed similar results, because the competitor for the Egr1-binding site attenuated protein binding (Fig. 5AGo, lanes 3 and 4 and lanes 13 and 14; loss or weakening of a, b, or c or combinations thereof). Competition for the SF1-binding site resulted in the loss of band e for both oligonucleotides (Fig. 5AGo, lanes 7 and 8, and Fig. 5BGo, lanes 17 and 18). However, the use of competitor for Pitx1 resulted in the loss of band e for mutated human CGß5 (Fig. 5AGo, lanes 5 and 6) but not for marmoset WT CGß (Fig. 5BGo, lanes 15 and 16).


Figure 5
View larger version (47K):
[in this window]
[in a new window]

 
FIG. 5. EMSA competitor experiments for TFBS of promoters. We identified protein complexes binding to the mutated (M) human CGß5 (A), the WT marmoset CGß (B), and the WT human LHß (C) proximal regions encompassing the binding sites for SF1, Egr1, and Pitx1, as depicted in Fig. 1Go. Protein extracts were preincubated with a 100-fold excess of unlabeled oligonucleotides containing the consensus DNA-binding motif for Egr1, Pitx1, and SF1. Nuclear extracts of LßT2 cells were used without (–) and with (+) GnRH stimulation. The acrylamide/bisacrylamide percentage of the gel was 4% (A and B) or 3% (C).

 
All three competitors together were able to abrogate all signals except for band c for mutated human CGß5 and WT marmoset CGß (Fig. 5Go, A and B, lanes 9, 10, 19, and 20).

The protein-binding pattern to human WT LHß was different and less sensitive to competitors. The very weak bands b and c were lost when the competitor for Egr1 was used (Fig. 5CGo, lanes 23 and 24). Band e was abrogated by any of the three competitors. When all three competitors together were used, all bands but d disappeared, indicating the binding of another yet unknown transcription factor. It was difficult to assign certain bands to specific factors, but nevertheless it appeared that c refers to a DNA-protein complex involving Egr1, d to an unknown factor binding only to human LHß, e to a complex that involves Egr1 and SF1, and f to SF1 binding.

CG is highly expressed in pituitaries of pregnant marmoset monkeys
After we found in vitro that marmoset CGß was regulated similar to LHß in pituitaries, we wanted to investigate whether the in vivo situation was also similar. Therefore, the regulation of CG was investigated in two groups of female marmosets that were either nonpregnant or pregnant. It was expected that pregnant animals show a clear decrease of pituitary CG in comparison with nonpregnant individuals at both the protein and the mRNA level.

On the day animals were killed, the pregnant marmoset monkeys showed serum levels of bioactive CG ranging from 170-1400 mU/ml with a mean of 916 ± 404 mU/ml, whereas in the nonpregnant control animals, CG levels were below the detection limit of the assay. The nonpregnant animals were in the follicular/preovulatory phase of their cycles and showed progesterone levels ranging from 4.9–36.4 ng/ml with a mean of 12.7 ± 12.3 ng/ml.

To analyze the origin of circulating CG, bioactive CG was measured in native protein extracts of pituitaries and placentas. The bioactive pituitary CG level in nonpregnant marmosets was 9833 ± 7665 mU/mg protein and in nonpregnant animals reached 16,018 ± 5,830 mU/mg protein, revealing no significant differences between groups (Fig. 6AGo).


Figure 6
View larger version (15K):
[in this window]
[in a new window]

 
FIG. 6. Quantification of pituitary CG expression in nonpregnant (NP) and pregnant (P) marmosets at the level of bioactive holohormone (A) and mRNA expression, quantified by real-time PCR and normalized against 18S rRNA (B). The difference between groups was not significant (NS), either at the protein level (t test; P = 0.292) or at the mRNA level (Mann-Whitney rank sum test; P = 0.200).

 
The transcriptional level of marmoset CGß expression during pregnancy and in normal cycling monkeys was studied using real-time PCR. The relative expression of CGß mRNA in the group of nonpregnant animals (n = 3) was 4.21 ± 1.71 arbitrary units compared with 2.25 ± 0.44 arbitrary units in the pregnant animals (n = 3). Statistical analysis showed no significant difference (Fig. 6BGo).

Therefore, there was no significant difference between the nonpregnant and the pregnant groups concerning pituitary content of CG holohormone or its ß-subunit expression.

The mean bioactive CG of placental protein extracts was 136 ± 68 mU/mg protein (n = 8) and significantly correlated with serum CG (Pearson test; P = 0.023) but not with pituitary CG (Fig. 7Go), suggesting that the high circulating CG levels in pregnancy derive mainly from the placenta.


Figure 7
View larger version (15K):
[in this window]
[in a new window]

 
FIG. 7. Correlation of serum CG to the bioactive CG in placenta (A) and pituitary (B). The correlation between serum and placenta CG is significant (Pearson test; P = 0.023) but not between serum and pituitary CG.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Because the marmoset monkey is an important and popular animal model in biomedical research, toxicology, and preclinical tests, it is crucial to investigate the molecular biology that underlies its physiology. Previous studies investigated the hormonal profile of LH in marmoset monkeys (16, 26), and it was already suggested that such studies actually investigated CG levels instead of LH and therefore should be reinterpreted (6). Human LH and CG during the menstrual cycle and pregnancy were described by (28, 29, 30). However, all these studies measured LH and CG in serum samples, which do not reveal the source of secretion. This study was the first that quantified CGß mRNA and bioactive CG in marmoset monkey pituitaries.

Other recent studies focused on hypothalamic GnRH and pituitary CG release in marmosets, using sophisticated experimental procedures for in vivo measurement of hormones in serum in close proximity to the sites of synthesis and release (31, 32). The GnRH release shows a pulsatile pattern with pulses every 50 min on average, similar to rhesus monkeys (31). In vitro experiments demonstrated that after GnRH stimulation, the onset of marmoset CG release was as fast as rat LH release but peaked later and lasted longer (32).

Interestingly, the marmoset monkey CGß protein sequence revealed a potential glycosylation pattern more similar to LHß than to human/rhesus CGß due to the loss of two O-linked glycosylation consensus sequence sites in the CTP and the presence of an N-linked glycosylation consensus sequence site (7). Therefore, it can be assumed that the marmoset monkey CGß glycosylation pattern is intermediate between the human LHß and CGß glycosylation pattern, resulting in a half-life probably intermediate between LHß and conventional CGß.

The prolonged half-life of the hormone and long-lasting secretion of marmoset CG from gonadotropes could add to high serum CG levels. Therefore, in vivo, the serum CG levels do not show a regular pulsatile pattern, resulting in a mismatch to the GnRH pulses (32).

In our investigations, we focused on the molecular mechanism for why CGß is expressed in the pituitary of marmoset monkeys but not at considerable levels in human pituitaries. We found that the TSS of marmoset monkey CGß in the pituitary was 7 bp upstream of exon 1, which is in excellent agreement with the TSS of LHß in other species, because in the mouse, rat, rhinoceros, and human, transcription of LHß starts approximately 8–11 bp upstream of the protein-coding region (22, 33). In contrast, all three human CGß isoforms expressed in the placenta have a TSS 366 bp upstream of exon 1 and contain in their 5'-UTR the area that serves as promoter in LHß transcription (22). This difference in the TSS was the first clue that marmoset monkey CGß is regulated similarly to LHß in the pituitary.

For the sequence of the proximal promoter part of marmoset CGß, MatInspector predicted the presence of TFBS essential for LHß activation. We demonstrated that marmoset CGß transcription in LßT2 cells was driven by the proximal promoter part (–264/–1 bp), whose homologous human LHß counterpart also showed the same high activity. In contrast, the distal marmoset CGß promoter and all of the human CGß5 gene promoter constructs showed quite low activity in the gonadotropic cell line.

In equids, the situation is similar to the marmoset monkey, because in equids there is also a single-copy LHß/CGß gene expressed in both pituitary and placenta. At both sites, the CGß peptide shows the presence of a CTP (34). In equine pituitary and placenta, the same promoter is used for both tissues and transcription starts close to exon 1 and is regulated by GnRH like in other mammals (35, 36). Despite these similarities, the evolution of the equine LHß/CGß gene occurred independently from the primate CGß evolution and is therefore an example of convergent development on a molecular level.

To our surprise, the marmoset LHß proximal promoter (–264/–1 bp) also showed activity that was intermediate between human LHß and CGß5 but still much lower than marmoset CGß. We expected a loss of function of this promoter for two reasons. First, in a previous study, it was shown that the gene itself appears intact and hypothesized that the intergenic region between marmoset CGß and LHß might have been compromised by a transposable element thereby disrupting the promoter (6). Second, the TFBS for Egr1 and Pitx1 bear two consensus sequence-mismatching nucleotides at exactly identical positions to human CGß5, termed M2 and M3 (Fig. 1Go). As demonstrated for human CGß5 promoter sequences, these two sites are crucial for full promoter activity. It follows that the mechanism of observed loss of expression of marmoset LHß in vivo can be explained only in part by its reduced promoter activity but is not entirely understood yet and remains the subject of further study.

The human CGß5 promoter, too, was not completely silent but displayed an activity on a very low level, fitting with reports of the presence of human CG protein in pituitaries (37, 38). One study reported that human CGß mRNA was detected using RT-PCR with a forward primer that indicated a long 5'-UTR of at least 200 bp (11). It follows that in the human CGß genes, the region –150/–1 bp upstream of exon 1, which serves as regulatory region for LHß activation, is not employed in pituitary expression and thereby demonstrates a further difference between human and marmoset CGß gene regulation.

The in vitro mutagenesis of marmoset and human CGß proximal promoters had a clear impact on expression in LßT2 cells. Although two single gain-of-function mutations in human CGß5 had nearly no effect (M1 and M3), mutation M2 showed a pronounced gain-of-function effect, and all mutations together had a synergistic effect. On the other hand, all three loss-of-function mutations of single sites in the marmoset CGß promoter led to a decrease of activity, and all three mutations together had a synergistic effect and resulted in an even more severe decrease of CGß promoter activity and loss of GnRH responsiveness. Thus, we could reverse the WT situation and silence marmoset CGß and activate human CGß5. These data were in agreement with other studies of inactivation of TFBS for LHß transactivation. Reporter genes driven by an LHß promoter showed decreased activity when the Pitx1 TFBS (24, 39), the SF1 TFBS (40), or the Egr1 TFBS (35, 41, 42) was disrupted.

Our EMSA data also supported the concept that marmoset CGß is transactivated by Egr1, SF1, and Pitx1. In the first experiment, mutation of M1, M2, and M3 led to pronounced changes in DNA-protein binding patterns for human and marmoset CGß promoter oligonucleotides. In a second series of experiments, unlabeled oligonucleotides competed for the binding of transcription factors. Because the short, unlabeled oligonucleotides contained the consensus sequence of the TFBS of Pitx1, SF1, or Egr1, the disappearance of some bands possibly relate to transcription factor-specific binding. However, a correct designation of bands to specific transcription factors was difficult because SF1, Egr1, and Pitx1 also interact with each other (40, 43) and with other factors (as reviewed in Refs. 10 , 44 , and 45). This results in complex protein-protein and protein-DNA interactions, so that competition for one factor might affect several bands simultaneously. We used the EMSA displacement method for Egr1 (based on Refs. 35 and 46) and for Pitx1 (based on Refs. 47 and 24). These studies, which also used cell line LßT2, confirmed the binding of transcription factors with supershift experiments. Thus, our EMSA data add to our hypothesis in addition to the other compelling in vitro data. The literature background, the similarity between mammalian LHß and marmoset CGß promoter architecture and cis elements, their nearly identical TSS, and their sensitivity to GnRH stimulation and mutation show for the marmoset CGß promoter regulation by SF1, Egr1, and Pitx1.

High in vivo expression of CG in marmosets during pregnancy
We measured bioactive CG in serum and in pituitaries of nonpregnant and pregnant female marmosets. Serum CG was significantly different between the pregnant and nonpregnant animals because CG was below the detection limit of the assay in the serum of nonpregnant individuals but was high in pregnant animals. We hypothesized that during pregnancy, a negative feedback might act on the pituitary similarly to the human, decreasing the synthesis of CG in the marmoset monkey pituitary. However, no clear-cut inhibition was shown in the pituitaries, suggesting that pituitary CG production does not stop during pregnancy in the marmoset. However, bioactive CG concentrations from marmoset placental protein extracts was 72-fold lower than in the pituitary. The mass differences between an average marmoset pituitary (10–15 mg) and an approximately 100-fold heavier placenta suggests that the placenta remains nevertheless the main source of CG in pregnancy, especially because serum CG concentrations correlated significantly with placental CG but not with pituitary CG. We suggest that placental CG is immediately secreted during pregnancy, whereas pituitary CG remains stored inside gonadotropes. It is well known that in rodents and sheep, LH is stored in intracellular vesicles until GnRH-triggered release, whereas human placental CG is not stored but released constantly. Thus, the steady-state level of intracellular hormone concentration is likely to be less in trophoblasts than in gonadotropes, independently of the actual output rate.

Hence, the transcriptional level of CGß was investigated in marmoset pituitaries. To our knowledge, real-time PCR of CGß was performed so far only on human tumor tissues, e.g. breast cancer biopsies (48). Thus, we report the first CGß mRNA real-time PCR quantification in primate pituitaries and found that CGß mRNA was 1.87-fold decreased in pregnant animals in comparison with nonpregnant individuals. Due to small groups and unexpected high interindividual variability, the difference between groups was not significant.

These unexpected findings in marmosets led us to the speculation that during pregnancy, CG is produced in the pituitary of female marmoset monkeys at a low constitutive level and that it might be stored in vesicles in the gonadotropes, similar to LH during the menstrual cycle in other mammals.

In Fig. 8Go, we summarize the special features of marmoset reproduction. Marmoset gonadotropes possess not only GnRH receptor (GnRHR) type I but also type II (49, 50). A disruption of the GnRHR type II gene was found in human, chimpanzee, cow, sheep, and rat (51). After gonadotrope stimulation by GnRH, CG instead of LH is released in irregular pulses due to longer half-life and because marmoset gonadotrope CG secretion lasts longer than LH secretion after GnRH stimulation (27, 32). The cognate LH receptor (LHR) type 2, present not only in the common marmoset but also in all New World monkeys, lacks exon 10 at the mRNA and protein level, although it is present at the genomic level (52, 53), caused by changes of intronic regulatory elements for splicing (54). It was described for the human that WT LHR transduces the signals of both LH and CG, with equally high cAMP responses. However, when a mutant LHR without exon 10 was used, LH signaling was severely reduced (55). Another study showed that the CTP is crucial to overcome the absence of exon 10 in the LHR type 2 to transduce signals (27).


Figure 8
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 8. A scheme displaying the special features of marmoset monkey endocrine regulation of reproduction. FSHR, FSH receptor.

 
In summary, we show that marmoset monkey CGß transcription in the pituitary has a TSS similar to LHß and is GnRH responsive. The promoter displays TFBS for Egr1, SF1, and Pitx1, which are crucial for transactivation. Three nucleotide changes in these TFBS were sufficient for activation impairment and mutated in the course of evolution in the promoter of human CGß5 and thereby blunted pituitary expression. In vivo, CGß expression in female marmoset pituitaries was high at the protein and mRNA levels during pregnancy. It is likely that these hormonal features are present not only in marmoset monkeys but also in all New World monkeys because they have the LHR type 2 in common (53). The mechanism of high in vitro and low in vivo marmoset LHß promoter activity remains to be clarified in future studies.


    Acknowledgments
 
We thank S. Nieschlag for language editing, Professor E. Nieschlag for providing the institute’s infrastructure and advice, G. Stelke and M. Heuermann for animal care, and R. Wesselmann and R. Sandhove for technical support in performing the RIAs.


    Footnotes
 
Grants were received from the German Research Council Deutsche Forschungsgemeinschaft, numbers GR1574/6-1 and LU827/3-1/-2 and the Innovative Medical Research Fund of the University Clinic Münster, Grant SI520601.

Disclosure Statement: The authors of this manuscript have nothing to declare.

First Published Online September 13, 2007

Abbreviations: CG, Chorionic gonadotropin; CTP, carboxyl-terminal peptide; Egr1, early growth response protein 1; FCS, fetal calf serum; ID, identification; IVM, in vitro mutagenesis; LHR, LH receptor; Pitx1, pituitary homeobox factor 1; RACE, rapid amplification of cDNA ends; SF1, steroidogenic factor 1; TFBS, transcription factor binding sites; TSS, transcriptional start site; UTR, untranslated region; WT, wild type.

Received June 20, 2007.

Accepted for publication September 5, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Maston GA, Ruvolo M 2002 Chorionic gonadotropin has a recent origin within primates and an evolutionary history of selection. Mol Biol Evol 19:320–335[Abstract/Free Full Text]
  2. Bousfield GR, Ward DN 2006 Gonadotropins: chemistry and biosynthesis. In: Neill JD, ed. Knobil and Neill’s physiology of reproduction. 3rd ed. San Diego: Elsevier Academic Press; 1581–1634
  3. Gromoll J, Eiholzer U, Nieschlag E, Simoni M 2000 Male hypogonadism caused by homozygous deletion of exon 10 of the luteinizing hormone (LH) receptor: differential action of human chorionic gonadotropin and LH. J Clin Endocrinol Metab 85:2281–2286[Abstract/Free Full Text]
  4. Talmadge K, Vamvakopoulos NC, Fiddes JC 1984 Evolution of the genes for the ß-subunits of human chorionic gonadotropin and luteinizing hormone. Nature 307:37–40[CrossRef][Medline]
  5. Muyan M, Furuhashi M, Sugahara T, Boime I 1996 The carboxy-terminal region of the ß-subunits of luteinizing hormone and chorionic gonadotropin differentially influence secretion and assembly of the heterodimers. Mol Endocrinol 10:1678–1687[Abstract/Free Full Text]
  6. Müller T, Simoni M, Pekel E, Luetjens CM, Chandolia R, Amato F, Norman RJ, Gromoll J 2004 Chorionic gonadotrophin ß-subunit mRNA but not luteinising hormone ß-subunit mRNA is expressed in the pituitary of the common marmoset (Callithrix jacchus). J Mol Endocrinol 32:115–128[Abstract]
  7. Simula AP, Amato F, Faast R, Lopata A, Berka J, Norman RJ 1995 Luteinizing hormone/chorionic gonadotropin bioactivity in the common marmoset (Callithrix jacchus) is due to a chorionic gonadotropin molecule with a structure intermediate between human chorionic gonadotropin and human luteinizing hormone. Biol Reprod 53:380–389[Abstract]
  8. Talmadge K, Boorstein WR, Fiddes JC 1983 The human genome contains seven genes for the ß-subunit of chorionic gonadotropin but only one gene for the ß-subunit of luteinizing hormone. DNA 2:281–289[Medline]
  9. Jameson L, Chin WW, Hollenberg AN, Chang AS, Habener JF 1984 The gene encoding the ß-subunit of rat luteinizing hormone. Analysis of gene structure and evolution of nucleotide sequence. J Biol Chem 259:15474–15480[Abstract/Free Full Text]
  10. Jorgensen JS, Quirk CC, Nilson JH 2004 Multiple and overlapping combinatorial codes orchestrate hormonal responsiveness and dictate cell-specific expression of the genes encoding luteinizing hormone. Endocr Rev 25:521–542[Abstract/Free Full Text]
  11. Dirnhofer S, Hermann M, Hittmair A, Hoermann R, Kapelari K, Berger P 1996 Expression of the human chorionic gonadotropin-ß gene cluster in human pituitaries and alternate use of exon 1. J Clin Endocrinol Metab 81:4212–4217[Abstract]
  12. Bo M, Boime I 1992 Identification of the transcriptionally active genes of the chorionic gonadotropin beta gene cluster in vivo. J Biol Chem 267:3179–3184[Abstract/Free Full Text]
  13. Miller-Lindholm AK, LaBenz CJ, Ramey J, Bedows E, Ruddon RW 1997 Human chorionic gonadotropin-ß gene expression in first trimester placenta. Endocrinology 138:5459–5465[Abstract/Free Full Text]
  14. Thompson JD, Higgins DG, Gibson TJ 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680[Abstract/Free Full Text]
  15. Thomas P, Mellon PL, Turgeon J, Waring DW 1996 The LßT2 clonal gonadotrope: a model for single cell studies of endocrine cell secretion. Endocrinology 137:2979–2989[Abstract]
  16. Chambers PL, Hearn JP 1979 Peripheral plasma levels of progesterone, oestradiol-17ß, oestrone, testosterone, androstenedione and chorionic gonadotrophin during pregnancy in the marmoset monkey, Callithrix jacchus. J Reprod Fertil 56:23–32[Abstract/Free Full Text]
  17. Oerke A, Einspanier A, Hodges JK 1994 Detection of pregnancy and fetal growth in the marmoset monkey (Callithrix jacchus) by real-time ultrasonography. Am J Primatol 36:1–13[CrossRef]
  18. Luetjens CM, Wesselmann R, Kuhlmann M 2006 GnRH-antagonist mediated down-regulation of the estrous cycle in marmosets. J Med Primatol 35:361–368[CrossRef][Medline]
  19. Wickings EJ, Qazi MH, Nieschlag E 1979 Determination ob biologically active LH in the serum of male rhesus monkeys (Macaca mulatta). J Reprod Fertil 57:497–504[Abstract/Free Full Text]
  20. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto EK, Goeke NM, Olson BJ, Klenk DC 1985 Measurement of protein using bicinchoninic acid. Anal Biochem 150:76–85[CrossRef][Medline]
  21. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  22. Jameson JL, Lindell CM, Habener JF 1986 Evolution of different transcriptional start sites in the human luteinizing hormone and chorionic gonadotropin ß-subunit genes. DNA 5:227–234[Medline]
  23. Cartharius K, Frech K, Grote K, Klocke B, Haltmeier M, Klingenhoff A, Frisch M, Bayerlein M, Werner T 2005 MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics 21:2933–2942[Abstract/Free Full Text]
  24. Jiang Q, Jeong KH, Horton CD, Halvorson LM 2005 Pituitary homeobox 1 (Pitx1) stimulates rat LHß gene expression via two functional DNA-regulatory regions. J Mol Endocrinol 35:145–158[Abstract/Free Full Text]
  25. Little TH, Zhang Y, Matulis CK, Weck J, Zhang Z, Ramachandran A, Mayo KE, Radhakrishnan I 2006 Sequence-specific deoxyribonucleic acid (DNA) recognition by steroidogenic factor 1: a helix at the carboxy terminus of the DNA binding domain is necessary for complex stability. Mol Endocrinol 20:831–843[Abstract/Free Full Text]
  26. Harlow CR, Hearn JP, Hodges JK 1984 Ovulation in the marmoset monkey: endocrinology, prediction and detection. J Endocrinol 103:17–24[Abstract/Free Full Text]
  27. Müller T, Gromoll J, Simula AP, Norman R, Sandhowe-Klaverkamp R, Simoni M 2004 The carboxyterminal peptide of chorionic gonadotropin facilitates activation of the marmoset LH receptor. Exp Clin Endocrinol Diabetes 112:574–579[CrossRef][Medline]
  28. Yuen BH, Livingston JE, Poland BJ, Wittmann BK, Sy L, Cannon W 1981 Human chorionic gonadotropin, estradiol, progesterone, prolactin, and B-scan ultrasound monitoring of complications in early pregnancy. Obstet Gynecol 57:207–214[Medline]
  29. Veldhuis JD, Beitins IZ, Johnson ML, Serabian MA, Dufau ML 1984 Biologically active luteinizing hormone is secreted in episodic pulsations that vary in relation to stage of the menstrual cycle. J Clin Endocrinol Metab 58:1050–1058[Abstract/Free Full Text]
  30. Jeppsson S, Rannevik G, Thorell JI 1977 Pituitary gonadotrophin secretion during the first weeks of pregnancy. Acta Endocrinol 85:177–188[Medline]
  31. Tannenbaum PL, Schultz-Darken NJ, Saltzman W, Terasawa E, Woller MJ, Abbott DH 2007 Gonadotrophin-releasing hormone (GnRH) release in marmosets I: in vivo measurement in ovary-intact and ovariectomised females. J Neuroendocrinol 19:342–353[CrossRef][Medline]
  32. Tannenbaum PL, Schultz-Darken NJ, Woller MJ, Abbott DH 2007 Gonadotrophin-releasing hormone (GnRH) release in marmosets. II. Pulsatile release of GnRH and pituitary gonadotrophin in adult females. J Neuroendocrinol 19:354–363[CrossRef][Medline]
  33. Sherman GB, Lund LA, Bunick D, Winn RJ 1997 Characterization and phylogenetic significance of rhinoceros luteinizing hormone ß (LHß) subunit messenger RNA structure, complementary DNA sequence and gene copy number. Gene 195:131–139[CrossRef][Medline]
  34. Sherman GB, Wolfe MW, Farmerie TA, Clay CM, Threadgill DS, Sharp DC, Nilson JH 1992 A single gene encodes the ß-subunits of equine luteinizing hormone and chorionic gonadotropin. Mol Endocrinol 6:951–959[Abstract/Free Full Text]
  35. Wolfe MW, Call GB 1999 Early growth response protein 1 binds to the luteinizing hormone-ß promoter and mediates gonadotropin-releasing hormone-stimulated gene expression. Mol Endocrinol 13:752–763[Abstract/Free Full Text]
  36. Wolfe MW 1999 The equine luteinizing hormone ß-subunit promoter contains two functional steroidogenic factor-1 response elements. Mol Endocrinol 13:1497–1510[Abstract/Free Full Text]
  37. Birken S, Maydelman Y, Gawinowicz MA, Pound A, Liu Y, Hartree AS 1996 Isolation and characterization of human pituitary chorionic gonadotropin. Endocrinology 137:1402–1411[Abstract]
  38. Hoermann R, Spoettl G, Moncayo R, Mann K 1990 Evidence for the presence of human chorionic gonadotropin (hCG) and free ß-subunit of hCG in the human pituitary. J Clin Endocrinol Metab 71:179–186[Abstract/Free Full Text]
  39. Quirk CC, Lozada KL, Keri RA, Nilson JH 2001 A single Pitx1 binding site is essential for activity of the LHß promoter in transgenic mice. Mol Endocrinol 15:734–746[Abstract/Free Full Text]
  40. Kaiser UB, Halvorson LM, Chen MT 2000 Sp1, steroidogenic factor 1 (SF-1), and early growth response protein 1 (egr-1) binding sites form a tripartite gonadotropin-releasing hormone response element in the rat luteinizing hormone-ß gene promoter: an integral role for SF-1. Mol Endocrinol 14:1235–1245[Abstract/Free Full Text]
  41. Lee SL, Sadovsky Y, Swirnoff AH, Polish JA, Goda P, Gavrilina G, Milbrandt J 1996 Luteinizing hormone deficiency and female infertility in mice lacking the transcription factor NGFI-A (Egr-1). Science 273:1219–1221[Abstract]
  42. Call GB, Wolfe MW 2002 Species differences in GnRH activation of the LHß promoter: role of Egr1 and Sp1. Mol Cell Endocrinol 189:85–96[CrossRef][Medline]
  43. Mouillet JF, Sonnenberg-Hirche C, Yan X, Sadovsky Y 2004 p300 regulates the synergy of steroidogenic factor-1 and early growth response-1 in activating luteinizing hormone-ß subunit gene. J Biol Chem 279:7832–7839[Abstract/Free Full Text]
  44. Melamed P, Kadir MN, Wijeweera A, Seah S 2006 Transcription of gonadotropin ß-subunit genes involves cross-talk between the transcription factors and co-regulators that mediate actions of the regulatory hormones. Mol Cell Endocrinol 252:167–183[CrossRef][Medline]
  45. Jeong KH, Kaiser UB 2006 Gonadotropin-releasing hormone regulation of gonadotropin biosynthesis and secretion. In: Neill JD, ed. Knobil and Neill’s physiology of reproduction. 3rd ed. San Diego: Elsevier Academic Press; 1635–1701
  46. Buggs C, Weinberg F, Kim E, Wolfe A, Radovick S, Wondisford F 2006 Insulin augments GnRH-stimulated LHß gene expression by Egr-1. Mol Cell Endocrinol 249:99–106[Medline]
  47. Rosenberg SB, Mellon PL 2002 An Otx-related homeodomain protein binds an LHß promoter element important for activation during gonadotrope maturation. Mol Endocrinol 16:1280–1298[Abstract/Free Full Text]
  48. Giovangrandi Y, Parfait B, Asheuer M, Olivi M, Lidereau R, Vidaud M, Bieche I 2001 Analysis of the human CGB/LHB gene cluster in breast tumors by real-time quantitative RT-PCR assays. Cancer Lett 168:93–100[CrossRef][Medline]
  49. Millar R, Lowe S, Conklin D, Pawson A, Maudsley S, Troskie B, Ott T, Millar M, Lincoln G, Sellar R, Faurholm B, Scobie G, Kuestner R, Terasawa E, Katz A 2001 A novel mammalian receptor for the evolutionarily conserved type II GnRH. Proc Natl Acad Sci USA 98:9636–9641[Abstract/Free Full Text]
  50. Millar RP 2005 GnRHs and GnRH receptors. Anim Reprod Sci 88:5–28[CrossRef][Medline]
  51. Cheng CK, Leung PC 2005 Molecular biology of gonadotropin-releasing hormone (GnRH)-I, GnRH-II, and their receptors in humans. Endocr Rev 26:283–306[Abstract/Free Full Text]
  52. Zhang FP, Rannikko AS, Manna PR, Fraser HM, Huhtaniemi IT 1997 Cloning and functional expression of the luteinizing hormone receptor complementary deoxyribonucleic acid from the marmoset monkey testis: absence of sequences encoding exon 10 in other species. Endocrinology 138:2481–2490[Abstract/Free Full Text]
  53. Gromoll J, Wistuba J, Terwort N, Godmann M, Müller T, Simoni M 2003 A new subclass of the luteinizing hormone/chorionic gonadotropin receptor lacking exon 10 messenger RNA in the New World monkey (Platyrrhini) lineage. Biol Reprod 69:75–80[Abstract/Free Full Text]
  54. Gromoll J, Lahrmann L, Godmann M, Müller T, Michel C, Stamm S, Simoni M 2007 Genomic checkpoints for exon 10 usage in the luteinizing hormone receptor type 1 and type 2. Mol Endocrinol 21:1984–1996[Abstract/Free Full Text]
  55. Müller T, Gromoll J, Simoni M 2003 Absence of exon 10 of the human luteinizing hormone (LH) receptor impairs LH, but not human chorionic gonadotropin action. J Clin Endocrinol Metab 88:2242–2249[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Toxicol PatholHome page
G. F. Weinbauer, M. Niehoff, M. Niehaus, S. Srivastav, A. Fuchs, E. Van Esch, and J. M. Cline
Physiology and Endocrinology of the Ovarian Cycle in Macaques
Toxicol Pathol, December 1, 2008; 36(7_suppl): 7S - 23S.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Henke, A.
Right arrow Articles by Gromoll, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Henke, A.
Right arrow Articles by Gromoll, J.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Hazardous Substances DB
*CHORIONIC GONADOTROPIN


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals