| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
BRIEF COMMUNICATION |
Service of Endocrinology, Diabetology, and Metabolism and Center for Cardiovascular and Metabolic Diseases (C.C.-V., M.G., R.S., R.C.G., F.P.P.), University Hospital, 1011 Lausanne, Switzerland; and Service of Endocrinology, Diabetology, and Metabolism (F.P.P.), University Hospital, 1211 Geneva, Switzerland
Address all correspondence and requests for reprints to: Dr. F. Pralong, M.D., Service of Endocrinology, BH 19-709, University Hospital, 1011 Lausanne, Switzerland. E-mail: Francois.Pralong{at}chuv.ch.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
) and two regulatory (ß and
) subunits. It is activated by nutritional or metabolic changes that promote increases in the ratio of AMP to ATP, thus playing the role of a cellular energy sensor. Activation of AMPK stimulates intracellular catabolic pathways that generate ATP while inhibiting anabolic pathways. In peripheral tissues, AMPK regulates many molecules and pathways controlling glucose and lipid uptake, storage and utilization, thus modulating energy expenditure (recently reviewed in Refs. 1 and 2). Obesity results from an imbalance between energy intake and energy expenditure. The control of food intake is achieved at least in part via highly specialized neurons located in the hypothalamus and modulated by peripheral metabolic signals such as insulin or leptin (3, 4). They can be broadly divided into two major groups: those generating signals that stimulate food intake (orexigenic), and those that inhibit feeding upon activation (anorexigenic) (5, 6). Prototypical members of the first group are neurons that coexpress neuropeptide Y (NPY) and agouti-related peptide. The second group comprises neurons that coexpress proopiomelanocortin (POMC) and the cocaine and amphetamine regulated transcript. Very recent data have implicated AMPK, which is mediating at least some of the metabolic actions of leptin in the periphery (7), in the control of food intake by the central nervous system; activation of hypothalamic AMPK in vivo increases food intake and body weight, whereas its inhibition has opposite effects (8, 9). Therefore, AMPK is emerging as a master metabolic switch, involved in the regulation of energy intake as well as energy expenditure (1, 2).
AMPK is also the only known intracellular target of the widely used oral antidiabetic agent metformin (10, 11). In addition to its role as a glucose-lowering drug, metformin is also exerting anorectic effects in humans (12, 13, 14), in rodents (15, 16), and even in birds (17). A central site of action has been postulated to explain this effect, but very little is known about the potential mechanism(s) implicated. Given the role played by AMPK in feeding regulations by hypothalamic neurons, we hypothesized that it could mediate the anorectic effects of metformin at the level of the central nervous system.
We used our model of dispersed primary rat hypothalamic neuronal cell cultures (18) to test this hypothesis, and to study the potential direct effects of metformin on the expression of orexigenic and anorexigenic peptides. In this study, we show that metformin is able to block the activation of AMPK induced by unfavorable metabolic conditions, thus reversing the concomitant increase observed in NPY expression. In contrast, POMC levels are not affected by the drug. These data demonstrate for the first time an effect of metformin on hypothalamic neurons. The differential regulation of NPY and POMC is consistent with a modulation of the effects of metformin via AMPK in these neurons.
| Materials and Methods |
|---|
|
|
|---|
Cultures are seeded at a density of 280 live cells per square millimeter in 6-well plates (Corning Costar Corp., Cambridge, MA) coated with 5 µg/ml poly-D-lysine (Sigma). After 48 h, 1 µM/liter cytosine ß-D-arabinofuranoside (Sigma) is added to prevent proliferation of nonneuronal cells. Forty-eight hours after cytosine ß-D-arabinofuranoside addition, two thirds of the medium is changed and replaced by Neurobasal with 0.05% B27 supplement containing 500 µmol/liter glutamine, no glutamate, penicillin/streptomycin (500 µmol/liter; Invitrogen AG), and fungizone (0.5 µg/ml; Life Technologies, Inc.). Two thirds of the medium is then changed every 72 h, and cells are maintained in culture for 3 wk before use.
Experiments were performed after 6 h of starvation of the cells in DMEM (Life Technologies, Inc.) at 5.5 mM glucose. For gene expression studies, cells were stimulated for 6 h either by low glucose (1 mM) or 5-aminoimidazole-4-carboxamide-1-ß-D-ribofuranoside (AICAR; Toronto Research Chemicals, Toronto, Ontario, Canada), an agonist of AMPK, used at the concentration of 1 mM (11). When necessary, AMPK blockade was achieved by adding compound C [(6-[4-(2-Piperidin-1-yl-ethoxy)-phenyl)]-3-pyridin-4-yl-pyyrazolo[1,5-a] pyrimidine; Merck Research Laboratories, Rahway, NJ], an inhibitor of AMPK phosphorylation, 1 h before stimulation of the cells. Compound C was used at the concentration of 20 mM (11). Metformin (Sigma) was used at the concentration of 1 mM (11), and added at the time of cell stimulation. At the end of the experiment, cells were lysed using a commercially available reagent (TRIzol; Invitrogen AG), and RNA was extracted following the manufacturers instructions. RNA was then quantified by absorbance with a spectrophotometer.
Experiments on AMPK phosphorylation were also performed over 6-h periods. At the end of the experiment, cells were lysed in 100 µl of a buffer containing 200 mM NaF, 20 mM NaPyroPo4, 150 mM NaCl, 50 mM HEPES, 4 mM NaVO4, 2% Triton X-100, 20% glycerol, 2 mM PMSF. The extracts were collected on ice, and total protein content always was measured following the Bradford method, with BSA as standard and using a commercially available kit (Bio-Rad Laboratories AG, Reinach, Switzerland).
Quantitative RT-PCR
First-strand cDNA was synthesized from 2 µg total RNA in a 20-µl reaction volume using oligo nucleotide [Oligo(dt) 15 Primer; Promega, Wallisellen, Switzerland] and superscript (Invitrogen AG) according to the manufacturers instructions.
Relative expression of NPY, POMC, and ß-actin (reference gene) was then assessed by real-time PCR using the LightCycler technology (Roche Diagnostics, Rotkreuz, Switzerland) with the Quantitect Sybr Green PCR Kit (Qiagen, Hilden, Germany) as previously described (19). cDNAs of interest were amplified using the following specific primers synthesized by Microsynth (Windish, Switzerland): sNPY (TCCGCTCTGCGACACTACAT) and asNPY (TGTTTTCCTTCATTAAGAGGTCTGA); sß-actin (CGTTGACATCCGTAAAGACC) and asß-actin (TAGAGCCACCAATCCACACA). sPOMC and asPOMC are commercially available primers, designed by and purchased from Qiagen AG (Hombrechtikon, Switzerland).
All samples were quantified in at least two runs, to obtain an interassay coefficient of variation (CV) less than 10%, and a negative control reaction in the absence of template was always added for each primer pair. Relative expression was then determined using crossing point values and amplification efficiencies of the target gene and the reference gene.
Western blots
For Western blot experiments, 20 µg protein per sample was run on a 10% SDS-polyacrylamide gradient gel and transferred onto polyvinylidene difluoride membranes (Hybond; Amersham Biosciences, Arlington Heights, IL). Blots were then blocked overnight at 4 C in TBST solution [10 mM Tris, HCL (pH 7.4), 150 NaCl, and 0.1% Tween] containing 5% skimmed milk. Then they were incubated overnight at 4 C in the same buffer containing the primary antibody. Membranes were first incubated with a commercially available antibody specific for the phosphorylated form of AMPK (Cell Signaling Technology, Inc., Beverly, MA). Protein-antibody complexes were visualized by the enhanced chemiluminescence system (ECL; Amersham Biosciences). Data were quantified by densitometric analysis of autoradiograms, using a computerized densitometer (Typhoon System; Molecular Dynamics, Inc., Sunnyvale, CA). Then the membranes were stripped and hybridized again with an antibody directed against total AMPK (Cell Signaling Technology, Inc.) to allow normalization. Both antibodies were used at a 1:2500 dilution.
Statistical analysis
All data are expressed as means ± SEM of a minimum of three separate experiments performed in duplicates. Statistical significance was assessed by ANOVA with Bonferroni post hoc correction. P < 0.05 was considered a significant difference.
| Results |
|---|
|
|
|---|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Metformin is an oral glucose-lowering agent, widely used in the treatment of type 2 diabetes. Our in vitro results demonstrate that metformin can modulate the activity of hypothalamic neurons and provide for the first time a possible mechanism for the anorectic effects of the drug (12, 13, 14, 15, 16, 17). In contrast, we did not observe any effect of metformin on the parallel inhibition of POMC expression induced by low glucose levels. This latter observation is consistent with the absence of relationship, in our cultured neurons, between variations in the phosphorylation of AMPK and variations in POMC gene expression. Together, these results support the specificity of the effects of metformin that we report here.
In muscle and liver cells, administration of metformin activates AMPK (10, 11), thus promoting fatty acid oxidation and inhibiting lipogenesis in the liver while stimulating glucose uptake by muscle cells (1, 2). We are now demonstrating that metformin is exerting an opposite effect on neuronal AMPK. If confirmed in vivo, our observation would be consonant with the recently described actions of leptin upon AMPK. Indeed, it is now established that leptin activates AMPK in skeletal muscle (7), while inhibiting it in the hypothalamus (1, 2, 8). This dual effect of leptin upon AMPK is not well understood. It may result from a different regulation of AMPK subunits in different tissues or from the implication of different regulators of AMPK in the muscle, in the liver, and in the hypothalamus. Irrespective of the potential mechanisms implicated, such dual regulation of AMPK between the periphery and the brain appears to be a generic theme. It is consistent with the effects noted for ghrelin and cannabinoids (20), although acting in opposite directions, and the present results suggest now that it is relevant for metformin as well.
The definitive physiological importance of the effect that we describe in this study will depend upon its confirmation in vivo, a limitation inherent to all in vitro experiments. However, based upon our previous work, we think that the model of primary neuronal cell cultures used in this study recapitulates many facets of in vivo hypothalamic regulations (18, 21). In this study, we used low glucose levels in the culture medium to simulate experimentally unfavorable metabolic conditions (22). Therefore, the increase in NPY levels and the decrease in POMC levels observed in this setting are also in good agreement with in vivo data (23). Furthermore, we did not observe any decrease in NPY levels from baseline when cells were incubated at 20 mM glucose (data not shown), again consistent with the hypothesis that NPY expression is at its lowest at physiological glucose concentrations (for review, see Ref. 24). Finally, we could confirm the absence of relationship between the level of AMPK phosphorylation and the expression of POMC in our culture system (8). Altogether, these findings demonstrate that NPY- and POMC-expressing neurons retain at least their most important physiologic regulation in our hypothalamic culture model, adding to the relevance of our observations.
Very little is known about the effects of metformin in the hypothalamus. An inhibition of food intake in Zucker fa/fa rats has been demonstrated (15), but NPY gene expression in the basal hypothalamus does not seem to be affected by metformin treatment in this model (25). However, it is somewhat difficult to correlate these in vivo data (15, 25) with the present results. Indeed, these authors studied rats after 14 days of metformin administration, a time point where steady-state NPY expression could have been reached. Moreover, the regulation of NPY gene expression in a monogenic model of animal obesity implicating resistance to leptin may not represent normal physiology. A recent study is reporting that 4 wk of metformin administration to either normal or high-fat-fed rats can potentiate the inhibition of hypothalamic AMPK by leptin, but is devoid of any effect of its own (26). However, the levels of NPY and agouti-related peptide expression in that study were similar between high-fat-fed rats and standard chow controls. Consistently, phosphorylated AMPK levels were also similar between the two groups of animals, and because the controls were fed ad libitum, these levels were presumably basal values. Therefore, these results (26) may indicate that metformin does not affect the basal activity of AMPK in vivo. Our present data are concordant with that study (26), because we observed no effect of metformin on unstimulated AMPK activity and NPY expression. Therefore, we can suggest in this study that the anorectic effect of metformin may become apparent only in conditions of increased hypothalamic AMPK activity, a hypothesis that remains to be directly tested in vivo.
It is currently hypothesized that the net food intake measured in a given individual is, at least in part, the result from an equilibrium existing between the activity of orexigenic and anorexigenic hypothalamic neurons (4, 5, 6). These neurons also act in conjunction with signals originating in hindbrain areas such as the nucleus of the solitary tract (27). This equilibrium arises from the central integration of humoral as well as neuronal peripheral signals, and is key to achieve the tight regulation of feeding and energy expenditure observed over time in most species. Given the redundancy of the system, it may appear useful in the future to associate different drugs modulating parallel (and potentially antagonist) pathways in a synergistic manner (28).
Metformin is a readily available drug. Its safety is well recognized in humans, but a precise knowledge of its central mechanism of action represents an absolute prerequisite to use this drug efficiently in such an association. Our results suggest that the anorectic effects of metformin are mediated via a modulation of hypothalamic AMPK, thus preventing increases in NPY gene expression while leaving POMC neurons unaffected. This information could be important for the future design of drug associations using metformin to modulate feeding behavior, with the hope to increase its efficacy as an anorectic agent in the human.
| Acknowledgments |
|---|
| Footnotes |
|---|
Disclosure Summary: The authors have nothing to disclose.
First Published Online November 9, 2006
Abbreviations: AICAR, 5-Aminoimidazole-4-carboxamide-1-ß-D-ribofuranoside; AMPK, AMP-activated kinase; NPY, neuropeptide Y; POMC, proopiomelanocortin.
Received September 8, 2006.
Accepted for publication November 2, 2006.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
H. Shimizu, H. Arima, M. Watanabe, M. Goto, R. Banno, I. Sato, N. Ozaki, H. Nagasaki, and Y. Oiso Glucocorticoids Increase Neuropeptide Y and Agouti-Related Peptide Gene Expression via Adenosine Monophosphate-Activated Protein Kinase Signaling in the Arcuate Nucleus of Rats Endocrinology, September 1, 2008; 149(9): 4544 - 4553. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Hou, S. Xu, K. A. Maitland-Toolan, K. Sato, B. Jiang, Y. Ido, F. Lan, K. Walsh, M. Wierzbicki, T. J. Verbeuren, et al. SIRT1 Regulates Hepatocyte Lipid Metabolism through Activating AMP-activated Protein Kinase J. Biol. Chem., July 18, 2008; 283(29): 20015 - 20026. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Christ-Crain, B. Kola, F. Lolli, C. Fekete, D. Seboek, G. Wittmann, D. Feltrin, S. C. Igreja, S. Ajodha, J. Harvey-White, et al. AMP-activated protein kinase mediates glucocorticoid-induced metabolic changes: a novel mechanism in Cushing's syndrome FASEB J, June 1, 2008; 22(6): 1672 - 1683. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. R. Ropelle, J. R. Pauli, K. G. Zecchin, M. Ueno, C. T. de Souza, J. Morari, M. C. Faria, L. A. Velloso, M. J. A. Saad, and J. B. C. Carvalheira A Central Role for Neuronal Adenosine 5'-Monophosphate-Activated Protein Kinase in Cancer-Induced Anorexia Endocrinology, November 1, 2007; 148(11): 5220 - 5229. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |