help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2006-1237
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chau-Van, C.
Right arrow Articles by Pralong, F. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chau-Van, C.
Right arrow Articles by Pralong, F. P.
Endocrinology Vol. 148, No. 2 507-511
Copyright © 2007 by The Endocrine Society

BRIEF COMMUNICATION

Metformin Inhibits Adenosine 5'-Monophosphate-Activated Kinase Activation and Prevents Increases in Neuropeptide Y Expression in Cultured Hypothalamic Neurons

Catherine Chau-Van, Marcella Gamba, Roberto Salvi, Rolf C. Gaillard and François P. Pralong

Service of Endocrinology, Diabetology, and Metabolism and Center for Cardiovascular and Metabolic Diseases (C.C.-V., M.G., R.S., R.C.G., F.P.P.), University Hospital, 1011 Lausanne, Switzerland; and Service of Endocrinology, Diabetology, and Metabolism (F.P.P.), University Hospital, 1211 Geneva, Switzerland

Address all correspondence and requests for reprints to: Dr. F. Pralong, M.D., Service of Endocrinology, BH 19-709, University Hospital, 1011 Lausanne, Switzerland. E-mail: Francois.Pralong{at}chuv.ch.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The oral antidiabetic agent metformin acts at least partially via an activation of AMP-activated kinase (AMPK) in liver and muscle cells. It has appeared recently that hypothalamic AMPK is a key regulator of feeding in mammals. Because metformin also exhibits anorectic effects in animal models as well as in humans, we hypothesized that AMPK may be a target of metformin in hypothalamic neurons. In this study, we show that, in primary cultures of rat hypothalamic neurons, low glucose levels stimulate the phosphorylation of AMPK, thus increasing neuropeptide Y (NPY) gene expression. The addition of metformin in low glucose conditions was found to block AMPK phosphorylation. Consistently, the stimulation of NPY observed in low glucose conditions was also inhibited by the drug. Proopiomelanocortin gene expression measured in parallel was inhibited under low glucose conditions, but in contrast to NPY, it was not dependent upon AMPK and not affected by metformin. Taken together, our data demonstrate that metformin can inhibit AMPK activity in hypothalamic neurons, thus modulating the expression of the orexigenic peptide NPY. These results provide, for the first time, a potential mechanism of action for the anorectic effects of metformin, a widely used drug that could represent a valuable adjunct to novel therapies aimed at modulating central feeding pathways.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THE SERINE/THREONINE PROTEIN kinase AMP-activated kinase (AMPK) is a heterotrimeric protein formed by a catalytic ({alpha}) and two regulatory (ß and {gamma}) subunits. It is activated by nutritional or metabolic changes that promote increases in the ratio of AMP to ATP, thus playing the role of a cellular energy sensor. Activation of AMPK stimulates intracellular catabolic pathways that generate ATP while inhibiting anabolic pathways. In peripheral tissues, AMPK regulates many molecules and pathways controlling glucose and lipid uptake, storage and utilization, thus modulating energy expenditure (recently reviewed in Refs. 1 and 2).

Obesity results from an imbalance between energy intake and energy expenditure. The control of food intake is achieved at least in part via highly specialized neurons located in the hypothalamus and modulated by peripheral metabolic signals such as insulin or leptin (3, 4). They can be broadly divided into two major groups: those generating signals that stimulate food intake (orexigenic), and those that inhibit feeding upon activation (anorexigenic) (5, 6). Prototypical members of the first group are neurons that coexpress neuropeptide Y (NPY) and agouti-related peptide. The second group comprises neurons that coexpress proopiomelanocortin (POMC) and the cocaine and amphetamine regulated transcript. Very recent data have implicated AMPK, which is mediating at least some of the metabolic actions of leptin in the periphery (7), in the control of food intake by the central nervous system; activation of hypothalamic AMPK in vivo increases food intake and body weight, whereas its inhibition has opposite effects (8, 9). Therefore, AMPK is emerging as a master metabolic switch, involved in the regulation of energy intake as well as energy expenditure (1, 2).

AMPK is also the only known intracellular target of the widely used oral antidiabetic agent metformin (10, 11). In addition to its role as a glucose-lowering drug, metformin is also exerting anorectic effects in humans (12, 13, 14), in rodents (15, 16), and even in birds (17). A central site of action has been postulated to explain this effect, but very little is known about the potential mechanism(s) implicated. Given the role played by AMPK in feeding regulations by hypothalamic neurons, we hypothesized that it could mediate the anorectic effects of metformin at the level of the central nervous system.

We used our model of dispersed primary rat hypothalamic neuronal cell cultures (18) to test this hypothesis, and to study the potential direct effects of metformin on the expression of orexigenic and anorexigenic peptides. In this study, we show that metformin is able to block the activation of AMPK induced by unfavorable metabolic conditions, thus reversing the concomitant increase observed in NPY expression. In contrast, POMC levels are not affected by the drug. These data demonstrate for the first time an effect of metformin on hypothalamic neurons. The differential regulation of NPY and POMC is consistent with a modulation of the effects of metformin via AMPK in these neurons.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture and experimental design
Hypothalamic neurons were derived from E18 or E19 rat fetuses as previously described (18). Briefly, hypothalami are rapidly dissected out from the fetus skull by two coronal cuts (anteriorly at the level of the optic chiasm and posteriorly at the level of the mammillary bodies) followed by two parasagittal cuts along the hypothalamic sulci and a final cut dorsally, at a depth of approximately 2 mm from the ventral surface of the tissue block. The dispersion is then performed mechanically in PBS with 0.05% glucose (Flucka Chemie GmbH, Buchs, Switzerland) and 100 µg/ml penicillin/streptomycin (Invitrogen AG, Basel, Switzerland): freshly excised whole hypothalami are gently passed several times through a Pasteur pipette. Nondispersed tissue is allowed to settle for 2 min, and supernatant is then transferred into a clean tube. The remaining pellet is resuspended in 1 ml PBS buffer, and mechanical dispersion is repeated twice. The supernatants are mixed and then centrifuged for 7 min at 650 rpm, and the cellular pellet is gently resuspended in Neurobasal medium (Life Technologies, Inc., Basel, Switzerland) with 0.05% B27 supplement (Life Technologies, Inc.) containing 500 µmol/liter glutamine, 25 µmol/liter glutamate (Sigma, Buchs, Switzerland), and 0.5 µg/ml fungizone (Life Technologies, Inc.). The viability is then assessed by Trypan blue exclusion and is typically between 30 and 40%, yielding approximately 2 x 105 live cells per hypothalamus.

Cultures are seeded at a density of 280 live cells per square millimeter in 6-well plates (Corning Costar Corp., Cambridge, MA) coated with 5 µg/ml poly-D-lysine (Sigma). After 48 h, 1 µM/liter cytosine ß-D-arabinofuranoside (Sigma) is added to prevent proliferation of nonneuronal cells. Forty-eight hours after cytosine ß-D-arabinofuranoside addition, two thirds of the medium is changed and replaced by Neurobasal with 0.05% B27 supplement containing 500 µmol/liter glutamine, no glutamate, penicillin/streptomycin (500 µmol/liter; Invitrogen AG), and fungizone (0.5 µg/ml; Life Technologies, Inc.). Two thirds of the medium is then changed every 72 h, and cells are maintained in culture for 3 wk before use.

Experiments were performed after 6 h of starvation of the cells in DMEM (Life Technologies, Inc.) at 5.5 mM glucose. For gene expression studies, cells were stimulated for 6 h either by low glucose (1 mM) or 5-aminoimidazole-4-carboxamide-1-ß-D-ribofuranoside (AICAR; Toronto Research Chemicals, Toronto, Ontario, Canada), an agonist of AMPK, used at the concentration of 1 mM (11). When necessary, AMPK blockade was achieved by adding compound C [(6-[4-(2-Piperidin-1-yl-ethoxy)-phenyl)]-3-pyridin-4-yl-pyyrazolo[1,5-a] pyrimidine; Merck Research Laboratories, Rahway, NJ], an inhibitor of AMPK phosphorylation, 1 h before stimulation of the cells. Compound C was used at the concentration of 20 mM (11). Metformin (Sigma) was used at the concentration of 1 mM (11), and added at the time of cell stimulation. At the end of the experiment, cells were lysed using a commercially available reagent (TRIzol; Invitrogen AG), and RNA was extracted following the manufacturer’s instructions. RNA was then quantified by absorbance with a spectrophotometer.

Experiments on AMPK phosphorylation were also performed over 6-h periods. At the end of the experiment, cells were lysed in 100 µl of a buffer containing 200 mM NaF, 20 mM NaPyroPo4, 150 mM NaCl, 50 mM HEPES, 4 mM NaVO4, 2% Triton X-100, 20% glycerol, 2 mM PMSF. The extracts were collected on ice, and total protein content always was measured following the Bradford method, with BSA as standard and using a commercially available kit (Bio-Rad Laboratories AG, Reinach, Switzerland).

Quantitative RT-PCR
First-strand cDNA was synthesized from 2 µg total RNA in a 20-µl reaction volume using oligo nucleotide [Oligo(dt) 15 Primer; Promega, Wallisellen, Switzerland] and superscript (Invitrogen AG) according to the manufacturer’s instructions.

Relative expression of NPY, POMC, and ß-actin (reference gene) was then assessed by real-time PCR using the LightCycler technology (Roche Diagnostics, Rotkreuz, Switzerland) with the Quantitect Sybr Green PCR Kit (Qiagen, Hilden, Germany) as previously described (19). cDNAs of interest were amplified using the following specific primers synthesized by Microsynth (Windish, Switzerland): sNPY (TCCGCTCTGCGACACTACAT) and asNPY (TGTTTTCCTTCATTAAGAGGTCTGA); sß-actin (CGTTGACATCCGTAAAGACC) and asß-actin (TAGAGCCACCAATCCACACA). sPOMC and asPOMC are commercially available primers, designed by and purchased from Qiagen AG (Hombrechtikon, Switzerland).

All samples were quantified in at least two runs, to obtain an interassay coefficient of variation (CV) less than 10%, and a negative control reaction in the absence of template was always added for each primer pair. Relative expression was then determined using crossing point values and amplification efficiencies of the target gene and the reference gene.

Western blots
For Western blot experiments, 20 µg protein per sample was run on a 10% SDS-polyacrylamide gradient gel and transferred onto polyvinylidene difluoride membranes (Hybond; Amersham Biosciences, Arlington Heights, IL). Blots were then blocked overnight at 4 C in TBST solution [10 mM Tris, HCL (pH 7.4), 150 NaCl, and 0.1% Tween] containing 5% skimmed milk. Then they were incubated overnight at 4 C in the same buffer containing the primary antibody. Membranes were first incubated with a commercially available antibody specific for the phosphorylated form of AMPK (Cell Signaling Technology, Inc., Beverly, MA). Protein-antibody complexes were visualized by the enhanced chemiluminescence system (ECL; Amersham Biosciences). Data were quantified by densitometric analysis of autoradiograms, using a computerized densitometer (Typhoon System; Molecular Dynamics, Inc., Sunnyvale, CA). Then the membranes were stripped and hybridized again with an antibody directed against total AMPK (Cell Signaling Technology, Inc.) to allow normalization. Both antibodies were used at a 1:2500 dilution.

Statistical analysis
All data are expressed as means ± SEM of a minimum of three separate experiments performed in duplicates. Statistical significance was assessed by ANOVA with Bonferroni post hoc correction. P < 0.05 was considered a significant difference.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Figure 1Go illustrates the effects of either low glucose concentration or AICAR (an AMPK agonist) upon the expression of NPY and POMC in primary hypothalamic neurons. This figure demonstrates that in our culture model, exposure to low glucose concentrations induces a 3-fold increase in NPY expression, together with a significant decrease in POMC mRNA levels. It also shows that a similar induction of NPY expression results from the addition of AICAR to cells maintained at normal glucose levels, suggesting the involvement of AMPK in the effect of low glucose on NPY. This hypothesis was also supported by our observation that AICAR at the concentration used stimulates the phosphorylation of AMPK (data not shown). In sharp contrast, the addition of AICAR at normal glucose concentrations does not modulate the expression of POMC.


Figure 1
View larger version (17K):
[in this window]
[in a new window]

  		FIG. 1. Effect of low glucose (1 mM) or AICAR (1 mM) on the expression of NPY (solid bars) and POMC (open bars), evaluated by their respective mRNA levels. All data expressed as percentage of control condition. a, P < 0.05; and b, P < 0.01 vs. control (5.5 mM glucose).

 
Figure 2Go shows that compound C, an inhibitor of AMPK phosphorylation, completely prevents the stimulation of NPY expression in low glucose conditions. These data are consistent with the results obtained with AICAR, and demonstrate that the stimulation of NPY expression after exposure to low glucose levels requires the activation of AMPK.


Figure 2
View larger version (11K):
[in this window]
[in a new window]

  		FIG. 2. Effect of compound C (20 mM), an inhibitor of AMPK phosphorylation, on basal and low glucose-stimulated NPY expression. a, P < 0.01 vs. control (5.5 mM); b, P < 0.01 vs. 1 mM glucose in the presence of compound C (CC, 20 mM).

 
Because metformin is an antidiabetic oral agent targeting AMPK (10, 11), our results on the involvement of this enzyme in the modulation of NPY expression in hypothalamic neurons prompted us to further evaluate the effects of metformin in our model. Figure 3Go shows that, in basal conditions, metformin interferes neither with NPY, nor with POMC expression. However, we found that, in the presence of metformin, low glucose levels fail to stimulate NPY expression. This effect of metformin is specific for NPY, because we did not observe any change in the inhibition of POMC expression induced by low glucose levels in similar conditions. Therefore, these results suggested to us that metformin may inhibit AMPK activation in hypothalamic neurons.


Figure 3
View larger version (14K):
[in this window]
[in a new window]

  		FIG. 3. Effect of metformin (1 mM) on basal and low glucose-stimulated NPY (solid bars) and POMC (open bars) expression. a, P < 0.01 vs. control (5.5 mM); b, P < 0.01 vs. 1 mM glucose in the presence of metformin; c, P < 0.05; and d, P < 0.01 vs. control (5.5 mM glucose).

 
Therefore, this hypothesis was tested further in our culture model. Figure 4Go represents the results of Western blot experiments, looking at AMPK phosphorylation after exposure to low glucose levels without or with the addition of metformin. These data demonstrate that the significant increase in AMPK phosphorylation induced by low glucose conditions can be completely inhibited by the addition of metformin.


Figure 4
View larger version (27K):
[in this window]
[in a new window]

  		FIG. 4. Effect of metformin (1 mM) on basal and low glucose-stimulated AMPK phosphorylation. a, P < 0.01 vs. control (5.5 mM); b, P < 0.01 vs. 1 mM glucose in the presence of metformin. P-AMPK, Phosphorylated AMPK; t-AMPK, total AMPK.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The discovery of physiological links between AMPK and the endocrine system has drawn renewed attraction for the study of its role and regulation (2). One fascinating new finding is that AMPK appears to represent an important regulator of food intake in specialized hypothalamic neurons, where it is the target of metabolic factors like insulin and leptin (1, 8). Here we show that metformin can block the increase in AMPK phosphorylation induced by low glucose levels in cultured hypothalamic neurons, suggesting that this enzyme could be a target of the drug in the central nervous system as well. Moreover, this effect was accompanied by a complete reversal of hypoglycemia-induced stimulation of NPY expression.

Metformin is an oral glucose-lowering agent, widely used in the treatment of type 2 diabetes. Our in vitro results demonstrate that metformin can modulate the activity of hypothalamic neurons and provide for the first time a possible mechanism for the anorectic effects of the drug (12, 13, 14, 15, 16, 17). In contrast, we did not observe any effect of metformin on the parallel inhibition of POMC expression induced by low glucose levels. This latter observation is consistent with the absence of relationship, in our cultured neurons, between variations in the phosphorylation of AMPK and variations in POMC gene expression. Together, these results support the specificity of the effects of metformin that we report here.

In muscle and liver cells, administration of metformin activates AMPK (10, 11), thus promoting fatty acid oxidation and inhibiting lipogenesis in the liver while stimulating glucose uptake by muscle cells (1, 2). We are now demonstrating that metformin is exerting an opposite effect on neuronal AMPK. If confirmed in vivo, our observation would be consonant with the recently described actions of leptin upon AMPK. Indeed, it is now established that leptin activates AMPK in skeletal muscle (7), while inhibiting it in the hypothalamus (1, 2, 8). This dual effect of leptin upon AMPK is not well understood. It may result from a different regulation of AMPK subunits in different tissues or from the implication of different regulators of AMPK in the muscle, in the liver, and in the hypothalamus. Irrespective of the potential mechanisms implicated, such dual regulation of AMPK between the periphery and the brain appears to be a generic theme. It is consistent with the effects noted for ghrelin and cannabinoids (20), although acting in opposite directions, and the present results suggest now that it is relevant for metformin as well.

The definitive physiological importance of the effect that we describe in this study will depend upon its confirmation in vivo, a limitation inherent to all in vitro experiments. However, based upon our previous work, we think that the model of primary neuronal cell cultures used in this study recapitulates many facets of in vivo hypothalamic regulations (18, 21). In this study, we used low glucose levels in the culture medium to simulate experimentally unfavorable metabolic conditions (22). Therefore, the increase in NPY levels and the decrease in POMC levels observed in this setting are also in good agreement with in vivo data (23). Furthermore, we did not observe any decrease in NPY levels from baseline when cells were incubated at 20 mM glucose (data not shown), again consistent with the hypothesis that NPY expression is at its lowest at physiological glucose concentrations (for review, see Ref. 24). Finally, we could confirm the absence of relationship between the level of AMPK phosphorylation and the expression of POMC in our culture system (8). Altogether, these findings demonstrate that NPY- and POMC-expressing neurons retain at least their most important physiologic regulation in our hypothalamic culture model, adding to the relevance of our observations.

Very little is known about the effects of metformin in the hypothalamus. An inhibition of food intake in Zucker fa/fa rats has been demonstrated (15), but NPY gene expression in the basal hypothalamus does not seem to be affected by metformin treatment in this model (25). However, it is somewhat difficult to correlate these in vivo data (15, 25) with the present results. Indeed, these authors studied rats after 14 days of metformin administration, a time point where steady-state NPY expression could have been reached. Moreover, the regulation of NPY gene expression in a monogenic model of animal obesity implicating resistance to leptin may not represent normal physiology. A recent study is reporting that 4 wk of metformin administration to either normal or high-fat-fed rats can potentiate the inhibition of hypothalamic AMPK by leptin, but is devoid of any effect of its own (26). However, the levels of NPY and agouti-related peptide expression in that study were similar between high-fat-fed rats and standard chow controls. Consistently, phosphorylated AMPK levels were also similar between the two groups of animals, and because the controls were fed ad libitum, these levels were presumably basal values. Therefore, these results (26) may indicate that metformin does not affect the basal activity of AMPK in vivo. Our present data are concordant with that study (26), because we observed no effect of metformin on unstimulated AMPK activity and NPY expression. Therefore, we can suggest in this study that the anorectic effect of metformin may become apparent only in conditions of increased hypothalamic AMPK activity, a hypothesis that remains to be directly tested in vivo.

It is currently hypothesized that the net food intake measured in a given individual is, at least in part, the result from an equilibrium existing between the activity of orexigenic and anorexigenic hypothalamic neurons (4, 5, 6). These neurons also act in conjunction with signals originating in hindbrain areas such as the nucleus of the solitary tract (27). This equilibrium arises from the central integration of humoral as well as neuronal peripheral signals, and is key to achieve the tight regulation of feeding and energy expenditure observed over time in most species. Given the redundancy of the system, it may appear useful in the future to associate different drugs modulating parallel (and potentially antagonist) pathways in a synergistic manner (28).

Metformin is a readily available drug. Its safety is well recognized in humans, but a precise knowledge of its central mechanism of action represents an absolute prerequisite to use this drug efficiently in such an association. Our results suggest that the anorectic effects of metformin are mediated via a modulation of hypothalamic AMPK, thus preventing increases in NPY gene expression while leaving POMC neurons unaffected. This information could be important for the future design of drug associations using metformin to modulate feeding behavior, with the hope to increase its efficacy as an anorectic agent in the human.


   Acknowledgments
 
We thank Drs. Marc Foretz, Juan Ruiz, and Luc Pellerin for helpful comments and discussions, Mrs. Chantal Verdumo and Micheline Glauser for their expert technical support, and Dr. R. E. Schwartz for kindly providing us with compound C.


   Footnotes
 
This work supported by Grant No. 320000-112075 from the Swiss National Science Foundation, and by a grant from the Novartis Foundation (both to F.P.P.).

Disclosure Summary: The authors have nothing to disclose.

First Published Online November 9, 2006

Abbreviations: AICAR, 5-Aminoimidazole-4-carboxamide-1-ß-D-ribofuranoside; AMPK, AMP-activated kinase; NPY, neuropeptide Y; POMC, proopiomelanocortin.

Received September 8, 2006.

Accepted for publication November 2, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kahn BB, Alquier T, Carling D, Hardie DG 2005 AMP-activated protein kinase: ancient energy gauge provides clues to modern understanding of metabolism. Cell Metab 1:15–25[CrossRef][Medline]
  2. Kola B, Boscaro M, Rutter GA, Grossman AB, Korbonits M 2006 Expanding role of AMPK in endocrinology. Trends Endocrinol Metab 17:205–215[CrossRef][Medline]
  3. Niswender KD, Baskin DG, Schwartz MW 2004 Insulin and its evolving partnership with leptin in the hypothalamic control of energy homeostasis. Trends Endocrinol Metab 15:362–369[CrossRef][Medline]
  4. Schwartz MW, Woods SC, Porte Jr D, Seeley RJ, Baskin DG 2000 Central nervous system control of food intake. Nature 404:661–671[Medline]
  5. Cowley MA, Pronchuk N, Fan W, Dinulescu DM, Colmers WF, Cone RD 1999 Integration of NPY, AGRP, and melanocortin signals in the hypothalamic paraventricular nucleus: evidence of a cellular basis for the adipostat. Neuron 24:155–163[CrossRef][Medline]
  6. Sainsbury A, Cooney GJ, Herzog H 2002 Hypothalamic regulation of energy homeostasis. Best Pract Res Clin Endocrinol Metab 16:623–637[CrossRef][Medline]
  7. Minokoshi Y, Kim YB, Peroni OD, Fryer LG, Muller C, Carling D, Kahn BB 2002 Leptin stimulates fatty-acid oxidation by activating AMP-activated protein kinase. Nature 415:339–343[CrossRef][Medline]
  8. Minokoshi Y, Alquier T, Furukawa N, Kim YB, Lee A, Xue B, Mu J, Foufelle F, Ferre P, Birnbaum MJ, Stuck BJ, Kahn BB 2004 AMP-kinase regulates food intake by responding to hormonal and nutrient signals in the hypothalamus. Nature 428:569–574[CrossRef][Medline]
  9. Kim EK, Miller I, Aja S, Landree LE, Pinn M, McFadden J, Kuhajda FP, Moran TH, Ronnett GV 2004 C75, a fatty acid synthase inhibitor, reduces food intake via hypothalamic AMP-activated protein kinase. J Biol Chem 279:19970–19976[Abstract/Free Full Text]
  10. Fryer LG, Parbu-Patel A, Carling D 2002 The anti-diabetic drugs rosiglitazone and metformin stimulate AMP-activated protein kinase through distinct signaling pathways. J Biol Chem 277:25226–25232[Abstract/Free Full Text]
  11. Zhou G, Myers R, Li Y, Chen Y, Shen X, Fenyk-Melody J, Wu M, Ventre J, Doebber T, Fujii N, Musi N, Hirshman MF, Goodyear LJ, Moller DE 2001 Role of AMP-activated protein kinase in mechanism of metformin action. J Clin Invest 108:1167–1174[CrossRef][Medline]
  12. Schultes B, Oltmanns KM, Kern W, Fehm HL, Born J, Peters A 2003 Modulation of hunger by plasma glucose and metformin. J Clin Endocrinol Metab 88:1133–1141[Abstract/Free Full Text]
  13. Lee A, Morley JE 1998 Metformin decreases food consumption and induces weight loss in subjects with obesity with type II non-insulin-dependent diabetes. Obes Res 6:47–53[Medline]
  14. Paolisso G, Amato L, Eccellente R, Gambardella A, Tagliamonte MR, Varricchio G, Carella C, Giugliano D, D’Onofrio F 1998 Effect of metformin on food intake in obese subjects. Eur J Clin Invest 28:441–446[CrossRef][Medline]
  15. Rouru J, Huupponen R, Pesonen U, Koulu M 1992 Subchronic treatment with metformin produces anorectic effect and reduces hyperinsulinemia in genetically obese Zucker rats. Life Sci 50:1813–1820[CrossRef][Medline]
  16. Bailey CJ, Flatt PR, Ewan C 1986 Anorectic effect of metformin in lean and genetically obese hyperglycaemic (ob/ob) mice. Arch Int Pharmacodyn Ther 282:233–239[Medline]
  17. Ashwell CM, McMurtry JP 2003 Hypoglycemia and reduced feed intake in broiler chickens treated with metformin. Poult Sci 82:106–110[Abstract/Free Full Text]
  18. Bergonzelli GE, Pralong FP, Glauser M, Cavadas C, Grouzmann E, Gaillard RC 2001 Interplay between galanin and leptin in the hypothalamic control of feeding via corticotropin-releasing hormone and neuropeptide Y. Diabetes 50:2666–2672[Abstract/Free Full Text]
  19. Giusti V, Suter M, Verdumo C, Gaillard RC, Burckhardt P, Pralong FP 2004 Molecular determinants of human adipose tissue: differences between visceral and subcutaneous compartments in obese women. J Clin Endocrinol Metab 89:1379–1384[Abstract/Free Full Text]
  20. Kola B, Hubina E, Tucci SA, Kirkham TC, Garcia EA, Mitchell SE, Williams LM, Hawley SA, Hardie DG, Grossman AB, Korbonits M 2005 Cannabinoids and ghrelin have both central and peripheral metabolic and cardiac effects via AMP-activated protein kinase. J Biol Chem 280:25196–25201[Abstract/Free Full Text]
  21. Burcelin R, Thorens B, Glauser M, Gaillard RC, Pralong FP 2003 Gonadotropin-releasing hormone secretion from hypothalamic neurons: stimulation by insulin and potentiation by leptin. Endocrinology 144:4484–4491[Abstract/Free Full Text]
  22. Lee K, Li B, Xi X, Suh Y, Martin RJ 2005 Role of neuronal energy status in the regulation of adenosine 5'-monophosphate-activated protein kinase, orexigenic neuropeptides expression, and feeding behavior. Endocrinology 146:3–10[Abstract/Free Full Text]
  23. Mizuno TM, Makimura H, Silverstein J, Roberts JL, Lopingco T, Mobbs CV 1999 Fasting regulates hypothalamic neuropeptide Y, agouti-related peptide, and proopiomelanocortin in diabetic mice independent of changes in leptin or insulin. Endocrinology 140:4551–4557[Abstract/Free Full Text]
  24. Schwartz MW, Woods SC, Seeley RJ, Barsh GS, Baskin DG, Leibel RL 2003 Is the energy homeostasis system inherently biased toward weight gain? Diabetes 52:232–238[Abstract/Free Full Text]
  25. Rouru J, Pesonen U, Koulu M, Huupponen R, Santti E, Virtanen K, Rouvari T, Jhanwar-Uniyal M 1995 Anorectic effect of metformin in obese Zucker rats: lack of evidence for the involvement of neuropeptide Y. Eur J Pharmacol 273:99–106[CrossRef][Medline]
  26. Kim YW, Kim JY, Park YH, Park SY, Won KC, Choi KH, Huh JY, Moon KH 2006 Metformin restores leptin sensitivity in high-fat-fed obese rats with leptin resistance. Diabetes 55:716–724[Abstract/Free Full Text]
  27. Grill HJ, Kaplan JM 2002 The neuroanatomical axis for control of energy balance. Front Neuroendocrinol 23:2–40[CrossRef][Medline]
  28. Yasuda N, Inoue T, Nagakura T, Yamazaki K, Kira K, Saeki T, Tanaka I 2004 Metformin causes reduction of food intake and body weight gain and improvement of glucose intolerance in combination with dipeptidyl peptidase IV inhibitor in Zucker fa/fa rats. J Pharmacol Exp Ther 310:614–619[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
H. Shimizu, H. Arima, M. Watanabe, M. Goto, R. Banno, I. Sato, N. Ozaki, H. Nagasaki, and Y. Oiso
Glucocorticoids Increase Neuropeptide Y and Agouti-Related Peptide Gene Expression via Adenosine Monophosphate-Activated Protein Kinase Signaling in the Arcuate Nucleus of Rats
Endocrinology, September 1, 2008; 149(9): 4544 - 4553.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X. Hou, S. Xu, K. A. Maitland-Toolan, K. Sato, B. Jiang, Y. Ido, F. Lan, K. Walsh, M. Wierzbicki, T. J. Verbeuren, et al.
SIRT1 Regulates Hepatocyte Lipid Metabolism through Activating AMP-activated Protein Kinase
J. Biol. Chem., July 18, 2008; 283(29): 20015 - 20026.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
M. Christ-Crain, B. Kola, F. Lolli, C. Fekete, D. Seboek, G. Wittmann, D. Feltrin, S. C. Igreja, S. Ajodha, J. Harvey-White, et al.
AMP-activated protein kinase mediates glucocorticoid-induced metabolic changes: a novel mechanism in Cushing's syndrome
FASEB J, June 1, 2008; 22(6): 1672 - 1683.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
E. R. Ropelle, J. R. Pauli, K. G. Zecchin, M. Ueno, C. T. de Souza, J. Morari, M. C. Faria, L. A. Velloso, M. J. A. Saad, and J. B. C. Carvalheira
A Central Role for Neuronal Adenosine 5'-Monophosphate-Activated Protein Kinase in Cancer-Induced Anorexia
Endocrinology, November 1, 2007; 148(11): 5220 - 5229.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chau-Van, C.
Right arrow Articles by Pralong, F. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chau-Van, C.
Right arrow Articles by Pralong, F. P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals