| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Molecular Cell Biology (D.V.M., R.Q., K.T., M.Be., M.Bo., F.C.S.), Katholieke Universiteit Leuven, 3000 Leuven, Belgium; and Howard Hughes Medical Institute (D.S., R.P., B.S., R.J.K.), Department of Biological Chemistry (R.J.K.), University of Michigan, Ann Arbor, Michigan 48105
Address all correspondence and requests for reprints to: Frans C. Schuit, M.D., Ph.D., Gene Expression Unit, Department of Molecular Cell Biology, KU-Leuven, Herestraat 49, B-3000 Leuven, Belgium. E-mail: Frans.Schuit{at}med.kuleuven.be.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(eIF2), a pivotal translation initiation factor. The decrease was rapid and detectable within 15 min and proportional to the range of glucose concentrations that also stimulate translation. Lowered net eIF2 phosphorylation was not associated with a detectable decrease in activity of any eIF2 kinase. Moreover, okadaic acid blocked glucose-induced eIF2 dephosphorylation, suggesting that the net effect was mediated by a protein phosphatase. Experiments with salubrinal on intact cells and nuclear inhibitor of protein phosphatase-1 (PP1) on cell extracts suggested that this phosphatase was PP1. The net effect contained, however, a component of glucose-induced folding load in the endoplasmic reticulum because coincubation with cycloheximide further amplified the effect of glucose on eIF2 dephosphorylation. Thus, the steady-state level of eIF2 phosphorylation in ß-cells is the result of a balance between folding-load-induced phosphorylation and PP1-dependent dephosphorylation. Because defects in the pancreatic endoplasmic reticulum kinase-eIF2 signaling system lead to ß-cell failure and diabetes, deregulation of the PP1 system could likewise lead to cellular dysfunction and disease. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(eIF2) phosphorylation, but the mechanism remains unclear (5). The present study focuses on a novel glucose-induced signaling pathway of general translation in which glucose activates an eIF2 phosphatase rather than deactivating an eIF2 kinase. Moreover, using in vitro data, we propose that this activation is Ca2+ dependent and mediated by protein phosphatase-1 (PP1).
In all eukaryotic cells, eIF2 forms a ternary complex with the translation initiator met-tRNA and GTP to allow the selection of the initiation codon (6). Phosphorylation of eIF2 at serine-51 inhibits this complex formation and thus attenuates general translation (7, 8). Four different protein kinases are currently known to phosphorylate eIF2 at Ser51 (reviewed in Refs. 9 and 10). One of these is the pancreatic endoplasmic reticulum kinase (PERK) that couples protein translation rate with the capacity for protein folding in the endoplasmic reticulum (ER) (11). Interestingly, the PERK-signaling pathway has been observed to be crucial to avoid ER stress in the ß-cell. Expression of PERK is high in the pancreas, and inactivating mutations in the PERK gene causes progressive ß-cell loss and diabetes in mice and humans (12). In a physiological setting, accumulation of unfolded protein in the ER activates PERK as one of the essential elements of the physiological unfolded protein response pathway (13, 14, 15, 16, 17). Consistent with the crucial role of this pathway for the ß-cell are recently developed mouse models in which the codon encoding eIF2-Ser51 is mutated to encode an alanine. The homozygous eIF2A/A mice die within 24 h after birth with severe ß-cell hypoplasia (18), whereas heterozygous eIF2S/A animals are phenotypically normal but susceptible to development of diabetes upon environmental stress of a moderately high-fat diet. Diabetes develops in this model as ß-cells develop distended ER and lose their capacity for glucose-stimulated insulin secretion (19).
Because we observed that a 50% reduced capacity of eIF2-Ser51 phosphorylation increases the maximal rate of glucose-stimulated translation in islets (18) and because it is well known that eIF2 phosphorylation is essential for ß-cell function and survival (18, 19), we questioned how the dephosphorylation of this residue is regulated acutely by glucose. In the literature, a chronic signaling cascade has been proposed involving PP1 (20, 21) and growth arrest and DNA damage inducible protein 34 (GADD34), one of its regulators, which is responsible for the derepression of translation once the unfolded protein state is resolved (22, 23). In the present study, we report that glucose acutely activates a phosphatase resulting in an acute dephosphorylation of eIF2. Moreover, immunoprecipitation data using Ppp1r1a [inhibitor-1 (I-1)] suggests the existence of a trimeric complex between eIF2, PP1, and I-1 in MIN6 cells (murine pancreatic ß-cell line). Thus, a new model of translational control in the ß-cell represents a balance between unfolded insulin-induced PERK-mediated eIF2 phosphorylation and glucose-dependent PP1-mediated eIF2 dephosphorylation. In the normal ß-cell, the latter component prevails when glucose levels rise within the physiological limits.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
phosphorylation. MIN6 cells were kindly provided by Dr. E. Yamato (Osaka University, Osaka, Japan) and cultured in DMEM (25 mM glucose) equilibrated with 5% CO2 and 95% air at 37 C. The medium was supplemented with 15% fetal calf serum, 50 mg/liter streptomycin, and 75 mg/liter penicillin sulfate. MIN6 cells (10 x 106) were suspended in DMEM containing 25 mM glucose for 16 h before use. MEF cells were used as described earlier (18). All procedures involving mouse islets were conducted according to protocols and guidelines approved by the Katholieke Universiteit Leuven animal welfare committee.
Measurement of glucose-induced translation and insulin release
MIN6 cells or freshly isolated islets were treated in the indicated glucose concentrations with or without thapsigargin (Tg; 1 µM), cycloheximide (Chx; 10 µg/ml), salubrinal (Sal; 50 µM), and okadaic acid (OA; 0.01 or 1 µM). OA was added during the preincubation period of 1 h, Sal was added during a suspension period of 16 h, before the preincubation. Samples of 25 x 104 MIN6 cells or 25 islets were preincubated in 1 mM glucose containing Earle’s HEPES buffer for 60 min at 37 C. The samples were pulsed with 50 µCi of L-[3,5-3H]tyrosine (Amersham Biosciences, Freiburg, Germany) for 60 min and washed four times with 4 ml Earle’s HEPES buffer containing 2 mM unlabeled tyrosine. The washed cell pellet was extracted in lysis buffer [1% Nonidet P-40, 50 mM Tris (pH 8.0), 150 mM NaCl, 0.1 mg/ml phenylmethylsulfonylfluoride,150 mM NaF, 0.5 mM sodium orthovanadate, 50 mM B-glycerol phosphate, protease (Roche), and phosphatase inhibitors (Sigma, Steinheim, Germany)]. Total protein from the extract was precipitated in ice-cold 10% (v/v) trichloroacetic acid (TCA), adding 2 mg carrier albumin per sample. The TCA pellets were solubilized in 1 M NaOH, neutralized with 1 M HCl, mixed with 5 ml of Lumasafe Plus (Lumac, Groningen, The Netherlands), and counted in a ß counter (Wallac 1409, Turku, Finland). Insulin release was measured as earlier described (24). To assess the time course and concentration dependency of glucose on protein synthesis and insulin release from MIN6 cells, the cells were preincubated in Earle’s HEPES buffer containing 1 mM glucose at 37 C and incubated at the indicated glucose levels.
Production of polyclonal antiphospho-eIF2 and anti-I-1 antisera
Antibodies were raised against QIRRRRPTPATLVLTSDQ for I-1 and MILLSELSRRRIRSI with a phosphorylated serine 51 (bold "S") for eIF2. Each peptide was coupled to Imject malamide-activated ovalbumin and keyhole limpet hemocyanin protein (Pierce, Rockford, IL), and 100 µg was used to immunize New Zealand white rabbits. The animals were injected sc with antigen in Freund’s complete adjuvant and boosted after 14 d using Freund’s incomplete adjuvant. Serum was affinity-purified over CNBr-activated Sepharose 4 fast flow beads (Amersham, Uppsala, Sweden) linked to the peptide-ovalbumin complex. After concentration of the purified serum using a Vivaspin column (Vivascience AG, Hannover, Germany), aliquots of 25 µl were stored in –20 C.
Immunoblotting
Different tissues (liver, lung, kidney, brain, pituitary, adipose tissue, and skeletal muscle) were isolated from male C57Bl/6 mice and homogenated using Ultra Turrax mixer (Ika, Wilmington, NC) in lysis buffer (see above). Lysates were clarified by centrifugation at 8000 rpm for 5 min in a microcentrifuge at 4 C. Total lysate was obtained after centrifugation at 8000 rpm for 10 min at 4 C. To detect the phosphorylated and the total form of eIF2 in MIN6 cells, the samples were electrophoretically separated on a 4–12% NuPage gel (Invitrogen, Carlsbad, CA). Samples were transferred to nitrocellulose membranes (Amersham Biosciences) and blocked in blocking buffer (LI-COR Biotechnology, Lincoln, NE). For MIN6 cell samples, the blots were incubated simultaneously with mouse-anti-eIF2 total (1/2,000) (18) and rabbit-antiphospho-eIF2 (1/2,000) (affinity purified as described above) for 1 h, followed by washing and incubation with a mixture of donkey antimouse IRdye 800 (1/10,000) (Rockland Immunochemicals, Gilbertsville, PA) and goat antirabbit Alexa 680 (1/10,000) (Molecular Probes, Eugene, OR). The relative abundance of phosphorylated over total eIF2 was quantified using the Odyssey Infrared Imaging System. To quantify the protein expression level of I-1 and PP1, mouse tissue samples were transferred to a Hybond-P (Amersham Biosciences) membrane that was blocked in Tris-buffered saline + 5% nonfat milk. The primary antisera were diluted as follows: anti-I-1 (1/2,000) (affinity purified from our own antiserum as described above), anti-PP1 (1/5,000) (25), and anti-ß-actin (1/20,000, Santa Cruz Biotechnology, Inc., Santa Cruz, CA). The secondary antibody was horseradish peroxidase-conjugated goat antirabbit serum (1/2,500) (BD Biosciences, Rockville, MD). Chemiluminescence was detected using the ECL reagents (Amersham Biosciences).
Assays for measuring the eIF2 phosphorylation state in MIN6 cells
An in situ kinase assay consisted in preincubation of batches of MIN6 cells at 20 mM glucose containing Earle’s HEPES. At time point zero, the cells were replaced in medium containing either 1 or 20 mM glucose supplemented with 1 µM OA. The cells were harvested at the indicated times, and lysates were prepared as described above. An in vitro phosphorylation assay was started by making cell lysate in lysis buffer without phosphatase inhibitors and this lysate, followed by incubation with 1 mM ATP and 5 mM Mg2+ with the indicated substrates. The eIF2 phosphorylation effect of the different substrates was monitored by immunoblotting of samples taken at the indicated time points. An in vitro dephosphorylation assay was performed by making similar lysates that were preincubated with 1 mM ATP and 5 mM Mg2+ for 45 min, after which 1 mM EDTA was added. Next, the samples were incubated with the indicated substrates. The eIF2 dephosphorylation effect of the different substrates was monitored by taking samples at the indicated time points. Samples were loaded on a 4–12% NuPage gel (Invitrogen), and the detection was done as described above. In each lane, 20 µg protein was loaded. During a GST-eIF2-32P dephosphorylation assay, recombinant glutatione-S-transferase (GST)-eIF2 was phosphorylated using 2 µl [32P]ATP (Amersham Biosciences) with maternal embryonic leucine zipper kinase in a phosphorylation buffer (100 µM cold ATP, 2 mM Mg2+ acetate, 5 mM glycilglycine, 1 mM dithiothreitol,0.5 mM 2-mercapto-ethanol, 8 mM Tris, and 16 mM KCl, pH 7.4) for 30 min at 30 C. MIN6 cells were preincubated in 1 mM glucose containing Earle’s HEPES medium (G1) for 1 h at 37 C and incubated at 1 mM glucose or 20 mM glucose (G20) for 1 h at 37 C. Lysates were made from these cells using lysis buffer (50 mM Tris, 150 mM KCl, 1% Nonidet P-40, 1 mM dithiothreitol, 0.1 mg/ml phenylmethylsulfonylfluoride) and incubated for the indicated times with the phosphorylated GST-eIF2-32P. After the incubation, the samples were electrophoretically separated on a 4–12% NuPage gel, and the gel was stained with Coomassie reagent. After destaining and drying, an autoradiograph of the gel was made.
Immunoprecipitation
MIN6 cells were resuspended in DMEM containing 25 mM glucose for 16 h and treated with lysis buffer (see above) for 10 min at 4 C. Cell debris was discarded after centrifugation for 10 min at 8000 rpm and 4 C. Supernatants were immunoprecipitated by incubation at 4 C with the I-1 antibody coupled to Protein A Sepharose (Affiland, Liege, Belgium). Beads were washed, boiled in reducing sample preparation buffer, and subjected to SDS–PAGE.
mRNA analysis of I-1
mRNA analysis was performed as previously described (26). Control tissues and pancreatic islets were isolated from male C57BL/6 mice at 12 wk of age and snap frozen in liquid nitrogen. Total RNA of control tissues was extracted using the TRIzol Reagent (Invitrogen), followed by RNA clean-up using the RNeasy mini kit (QIAGEN, Cologne, Germany) according to the manufacturer’s protocols. Oligonucleotide sequences used for quantitative RT-PCR were as follows: forward I-1, 5'-GGAGCCACTGAGAGCACA-3'; reverse I-1, 5'-ACACTGCTCCTGAGTCTTGG-3'; probe I-1, 5'-(6-FAM)CCAGACACAGGCTCGGCGTCAAGG(TAMRA)-3'; forward beta-actin, 5'-AGCCATGTACGTAGCCATCCA-3'; reverse beta-actin, 5'-TCTCCGGAGTCCATCACAATG-3'; probe beta-actin, 5'-(6-FAM)TGTCCCTGTATGCCTCTGGTCGTAC(BHQ1)-3'.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
dephosphorylation in primary and clonal ß-cells phosphorylation is known to attenuate translation, we first tested the hypothesis that the acceleration of protein synthesis in pancreatic mouse islets by glucose is linked to a state of eIF2 dephosphorylation. As estimated from rates of [3H]tyrosine incorporation into TCA-insoluble cell extract, elevation from 1 to 10 mM glucose resulted in a 4-fold acceleration of total protein synthesis in mouse islets (Fig. 1
, upper panel). Coincident with this increase, the eIF2 phosphorylation of the total cellular extract was reduced by almost 50% (Fig. 1, lower panel). Incubation with Tg, a sarco/endoplasmic reticulum Ca2+ ATPase pump inhibitor and pharmacological inducer of ER stress (27), overruled the effect of high glucose, enhancing eIF2 phosphorylation and reducing overall translation to rates intermediate between those at low and high glucose. The effect of glucose upon eIF2 phosphorylation and overall translation was not observed in pancreatic acinar cells and mouse embryonic fibroblasts (data not shown). Thus, the data indicate that cell-specific glucose stimulation of general translation in the ß-cell is linked to a rapid action at the level of eIF2 dephosphorylation.
|
phosphorylation were analyzed. Because large numbers of cells were required for these studies, we performed experiments on the murine pancreatic ß-cell line MIN6, a surrogate model for the primary ß-cell that is known to be glucose-responsive (28, 29). Moreover, we performed some modifications in the phospho-specific eIF2 immunoblotting protocol allowing a one-step dual detection of total- and Ser51phospho-eIF2. As was observed before in primary ß-cells and MIN6 cells (24), overall translation in MIN6 cells was acutely stimulated by glucose (Fig. 2A) in the range of 1–10 mM, with maximal sensitivity between 2 and 5 mM, whereas higher glucose concentrations were required to activate insulin release. To assess the time dependency of translational activation, we preincubated the cells with 1 mM glucose and radioactive tracer and subsequently incubated in either 1 or 10 mM glucose at time = 0. As illustrated in Fig. 2B, the acceleration of translation by glucose is rapid, with an estimated lag time of less than 10 min, i.e. even more rapidly than proposed in previous estimations (29). Therefore, in the MIN6 cell, a very rapid and powerful overall control of translation exists, which allows for acceleration of protein synthesis when the concentration of extracellular glucose rises. The concentration dependency of glucose-induced eIF2 dephosphorylation (Fig. 2C, upper panel) was very similar to that of stimulation of translation, further supporting the hypothesis that stimulation of translation occurs in these cells through a reduction of eIF2 phosphorylation levels, confirming earlier results (5).
|
phosphorylation in the presence of the high glucose conditions that promoted reduction of eIF2 phosphorylation. First, as was observed in islets, Tg completely reversed the effects of high glucose. Second, Chx, a potent inhibitor of translation elongation, was applied to reduce the folding load upon the ER. Thus, in the absence of ongoing stimulation of PERK and eIF2 phosphorylation, increasing glucose concentration more strongly promoted eIF2 dephosphorylation (Fig. 2C
, lower panel).
Glucose activation of translation depends on stimulation of an eIF2 phosphatase, rather than on the deactivation of an eIF2 kinase
The overall effect of glucose upon eIF2 dephosphorylation could be the result of the stimulation of a phosphatase or the reduced activity of an eIF2 kinase. Because PERK is highly expressed in the ß-cell and is essential for ß-cell survival (30), we studied the acute effect of glucose upon PERK activation/phosphorylation in MIN6 cells (Fig. 3A), confirming earlier results (5). There was no significant level of PERK activation at 1 mM glucose, the condition with the highest level of eIF2 phosphorylation and the lowest rate of translation, nor did the level of phosphorylation detectably change upon incubation with 10 mM glucose. However, in the presence of the ER stressor Tg, 10 mM elicited a robust phosphorylation of PERK, indicating that the kinase was not blocked from activation. Cellular extracts were prepared from PERK null MEFs and were used as a negative control for antibody specificity (Fig. 3A, right). These results suggest that a shift in the activation status of the eIF2 kinase PERK is not primarily responsible for the glucose-induced eIF2 dephosphorylation and activated translation. To explore further whether high glucose deactivates PERK or other eIF2 kinases, we performed an in situ kinase assay (Fig. 3, B and C) in which the cells were incubated for different time periods at low and high glucose in the presence of OA and inhibitor of phosphatases. Similar rates of phosphorylation were measured at low and high glucose, suggesting that the main effect of glucose is not mediated by deactivation of an eIF2 kinase. Next, we performed experiments where we incubated recombinant GST-eIF2, which was phosphorylated in vitro with radioactive 32P, with lysates of MIN6 cells, which had been at low (1 mM) or high (20 mM) glucose (Fig. 3D). The lysates from cells that were incubated at high glucose showed increased eIF2 dephosphorylation activity, suggesting that glucose activates an eIF2 dephosphorylation pathway in the ß-cell.
|
dephosphorylation is the result of increased phosphatase activity, we treated both freshly isolated islets of Langerhans and MIN6 cells with the phosphatase inhibitor OA before exposing them to 1 mM glucose + OA and 10 mM glucose + OA to stimulate translation. Concentrations of OA in the low nanomolar range (31), which inhibit PP2A but have no effect on PP1, had no impact on glucose-stimulated translation. In contrast, concentrations of OA in the high nanomolar/micromolar range, which are inhibitory to PP1 (32), were required to inhibit glucose-stimulated translation, both in MIN6 cells and islets (Fig. 4, A and B). Treatment of islets with OA completely reversed high glucose-induced eIF2 dephosphorylation (Fig. 4C). Hence, we treated MIN6 cells with 50 µM Sal, a specific inhibitor of PP1 complexes, but not of PP2A (33). As is shown in Fig. 4D, the stimulatory effect of glucose on translation in MIN6 cells was counteracted by preincubation in the presence of Sal. This inhibitory effect appears to be competitive with glucose activation, because the greatest difference was noted when the cells were stimulated by 1 mM glucose, whereas inhibition was no longer seen at 20 mM glucose.
|
dephosphorylation were found using assays on cell extracts. Both high glucose and the glycolytic metabolite glucose-6-phosphate were found to slow down the rate of overall eIF2 phosphorylation of MIN6 cell lysates (Fig. 4E), suggesting that glucose activates a dephosphorylation pathway. Second, the in vitro dephosphorylation assay (Fig. 4F), using EDTA as a Ca2+ chelator, suggests that Ca2+ is needed for glucose mediated eIF2 dephosphorylation. Third, using 1 mM EGTA, which is a better chelator of Ca2+, instead of EDTA, the dephosphorylation of eIF2 was completely blocked (data not shown). Finally, addition of nuclear inhibitor of PP1 (34) to the dephosphorylation mix (Fig. 4F, lower panel) also inhibits the eIF2 dephosphorylation (Fig. 4F, upper panel). Together, these data thus indicate that glucose-induced change of eIF2 phosphorylation primarily depends on the regulation of PP1 activity in the ß-cell, using a signaling cascade that requires the presence of Ca2+.
Inhibitor-1 forms a trimeric complex with PP1 and eIF2 in MIN6 cells
The multifunctionality of PP1 depends on its association with various proteins (20). We screened for possible interactors of PP1 using microarrays and observed that Ppp1r1a (I-1) had a significantly higher mRNA expression in islets and MIN6 cells compared with other tissues (data not shown). Using a quantitative RT-PCR, we confirmed that I-1 mRNA was more abundant in mouse islets than in a panel of other mouse tissues, including brain, skeletal muscle, and pituitary (Fig. 5A). Moreover, very high I-1 mRNA expression levels were observed in MIN6 cells. To assess whether this is also the case at the protein level, we generated a polyclonal antirabbit I-1 antiserum and measured I-1 protein abundance in the same tissue panel (Fig. 5B). Very high abundance of the full-length protein was indeed observed both in primary islets and in MIN6 cells, suggesting that the inhibitor plays a particular and yet unrecognized role in the regulation of phosphatase activity in the ß-cell.
|
was found by immunoprecipitation of MIN6 cell lysates with the I-1 antiserum because immunoreactive PP1 and eIF2 could be detected in the precipitates (Fig. 5C), suggesting that a protein complex exists in MIN6 cells that includes I-1, PP1, and eIF2 in MIN6 cells (Fig. 5C). Preincubation for 1 h in either 1 or 20 mM glucose, however, did not have an effect on the presence and amount of PP1 or eIF2 in the complex (data not shown). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in the pancreatic ß-cell is an important control site of energy homeostasis in vivo that can, when deregulated, give rise to several disease states such as insulin deficiency and progressive ß-cell loss (12) or glucose unresponsiveness of ß-cells and failure to fold proinsulin correctly (19). This work has underlined the importance of a surveillance system based upon the ER chaperone BiP (35) and the ER membrane-resident eIF2 kinase PERK that prevents the accumulation of unfolded protein in the ER (36). Moreover, it was also shown previously in HEK293T, a non-endocrine cell line, that a subacute consequence of ER stress is the increased formation of a signaling complex between GADD34, PP1, and I-1, but this effect is only detected after several hours and requires protein synthesis (22). The accomplished effect is believed to promote eIF2 dephosphorylation that helps cells to recover from a period of ER stress and to adapt to a higher level of ER folding charge (37). In the present study, we provide evidence for the idea that eIF2 can also be rapidly dephosphorylated by a physiological stimulus via a signaling pathway that activates PP1. We propose on the basis of acute glucose-stimulation experiments in the ß-cell and in MIN6 cells that another level of regulation exists in which PP1 is inhibited at basal glucose levels and acutely activated when glucose levels rise. Thus, a model of balance can be proposed in which glucose enhances overall translation in the pancreatic ß-cell (24) by activating PP1 to dephosphorylate eIF2 (Fig. 6). As such, this action brings new preproinsulin into the ER compartment, hereby burdening the protein folding capacity and causing interactions with the ER chaperone BiP (19). This stimulatory effect is countered in part by PERK-mediated rephosphorylation of eIF2. The eIF2-kinase arm thus represents a brake system preventing excessive loading of the ER compartment with unfolded protein.
|
phosphorylation is not primarily induced by ameliorating the folding conditions in the ER lumen, e.g. by promoting sarco/endoplasmic reticulum Ca2+ ATPase-depending calcium influx, improving the ATP/ADP ratio, or ensuring a reducing environment required for the formation of the right disulfide bonds. The in situ kinase experiment shows that high glucose does not deactivate any eIF2 kinase, and the PERK immunoblots directly show that the level of ER stress in MIN6 cells is low at basal glucose compared with acute pharmacologically induced ER stress. On the contrary, it seems that a minor degree of folding stress is induced by raising the glucose level, as is shown indirectly by Chx-induced exaggeration of eIF2 dephosphorylation at high glucose. This may mean that the PERK attenuation arm of translational control operates at low intensity under physiological conditions of stimulation and only becomes strong when folding conditions deteriorate, e.g. by a high-fat diet in vivo. It is an interesting point of future research to assess whether other factors, which are present in the circulation or accumulate in ß-cells, can negatively influence ER folding conditions so that ER stress occurs and the insulin biosynthetic rates fall, because such conditions are expected to cause glucose intolerance and diabetes.
The molecular evidence for a glucose-sensitive PP1 signaling complex could include a very elevated level of I-1 gene expression in the pancreatic islet. However, it should be noted that a signaling complex between PP1, eIF2, and Nck was recently detected in Hela cells (38). Its unique function in the ß-cell may be that under basal conditions, metabolic flux is so low that the I-1 represses the catalytic subunits of PP1. Only when glucose rises above a certain threshold is PP1 derepressed, analogous to the glucose-induced shift in PP1 activity by the liver-type glycogen-targeting subunit PP1 regulator (20, 39). We are currently investigating the expression of glycogen-targeting subunits in the ß-cell and do not exclude that under certain circumstances such regulators can participate in the glucose-induced PP1-mediated eIF2 dephosphorylation. In fact, the immunoprecipitation experiments do not rule out that these regulators of PP1 are present in the signaling complex. We have tried to detect the PP1 regulator GADD34 but obtained negative results (data not shown).
In summary, our data show that rapid activation of translation in ß-cells depends on glucose-induced PP1-mediated eIF2 dephosphorylation. As genetic and environmental factors that disturb the balance in the eIF2 phosphorylation state in ß-cells can trigger ß-cell dysfunction and cell death (19), it may be of interest to investigate the involvement of still unknown regulators of PP1 in this signaling pathway in the pathogenesis of diabetes.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
This work was supported by the Juvenile Diabetes Research Foundation (Grant 1-2002-801), the KU-Leuven (Grant GOA/2004/11, to F.C.S.), and National Institutes of Health Grant DK42394 (to R.J.K.).
First Published Online November 2, 2006
Abbreviations: Chx, Cycloheximide; eIF2, eukaryotic translation initiation factor 2; ER, endoplasmic reticulum; GADD34, growth arrest and DNA damage inducible protein 34; GST, glutathione-S-transferase; I-1, inhibitor 1; PERK, pancreatic ER kinase; PP1, protein phosphatase-1; TCA, trichloroacetic acid; Tg, thapsigargin.
Received July 27, 2006.
Accepted for publication October 23, 2006.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. J Biol Chem 279:53937–53946 subunit of initiation factor 2 (eIF2) to the regulatory subunits of guanine nucleotide exchange factor eIF2B is required for inhibition of translation initiation. Mol Cell Biol 21:5018–5030. J Cell Biol 153:1011–1022 dephosphorylation protects cells from ER stress. Science 307:935–939 signaling and cell survival to endoplasmic reticulum stress. J Biol Chem 281:26633–26644This article has been cited by other articles:
 |
|
 |
|
  D. Scheuner and R. J. Kaufman The Unfolded Protein Response: A Pathway That Links Insulin Demand with {beta}-Cell Failure and Diabetes Endocr. Rev., May 1, 2008; 29(3): 317 - 333. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Thomas, L. M. Dias, and G. J. Johannes Translational repression during chronic hypoxia is dependent on glucose levels RNA, April 1, 2008; 14(4): 771 - 781. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Eizirik, A. K. Cardozo, and M. Cnop The Role for Endoplasmic Reticulum Stress in Diabetes Mellitus Endocr. Rev., February 1, 2008; 29(1): 42 - 61. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Nguyen, A. Nishi, J. W. Kansy, J. Fernandez, K. Hayashi, F. Gillardon, H. C. Hemmings Jr., A. C. Nairn, and J. A. Bibb Regulation of Protein Phosphatase Inhibitor-1 by Cyclin-dependent Kinase 5 J. Biol. Chem., June 1, 2007; 282(22): 16511 - 16520. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
0.001; **, P 
) and insulin release (
) were measured during a 1-h incubation at different glucose concentrations as indicated, after a preincubation of 1 h in 1 mM glucose. Data represent means ± SEM of seven experiments; significance of differences with incubation at 1 mM glucose was calculated with the unpaired Student’s t test. +, P < 0.001; *, P < 0.05. B, Glucose acutely regulates total protein synthesis. Protein synthesis was measured by preincubating MIN6 cells for 1 h in 1 mM glucose followed by incubation at different time points in 1 (
