Endocrinology, doi:10.1210/en.2006-1390
Endocrinology Vol. 148, No. 4 1518-1523
Copyright © 2007 by The Endocrine Society
Generation of Transgenic Rats Expressing Green Fluorescent Protein in S-100ß-Producing Pituitary Folliculo-Stellate Cells and Brain Astrocytes
Eisuke Itakura,
Kousuke Odaira,
Kotaro Yokoyama,
Marumi Osuna,
Takahiko Hara and
Kinji Inoue
Department of Regulatory Biology (E.I., K.O. K.Y., M.O, K.I.), Graduate School of Science and Engineering, Saitama University, Sakura-ku, Saitama 338-8570, Japan; and Stem Cell Project Group (T.H.), The Tokyo Metropolitan Institute of Medical Science, Tokyo Metropolitan Organization for Medical Research, Bunkyo-ku, Tokyo 113-8613, Japan
Address all correspondence and requests for reprints to: K. Inoue, Ph.D., Department of Regulatory Biology, Graduate School of Science and Engineering, Saitama University, 255 Shimo-ohkubo, Sakura-ku, Saitama 338-8570, Japan. E-mail: kininoue{at}seitai.saitama-u.ac.jp.
 |
Abstract
|
|---|
Folliculo-stellate (FS) cells are known to act as sustentacular cells or scavenger cells in the anterior lobe. However, the precise function and origin of FS cells are still under discussion. Like brain astrocytes, FS cells contain S-100ß protein, and FS cells can be detected immunocytochemically using antibodies for S-100ß protein after fixation; however, living FS cells can not be detected. The generation of transgenic rats expressing green fluorescent protein (GFP) under the control of S-100ß protein gene promoter may allow the detection of living FS cells, which may be an excellent tool for the study of FS cells. With the aim of generation of transgenic rats, we analyzed the promoter activity of the S-100ß gene and found that intron 1 is important for cell-specific expression of the S-100ß gene. Therefore, we obtained a DNA construct containing GFP gene under a part of the S-100 promoter with intron 1. We transfected the construct into rat embryos and succeeded in generating transgenic rats. The transgenic rats expressed GFP in FS cells specifically in the anterior lobe. GFP is also expressed in other known S-100ß-expressing cells, i.e. brain astrocytes, adipocytes, and chondrocytes. We believe that the newly generated transgenic rats will provide a new approach for the study of FS cells and other S-100ß protein-producing cells.
 |
Introduction
|
|---|
FOLLICULO-STELLATE (FS) CELLS comprise major population of nonendocrine cells in the anterior lobe. They have long cytoplasmic processes and form tiny follicular lumina (1, 2). Although there have been many previous studies, FS cells are considered to be multifunctional and it is speculated that there are still many unknown functions of FS cells (3, 4). For the study of FS cells, we previously established TtT/GF and Tpit/F1 cell lines (5, 6) and used them in many studies (7, 8). Although these cell lines are good models for the study of FS cells, they are transformed cells and may have lost some of the normal functions of FS cells. Therefore, a method for the detection or purification of living FS cells from rat pituitary gland is strongly needed.
On the other hand, use of transgenic animals that express an intrinsically fluorescent reporter molecule, green fluorescent protein (GFP), under cell-specific promoters has been documented successfully (9, 10). We therefore attempted to generate transgenic rats expressing GFP under the regulation of S-100ß protein gene promoter. To generate transgenic rats, we first isolated the rat S-100ß promoter and analyzed the cell-specific activity of the promoter using cells expressing or not expressing the S-100 protein. Here we report that intron 1 in the S-100ß gene is important for cell-specific gene expression. Using this promoter, we finally succeeded in generating transgenic rats that express GFP in S-100ß protein-synthesizing cells. This transgenic rat model will provide new insights for research on FS cells.
 |
Materials and Methods
|
|---|
Cloning of the rat S-100ß promoter
The rat S-100ß genomic region is shown Fig. 1
. We cloned S-100ß gene from rat Bac clone CH230202H4 (Childrens Hospital Oakland Research Institute, Oakland, CA). A BglII fragment including S-100ß intron 1(990 to +4167 bp) was inserted into the pGEM-T Easy Vector (Promega, Tokyo, Japan), modified by insertion of a BglII cloning site. The 5' flanking region was engineered by means of PCR strategy with the Bac clone as a template and forward and reverse primers, CTCACTGGGTTCGTTCTG and CTCCTGGTCACCTTTTGCC, respectively. These primers were designed to recognize from 5786 to +292 bp of the S-100ß genomic region. The PCR product of this reaction was subcloned into the TA cloning pGEM-T Easy Vector.
Construction of plasmids for the luciferase assay
Four different lengths of the 5' flanking region of S-100ß promoter constructs were subcloned into the pGL3 Basic vector (Promega) by means of PCR or a restriction enzyme. The 156e1 (156 to +292 bp) and 1721e1 (1721 to +292 bp) fragments were subcloned into the pGEM-T Easy vector by means of PCR with the following forward and reverse primers: CAGCACTCAGCACCAGAAGT or TGTGCTGGTGTGCATCTGTA and CTCCTGGTCACCTTTTGCC, respectively. Then SacI-NcoI fragments were inserted into the corresponding restriction sites in the multiple cloning sites of the pGL3 Basic vector. The 3930e1 construct was obtained by subcloning the SacI-PstI restriction fragment (3930 to +168 bp) into digested restriction sites in the 1721e1 construct. The +78e1 construct was then generated by digesting 1721e1 with KpnI, followed by self-ligation.
For cloning into the pGL3 Basic vector, pGL Basic vector was inserted the SacII site between the KpnI and SacI sites using primers CCCGCGGATTTAAATGAGCT and CATTTAAATCCGCGGGGTAC and the AatII sites between the HindIII and NcoI sites using primers AGCTTAAGACGTCAGC and CATGGCTGACGTCTTA. To link S-100ß exon 2 to upstream of the luciferase, forward primer CTTGCTCAGCCTGCTTTCTT and reverse primer aaaagacgtcGCCTTCTCCAGCTCAGACAT (the nucleotide sequence for S-100ß ATG is shown in bold, the new AatII site is underlined) were used for PCR amplification. The 500-bp fragment obtained on digestion at SpeI-AatII of the PCR product was inserted into pGEM containing the BglII fragment of the S-100ß genomic region, and then the PstI-AatII fragment (+168 to +4029 bp) was subcloned into the pGL3 Basic vector containing the 5' promoter region. The S-100
1 promoter from 699 to +44 bp and the elongation factor (EF)1 promoter from 307 to +12 bp were inserted into the pGEM-T Easy vector by means of PCR, using the rat genome as a template; forward primers and reverse primers CGCTGAATTCGAGAGAGGAGA or TTCATACAAAAGGAGGGATC and GACGTCGGGAGCAGGTTCTT or AAACCCGTTGCGAAAAAGA were used, respectively. The resultant plasmids and pGL3 or +78e2 were linked to each other after digestion with SacII and MluI or SacII and PstI.
Cell cultures
Tpit/F1 and AtT/20 were cultured in medium comprising of half DMEM and half Hams F-12 (Life Technologies, Inc., Grand Island, NY), which was supplemented with 10% normal horse serum and 2.5% fetal bovine serum. C6 and PC12 were maintained in DMEM containing 10% fetal bovine serum. Cells were cultured in a CO2 incubator (5% CO2 and 95% air) at 37 C. The Tpit/F1 cells were cultured at 33 C.
Luciferase assay
Cells were seeded at 24 x 104 cells in the wells of 96-well plates. The transfection mix contained 2 ng of phRL-TK plasmid to correct for transfection efficiency and 0.2 µg of the designed pGL3 plasmids. The plasmids were dissolved in 100 µl of medium DMEM followed by the addition of Lipofectamine 2000 (Invitrogen, Tokyo, Japan) according to the manufacturers directions. Mixtures were incubated for 20 min at room temperature before addition in the culture medium. After 4 h of incubation at 37 C or 33 C in a humidified incubator, the cells were supplemented with 0.1 ml of growth medium. Forty-eight hours later the cell medium was discarded and the cultured cells were washed with PBS. After solubilization of the cells in 200 µl of lysis buffer, a 20-µl aliquot was assayed using a dual-luciferase kit (Promega). The luminescence in the samples was measured with a luminometer (Gene light 55; Yamato Kagaku, Tokyo, Japan). Firefly luciferase activity was corrected for transfection efficiency using Renilla luciferase activity.
Generation of transgenic rats
The rat S-100ß promoter (5030 to +4029) including intron 1 linked to the coding sequence for enhanced GFP (EGFP) (Clontech Laboratories, Inc., Tokyo, Japan), and the simian virus (SV)40 polyadenylation signal was used for the transgene. The excised transgene was injected into 206 the pronucleus of fertilized oocytes obtained from Wistar crlj rats (YS New Technology, Tochigi, Japan). Four transgenic founders were identified through genome PCR of DNA harvested from tail snips from 30 pups using forward and reverse primers CTTGCCTAGGAAGCACAAGG and TCCAGCTCGACCAGGATG, respectively.
Fluorescent microscopy and immunocytochemistry
Rats were deeply anesthetized with pentobarbital and tissues were immediately fixed by perfusion with 4% paraformaldehyde. After fixation, the tissues were kept overnight in the paraformaldehyde solution, followed by pretreatment with 30% sucrose in PBS overnight. Tissue samples were then embedded in Tissue-Tek OCT compound (Sakura Finetechnical Co., Ltd., Tokyo, Japan), and cryosections of 10- to 16-µm thickness were cut with a cryostat. After being mounted on glass slides and air dried, the cryosections were washed with PBS three times. After being blocked with PBS containing 1% fetal bovine serum and 0.4% Triton X-100, the sections were incubated overnight with the first antibody, followed by 1 h of incubation with the Alexa fluor 594 antirabbit IgG antibody. Samples were mounted using 90% glycerol containing 5% 1,4-diazabicyclo-[2.2.2] octane and 0.02 M Na2HPO4 and were then observed. We distinguished specific GFP signals from autofluorescence signals by nondetection of other excitation wavelengths.
Fluorescence activated cell sorting
Anterior lobes obtained from S100b-GFP transgenic rats (10 wk old) were minced and dispersed with collagenase and pancreatine. The cells were suspended in PBS, which contained 2 µg/ml of propidium iodide to label the nuclei. The cells were then analyzed and sorted with a cell sorter (FACS Aria; Becton Dickinson, Tokyo, Japan).
 |
Results
|
|---|
Analysis of the promoter activity of the S-100ß gene
The rat S-100ß genomic region and restriction sites are shown in Fig. 1A
. The transcriptional start site of S-100ß and its transcriptional activity were reported previously (11, 12, 13, 14). To confirm the site of cell-specific expression and the transcriptional activity of the S-100ß promoter, four S-100ß luciferase expression vectors including the 5' flanking region were constructed, and the luciferase assay was performed. These vectors were transiently transfected into C6 (a brain astrocyte-derived cell line), Tpit/F1 (a pituitary FS cell line), PC12 (an adrenal pheochromocytoma cell line), and AtT/20 (a pituitary corticotroph cell line) cells. C6 and Tpit/F1 cells are known to express S-100ß protein. As shown in Fig. 1B
, all these constructs containing the 5' promoter region showed expression activity in these cell lines without any cell specificity; i.e. S-100-negative cells (AtT/20 cell) and S-100-positive cells (C6 and Tpit/F1) showed equal expression activity.
In contrast, three constructs from the 5' promoter region to +4029 bp containing full-length intron 1 (+78e2, 156e2, and 1721e2) showed a strong suppressing effect in S-100ß-negative cells (Fig. 1C
), which is independent of the length of the 5' promoter region, suggesting that intron 1 acts as a silencer element in S-100ß-negative cells. To confirm the silencer activity of intron 1, we used the S-100
gene. The S-100 protein family consists of
114, ß, and P. Of these S-100 family proteins, ß and
-1 are known to show tissue-specific expression (15). To test activity of intron 1 on cell-specific expression, we cloned 700 bp of the 5' promoter region of the rat S-100
gene and linked it with +168 to +292bp of exon 1 or +168 to +4029 bp containing the full-length S-100ß gene intron 1 and performed the luciferase assay. Constructs containing intron 1 decreased S-100
promoter activity 5- to 10-fold in the S-100ß-negative cells compared with constructs containing only exon 1 (Fig. 1D
). In contrast, the promoter activity did not change in S-100ß-positive cells despite the intron 1 sequence being present. Therefore, it is suggested that S-100ß intron 1 suppress S-100
1 promoter activity in only S-100-negative cells.
In addition, we examined the effect of intron 1 on cell-specific expression activity of ubiquitous promoter EF1
(16). As shown in Fig. 1E
, there was no difference in the EF1 promoter (300 bp) activity between constructs with intron 1 and without intron 1 in S-100-negative cells, whereas the promoter activity with intron 1 was clearly increased in S-100-positive cells. These data suggest that intron 1 acts as an enhancer for EF1. Overall, our data suggest that intron 1 is necessary for cell-specific expression of the S-100ß promoter.
Generation of S100b-GFP transgenic rats
To generate transgenic rats expressing GFP, we used intron 1 containing the S-100ß genomic region from 5030 to +4029 bp, which was linked to the EGFP gene and SV40 poly A (Fig. 2A
). The gene construct was injected into 200 fertilized rat eggs and four transgenic founders were obtained, which were identified through PCR analysis of DNA harvested from the tail snips from 30 pups. We found that lines 13, 17, 19, and 24 exhibited a specific GFP expression pattern in S-100-positive cells in the anterior pituitary glands without any positional effect of the transgene integration site. However, due to the low level of GFP expression in lines 17 and 19, we selected line 13 for further breeding. Line 13 was called S100b-GFP.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2. Specific expression of GFP in S-100-positive cells of S100b-GFP transgenic rat pituitary gland. A, Transgene of rat S100b-GFP. The transgene consisted of 5030 bp of the 5' flanking region to +4029 bp of exon 2 fused to the EGFP gene and SV40 poly A. The nucleotide positions are numbered from the transcription start site. B, Expression of GFP in S100b-GFP transgenic rat pituitary gland. Pituitary samples were prepared from S100b-GFP transgenic rats and fixed with 4% paraformaldehyde. Cryosections of pituitary glands at 6 wk were used for immunofluorescence staining with anti-S-100 protein (red) and were observed by fluorescence microscopy. C and D, GFP-expressing cells in the anterior lobe (AL) (C) and intermediate lobe (IL) and posterior lobe (PL) (D). E, Three-dimensional imaging of a FS cell. An image was constructed from 40 optical sections (0.5 µm each). A three-dimensional view was constructed using software MetaMorph (Molecular Devices Tokyo) and showed rotation in the vertical direction. The white lines in the figure are the boundaries of the volume. See also the QuickTime movie of GFP-positive FS cells, published as supplemental Fig. 1 on The Endocrine Societys Journals Online web site, http://endo.endojournals.org. Bars, 20 µm.
|
|
Expression of GFP in the pituitary gland and other tissues
We first observed GFP expression in the pituitary gland of adult S100b-GFP rats. As shown in Fig. 2
, B and C, GFP was expressed in the cells that had long cytoplasmic processes (Fig. 2C
). GFP-positive cells were also observed in the marginal cell layer of intermediate lobe and pituicytes of the posterior lobe, respectively (Fig. 2D
). The GFP-expressing cells were compared with S-100ß immunoreactive cells, and it was confirmed that GFP-expressing cells correspond to S-100ß cells (Fig. 2
, C and D).
The GFP-positive FS cells in the anterior lobe were observed by laser scanning confocal microscopy. Twenty-micrometer-thick sections were optically sectioned (0.5 µm thick) by laser scanning confocal microscopy, and a three-dimensional view was constructed. The obtained images are shown in Fig. 2E
and in supplemental Fig. 1, published on The Endocrine Societys Journals Online web site, http://endo.endojournals.org.
In addition, the GFP-expressing cells did not correspond to GH, prolactin (Prl), TSH, LH, and ACTH cells (Fig. 3
), which suggests that GFP is expressed only in FS cells in the anterior pituitary gland.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 3. Comparison of GFP-positive cells and hormone-producing cells. A GH-producing cells. B, Prl-producing cells. C, TSH-producing cells. D, LH-producing cells. E, ACTH-producing cells. F, Intermediate (IL) and posterior lobe (PL) cells. Cryosections of S100b-GFP transgenic rat pituitary gland at 6 wk were stained with each anti-anterior hormone (red). Bar, 20 µm.
|
|
GFP is also expressed in brain astrocytes (Fig. 4A
), adipocytes, and chondrocytes (Fig. 4
, B and C). In addition, GFP is also expressed in some cells in the skin, testis, and thymus. Those cells in these tissues correspond to S-100ß-producing cells (data not shown). The synthesis of GFP protein is also conformed by Western blotting analysis (see supplemental Fig. 2). As shown in supplemental Fig. 2, productions of GFP protein in various tissues are corresponded with S-100ß protein except kidney. Although S-100ß protein is not detected in kidney, the mRNA is detected, which suggests that S-100ß synthesis is controlled at translational level in this tissue.

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 4. Comparison of GFP and S-100ß positive cells in other tissues. Cryosections of each tissue of S100b-GFP transgenic rats at 6 wk were stained with anti-S-100ß protein (red) and compared with GFP-positive cells (green). A, Cerebellum; B, chondrocytes; C, adipocytes. Bar, 20 µm.
|
|
Cell sorting and primary cell cultivation
We purified GFP-positive FS cells with a cell sorter. As shown in Fig. 5A
, we obtained pure GFP-positive cells from pituitary glands of transgenic rats. The purity of the FS cells was examined by means of RT-PCR. As expected, the purified GFP-positive cells strongly expressed S-100ß but not any pituitary hormones (Fig. 5B
). On the contrary, GFP-negative cells expressed mRNA for GH, Prl, and TSH.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 5. Cell sorting of GFP-positive cells in the anterior lobes. A, Cell sorting of S100b-GFP cells. About 4 x 106 cells from the pituitary gland were fractionated with FSC (forward scatter) and SSC (side scatter) to remove cell debris (P1). The propidium iodide-negative fraction was selected as living cells (P2), and the GFP-positive and -negative pools were sorted using FACS Aria (Becton Dickinson). The GFP+ cells amounted to about 4%. B, RT-PCR of sorted cells. The fractioned GFP (5 x 104) cells and GFP+ (5 x 104) cells were analyzed by RT-PCR for mRNA of S-100ß, GH, Prl, and TSH. C, Primary culture of the sorted anterior pituitary cells. Anterior lobes obtained from S100b-GFP transgenic rats were dispersed and sorted into GFP+ and GFP cells. Both fluorescent (upper) and phase contrast (lower) images are shown.
|
|
The GFP-positive cells were cultured. The GFP-positive cells had extended processes like pituitary FS cells (Fig. 5C
).
 |
Discussion
|
|---|
FS cells in the anterior lobe are considered to be multifunctional and to support neighboring endocrine cells. However, the precise functions, origin, and differentiation potential of FS cells are still under discussion. For the study of FS cells, the detection and separation of living FS cells from the pituitary gland is strongly needed. A GFP-expressing transgenic animal would allow one to distinguish specific living cells and to separate such cells. For such a purpose, transgenic mice expressing GFP under the mouse or human S-100ß promoter were generated (17, 18). However, most previous studies on FS cells were performed using rat cells because S-100ß protein is not accumulated much in mouse FS cells. FS cells were not detected by immunocytochemistry. In addition, the mouse pituitary is about 10 times smaller than that of the rat. We therefore attempted to generate transgenic rats that express GFP under the S-100ß promoter.
In this paper we first report the importance of intron 1 for cell-specific expression of the S-100ß gene. Intron 1 suppressed the S-100
1 promoter activity in S-100-negative cells. Moreover, EF1 promoter activity was increased by intron 1 in S-100-producing cells. These data suggest that intron 1 shows suppressive or facilitative activity. On the other hand, it was previously reported that the expression of GnRH, lamin A, and GATA1 is regulated by intron through various mechanisms (19, 20, 21). In the case of GnRH, intron 1 suppresses translation when intron 1 is not splicing. In addition, GATA1 transcription is controlled through alteration of the transcriptional start site in intron 1. However, further study is needed to reveal the functional mechanism of intron 1.
According to the importance of intron 1 for cell-specific expression of S-100ß protein, we obtained an S-100ß promoter construct containing full-length intron 1 (5030 to +4029) linked to the coding sequence for EGFP. Using this construct, we succeeded in generating transgenic rats that express GFP in S-100ß protein-expressing cells. Actually, transgenic rats expressed GFP only in FS cells but not in other endocrine cells in the anterior lobe. One of our aims is the establishment of a method for the separation of living FS cells from the anterior lobe. Therefore, we separated GFP-expressing cells from anterior lobes using a cell sorter. As shown in Fig. 5
, we succeeded in the separation of pure living FS cells. The transgenic rats will be used for study of the differentiation of FS cells, cell to cell interactions in the pituitary gland, and also for morphological studies. In addition, the newly established transgenic rats will be used for study of other S-100ß protein-expressing cells such as brain astrocytes, chondrocytes, and adipocytes. This animals may also be used to explore dynamic changes of GFP+ cell appearances in the pituitary gland according to development and some physiological changes.
In conclusion, we report the characterization and usefulness of transgenic rats that express GFP specifically in FS cells of the anterior lobe. This newly developed transgenic rat expressing GFP well definitely be a new tool for the study of FS cells and other S-100ß-expressing cells. Currently, we are preparing to deposit transgenic rats with the aim of providing animals worldwide through the NBRP (National Bio Resource Project for the Rat, Kyoto, Japan; see http://www.anim.med.kyoto-u.ac.jp/NBR/).
 |
Footnotes
|
|---|
This work was supported by a grant from the Rational Evolutionary Design of Advanced Biomolecules Project supported by the Japan Science and Technology Agency.
Disclosure Statement: The authors have nothing to declare.
First Published Online January 18, 2007
Abbreviations: EF, Elongation factor; FS, Folliculo-stellate; GFP, green fluorescent protein; EGFP, enhanced GFP; Prl, prolactin; SV, simian virus.
Received October 13, 2006.
Accepted for publication January 9, 2007.
 |
References
|
|---|
- Rinehart JF, Farquhar MG 1953 Electron microscopic studies of the anterior pituitary gland. J Histochem Cytochem 1:93113[Abstract]
- Kagayama M 1965 The follicular cell in the pars distalis of the dog pituitary gland: an electron microscope study. Endocrinology 77:10531060[Medline]
- Allaerts W, Vankelecom H 2005 History and perspectives of pituitary folliculo-stellate cell research. Eur J Endocrinol 153:112[Abstract/Free Full Text]
- Inoue K, Couch EF, Takano K, Ogawa S 1999 The structure and function of folliculo-stellate cells in the anterior pituitary gland. Arch Histol Cytol 62:205218[CrossRef][Medline]
- Inoue K, Matsumoto H, Koyama C, Shibata K, Nakazato Y, Ito A 1992 Establishment of a folliculo-stellate-like cell line from a murine thyrotropic pituitary tumor. Endocrinology 131:31103116[Abstract]
- Chen L, Maruyama D, Sugiyama M, Sakai T, Mogi C, Kato M, Kurotani R, Shirasawa N, Takaki A, Renner U, Kato Y, Inoue K 2000 Cytological characterization of a pituitary folliculo-stellate-like cell line, Tpit/F1, with special reference to adenosine triphosphate-mediated neuronal nitric oxide synthase expression and nitric oxide secretion. Endocrinology 141:36033610[Abstract/Free Full Text]
- Rees DA, Lewis MD, Lewis BM, Smith PJ, Scanlon MF, Ham J 2002 Adenosine-regulated cell proliferation in pituitary folliculostellate and endocrine cells: differential roles for the A(1) and A(2B) adenosine receptors. Endocrinology 143:24272436[Abstract/Free Full Text]
- Chapman LP, Epton MJ, Buckingham JC, Morris JF, Christian HC 2003 Evidence for a role of the adenosine 5'-triphosphate-binding cassette transporter A1 in the externalization of annexin I from pituitary folliculo-stellate cells. Endocrinology 144:10621073[Abstract/Free Full Text]
- Childs GV 2000 Green fluorescent proteins light the way to a better understanding of the function and regulation of specific anterior pituitary cells. Endocrinology 141:43314333[Free Full Text]
- Fujioka H, Suzuki M, Yamanouchi K, Ohta A, Nagashima H, Kato M, Nishihara M 2003 Generation of transgenic rats expressing enhanced green fluorescent protein in gonadotropin-releasing hormone neurons. J Reprod Dev 49:523529[CrossRef][Medline]
- Hagiwara N, Sueoka N 1995 Regulation of the rat S100 ß gene expression: the role of the 2 kb 5'-upstream sequence in glial specific expression. J Neurosci Res 42:603612[CrossRef][Medline]
- Maeda T, Usui H, Araki K, Kuwano R, Takahashi Y, Suzuki Y 1991 Structure and expression of rat S-100 ß subunit gene. Brain Res Mol Brain Res 10:193202[Medline]
- Jiang H, Shah S, Hilt DC 1993 Organization, sequence, and expression of the murine S100 ß gene. Transcriptional regulation by cell type-specific cis-acting regulatory elements. J Biol Chem 268:2050220511[Abstract/Free Full Text]
- Castets F, Griffin WS, Marks A, Van Eldik LJ 1997 Transcriptional regulation of the human S100 ß gene. Brain Res Mol Brain Res 46:208216[Medline]
- Ravasi T, Hsu K, Goyette J, Schroder K, Yang Z, Rahimi F, Miranda LP, Alewood PF, Hume DA, Geczy C 2004 Probing the S100 protein family through genomic and functional analysis. Genomics 84:1022[CrossRef][Medline]
- Hershey JW 1991 Translational control in mammalian cells. Annu Rev Biochem 60:717755[CrossRef][Medline]
- Vives V, Alonso G, Solal AC, Joubert D, Legraverend C 2003 Visualization of S100B-positive neurons and glia in the central nervous system of EGFP transgenic mice. J Comp Neurol 457:404419[CrossRef][Medline]
- Zuo Y, Lubischer JL, Kang H, Tian L, Mikesh M, Marks A, Scofield VL, Maika S, Newman C, Krieg P, Thompson WJ 2004 Fluorescent proteins expressed in mouse transgenic lines mark subsets of glia, neurons, macrophages, and dendritic cells for vital examination. J Neurosci 24:1099911009[Abstract/Free Full Text]
- Son GH, Jung H, Seong JY, Choe Y, Geum D, Kim K 2003 Excision of the first intron from the gonadotropin-releasing hormone (GnRH) transcript serves as a key regulatory step for GnRH biosynthesis. J Biol Chem 278:1803718044[Abstract/Free Full Text]
- Onodera K, Takahashi S, Nishimura S, Ohta J, Motohashi H, Yomogida K, Hayashi N, Engel JD, Yamamoto M 1997 GATA-1 transcription is controlled by distinct regulatory mechanisms during primitive and definitive erythropoiesis. Proc Natl Acad Sci USA 94:44874492[Abstract/Free Full Text]
- Arora P, Muralikrishna B, Parnaik VK 2004 Cell-type-specific interactions at regulatory motifs in the first intron of the lamin A gene. FEBS Lett 568:122128[CrossRef][Medline]