Endocrinology, doi:10.1210/en.2006-1106
Endocrinology Vol. 148, No. 4 1598-1604
Copyright © 2007 by The Endocrine Society
Midkine Is an Autocrine Activator of Signal Transducer and Activator of Transcription 3 in 3T3-L1 Cells
Erin R. Cernkovich,
Jianbei Deng,
Kunjie Hua and
Joyce B. Harp
Department of Nutrition, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599
Address all correspondence and requests for reprints to: Joyce B. Harp, M.D., Department of Nutrition, CB 7461 McGavran Greenberg Hall, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599. E-mail: jharp{at}email.unc.edu.
 |
Abstract
|
|---|
Mitotic clonal expansion is believed to be necessary for 3T3-L1 adipocyte formation. Signal transducer and activator of transcription 3 (STAT3), a mitogenic signaling protein, is activated through tyrosine phosphorylation during the proliferative phases of adipogenesis. We hypothesize that this signaling protein plays a key role in mitotic clonal expansion and differentiation. Here we determined that the adipocyte differentiation cocktail containing isobutylmethylxanthine, dexamethasone, and insulin (MDI) induced STAT3 tyrosine phosphorylation indirectly through the synthesis of an autocrine/paracrine factor. We further determined that the factor has heparin binding properties and identified the factor as midkine, a pleiotrophic growth factor previously associated with neuronal development and oncogenesis. Recombinant midkine induced STAT3 tyrosine phosphorylation in a time- and dose-dependent manner and stimulated the proliferation of postconfluent 3T3-L1 cells. Midkine neutralizing antibodies inhibited differentiation-induced STAT3 tyrosine phosphorylation as well as adipogenesis. These results show that MDI-induced synthesis and release of midkine explains the delayed activation of STAT3 during adipogenesis and that the midkine-STAT3 signaling pathway plays a necessary role in mitotic clonal expansion and differentiation.
 |
Introduction
|
|---|
OBESITY OCCURS WHEN energy intake chronically exceeds energy expenditure. Excess energy is stored in adipose tissue as triacylglycerol (1). To accommodate the increased triacylglycerol, adipose tissue expands, primarily through an increase in fat cell size. Upon reaching a critical size, enlarged adipocytes secrete factors that promote preadipocytes to proliferate and differentiate into adipocytes (2). Although much is known about the mechanisms of preadipocyte differentiation, less is known about the mechanisms of preadipocyte proliferation.
Many of the advances in our understanding of adipogenesis are based on studies in 3T3-L1 cells. 3T3-L1 preadipocytes are fibroblast-like cells committed to the adipocyte lineage. In culture, 3T3-L1 preadipocytes replicate until they form a confluent monolayer (3). At confluence, cell-cell contact triggers growth arrest. When induced with hormonal agents, often a cocktail of isobutylmethylxanthine, dexamethasone, and insulin (MDI), growth-arrested preadipocytes reenter the cell cycle and undergo one to two rounds of cell division known as mitotic clonal expansion (4). After mitotic clonal expansion, preadipocytes exit the cell cycle, commit to terminal differentiation, and begin to express adipocyte-specific genes (5).
The major transcriptional regulators of adipogenesis include proteins belonging to the CCAAT/enhancer binding protein (C/EBP) family and the peroxisome proliferator-activated receptor (PPAR) superfamily. Signal transducers and activators of transcription (STATs) have also been implicated in the differentiation program. A coordinated cascade involving the above mentioned factors typifies the differentiated phenotype (6, 7, 8). Specifically, mitotic clonal expansion is characterized by a transient increase in the expression of the transcription factors C/EBPß (9) and
(9), as well as the tyrosine phosphorylation and activation of STAT3 (10). Furthermore, acquisition of the terminally differentiated phenotype depends on transcriptional activation of C/EBP
and PPAR
(11).
Midkine is a secreted heparin-binding growth factor encoded by a retinoic acid-responsive gene (12). The mature molecule is a basic, cysteine-rich polypeptide with molecular mass of 14 kDa (13). Midkines biological activities are diverse, including regulation of neurite outgrowth and neuron survival (14, 15). Accumulating evidence is defining a role for midkine in oncogenesis as well. Midkine is overexpressed in a variety of cancers including esophageal (16), gastric (17), colon (18), pancreatic (19), lung (20), and breast (21). Additionally, midkine serves as an autocrine mitogen for tumor cells. Midkine also possesses transforming properties: forced expression of midkine causes NIH-3T3 cells to undergo cellular transformation and causes tumor formation in nude mice (22). Finally, midkine inhibits the induction of apoptosis (23), promotes angiogenesis (24), and stimulates tyrosine phosphorylation of several cellular proteins, including STAT1 (23, 25).
In this report, we identified a midkine-STAT3 signaling pathway that plays a necessary role in mitotic clonal expansion and differentiation.
 |
Materials and Methods
|
|---|
Materials
3T3-L1 cells were purchased from ATCC (Manassas, VA). Affinity-purified rabbit polyclonal phosphotyrosine 705-specific anti-STAT3 (STAT3-PY) and rabbit polyclonal anti-STAT3 were purchased from Cell Signaling (Beverly, MA). Affinity-purified rabbit polyclonal anti-C/EBP
, mouse monoclonal anti-PPAR
, human polyclonal anti-midkine and normal goat IgG were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Recombinant human midkine was purchased from R&D Systems (Minneapolis, MN). The enhanced chemiluminescence (ECL) detection kit and horseradish peroxidase-conjugated secondary antibodies were purchased from Pierce Biotechnology, Inc. (Rockford, IL). The HiTrap Heparin HP column was purchased from Amersham Pharmacia (Piscataway, NJ).
Cell culture
3T3-L1 preadipocytes were cultured in DMEM containing 10% vol/vol fetal bovine serum (FBS), 10 mg/ml streptomycin, 100 U/ml penicillin, and 1 mM pyruvate at 37 C in 5% CO2 air. 3T3-L1 cells were studied as pre- and postconfluent preadipocytes and as adipocytes. To induce differentiation, 2-d postconfluent cells were treated with 0.5 µM dexamethasone, 0.5 mM isobutylmethylxanthine, and 10 µg/ml insulin in DMEM/10% FBS for 72 h. On d 3, the differentiation medium was replaced with DMEM/10% FBS, which was changed every 2 d thereafter until analysis.
Immunoblot analysis
3T3-L1 cells were washed twice in PBS with 1 mM orthovanadate and then placed immediately in sample buffer [1% Nonidet P-40, 20 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM EDTA, 0.1% NaN3, 10 µg/ml aprotinin, 1 µM pepstatin, 16.4 µg/ml leupeptin, 1 mM phenylmethyl-sulfonylfluoride, 0.1 mM Na3VO4, 2% SDS, 10% glycerol] without dithiothreitol or tracking dye. Lysates were heated and protein concentrations were determined using Bio-Rad Laboratories, Inc., DC Protein Assay kit (Richmond, CA). BSA was used as a standard. Samples were heated for 2 min at 85 C, separated by 10% SDS-PAGE, and analyzed by immunoblotting as previously described. Immunoblots were developed using the enhanced chemiluminescence kit.
RNA isolation
Total RNA was isolated from 3T3-L1 cells using the RNeasy mini kit (QIAGEN, Inc., Valencia, CA) at 0, 1, 3, 6, 24, 48, and 72 h after induction of differentiation. RNA quality was confirmed by ethidium bromide staining and detection of intact 28S and 18S ribosomal RNA bands.
RT-PCR
Deoxyribonuclease-treated RNA, collected 0, 1, 3, 6, 24, 48, and 72 h after induction of differentiation, was reversed transcribed using the QIAGEN OneStep RT-PCR kit (QIAGEN, Inc., Valencia, CA). ACCGAGGCTTCTTCCTTCTCGCCCTTCTTGCCC and CCCTGCACCTCCAA GACCAAGTCAAAGACC were used as forward and reverse primers, respectively.
Heparin affinity column
Twenty-four-hour conditioned medium (CM) was applied to a HiTrap Heparin HP column. The column was washed with 0.02 M Tris-HCl (pH 7.5), and eluted with NaCl in doses ranging from 02 M. To concentrate and desalt the eluted fractions, fractions were centrifuged three times at 5500 rpm for 45 min at 4 C.
Midkine neutralization assay
Recombinant human midkine at a concentration of 10.0 ng/ml was neutralized with anti-midkine antibody (M-18), in doses ranging from 0.1 µg/ml to 10.0 µg/ml, for 1 h at 37 C. Postconfluent preadipocytes were stimulated with recombinant human midkine, or recombinant human midkine neutralized with anti-midkine antibody. Cells were harvested after 10 min of treatment.
CM collected 24 h after stimulation with MDI (A1 CM) was neutralized with 10.0 µg/ml normal goat IgG or 10.0 µg/ml anti-midkine antibody (M-18) for 1 h at 37 C. Postconfluent preadipocytes were stimulated with A1 CM, or A1 CM neutralized with 10.0 µg/ml normal goat IgG or 10.0 µg/ml anti-midkine antibody. Cells were harvested after 10 min of treatment.
Proliferation assay
Preconfluent 3T3-L1 preadipocytes were seeded in 96-well plates at a density of 2000 cells/100 µl/well. Cells were seeded in DMEM containing 10% FBS. Vehicle (PBS), 10.0 ng/ml recombinant human midkine, or MDI were added to culture medium with or without cells at 2 d after confluence. At 0, 24, 48, and 72 h after stimulation, a colorimetric proliferation assay (CellTiter 96 AQueous nonradioactive cell proliferation assay; Promega, Madison, WI) was performed as directed by the manufacturer. To calculate the absorbance values at each time point, the mean absorbance of two blank wells (containing vehicle, recombinant human midkine, or MDI in culture medium without cells) was subtracted from the mean absorbance of three wells containing cells.
Oil Red O staining
Eight to 12 d after induction of differentiation, 3T3-L1 adipocytes were washed with PBS, fixed with 3.7% formaldehyde in PBS, then stained with 0.5% Oil Red-O.
 |
Results
|
|---|
An autocrine/paracrine factor induces STAT3 activation in 3T3-L1 cells
STAT3 is activated within the first 24 h after induction of differentiation (10). To better define the timing of MDI-induced STAT3 tyrosine phosphorylation, cell lysates were recovered 1, 3, 6, 12, and 24 h after MDI stimulation. STAT3 tyrosine phosphorylation was not observed until 3 h after the induction of differentiation (Fig. 1
). This 3-h delay in STAT3 activation is not consistent with the immediate tyrosine phosphorylation that typically occurs minutes after ligand stimulation (26). These data suggest that induction of differentiation with MDI stimulates the tyrosine phosphorylation of STAT3 by an indirect mechanism.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 1. Pattern of STAT3 activation in 3T3-L1 preadipocytes. Whole cell lysates were prepared from 3T3-L1 cells at various times (0, 1, 3, 6, 12, and 24 h) after induction of differentiation with MDI. Western blot analysis (IB) was performed with anti-STAT3-PY antibody. Blots were stripped and reprobed with anti-STAT3 antibody. Results are representative of three separate experiments.
|
|
To determine whether MDI induces the release of a STAT3 activating factor, postconfluent preadipocytes were induced to differentiate with MDI, and CM was collected 5 min and 24 h after stimulation. Unstimulated postconfluent preadipocytes were then stimulated with either the 5-min CM or the 24-h CM for 5 min. Treatment of unstimulated preadipocytes with 24-h CM induced STAT3 tyrosine phosphorylation, suggesting that MDI stimulated the release of a STAT3 activating factor over the 24-h period (Fig. 2A
). Treatment of unstimulated preadipocytes with 5-min CM, however, did not induce STAT3 activation, suggesting that release of the activating factor had not occurred within this short time frame.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 2. Effect of CM stimulation on STAT3 tyrosine phosphorylation in 3T3-L1 preadipocytes and adipocytes. A, 3T3-L1 preadipocytes were cultured in the presence of CM generated 5 min after stimulation with MDI, or CM generated 24 h after stimulation with MDI. After a 5-min stimulation, whole cell lysates were prepared and Western blot analysis (IB) was performed with anti-STAT3-PY antibody. Blots were stripped and reprobed with anti-STAT3 antibody. B, 3T3-L1 preadipocytes were cultured in the presence of CM generated 1, 2, 3, 5, 7, or 8 d after stimulation with MDI. After a 5-min stimulation, whole cell lysates were prepared and Western blot analysis was performed with anti-STAT3-PY antibody. Blots were stripped and reprobed with anti-STAT3 antibody. Results are representative of three separate experiments.
|
|
To determine the cellular source of the STAT3-activating factor, we next collected CM daily from 3T3-L1 cells at various stages of proliferation and differentiation. Unstimulated postconfluent preadipocytes were then stimulated with this CM. As shown in Fig. 2B
, CM from postconfluent proliferating preadipocytes (1 and 2 d after induction of differentiation) induced STAT3 tyrosine phosphorylation. STAT3 tyrosine phosphorylation was barely detectable, however, in cells stimulated with CM from growth-arrested preadipocytes (0) and adipocytes (3, 4, 5, 6, 7, 8).
Transcription and translation are required for autocrine/paracrine activation of STAT3
Because 24-h CM induced STAT3 tyrosine phosphorylation, but 5-min CM did not, we hypothesized that the STAT3 activating factor was synthesized de novo in response to MDI. Postconfluent preadipocytes were pretreated with cycloheximide or actinomycin D before generation of 24-h CM. A new group of postconfluent preadipocytes was then stimulated with the inhibitor pretreated CM for 5 min. Inhibition of protein synthesis with cycloheximide during the generation of CM significantly reduced CM-induced STAT3 tyrosine phosphorylation (Fig. 3A
). Blockade of mRNA synthesis with actinomycin D completely inhibited CM-induced STAT3 tyrosine phosphorylation, indicating that RNA synthesis is required to generate the STAT3-activating factor.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 3. Effects of cycloheximide, actinomycin D, and heparin affinity column pretreatment on CM-induced activation of STAT3. A, 3T3-L1 preadipocytes were cultured in the presence of 24-h CM generated by preadipocytes pretreated with either 10.0 µg/ml cycloheximide or 5.0 µg/ml actinomycin D. After a 5-min stimulation, whole cell lysates were prepared and Western blot analysis (IB) was performed with anti-STAT3-PY antibody. Blots were stripped and reprobed with anti-STAT3 antibody. B, 3T3-L1 preadipocytes were cultured in the presence of 24-h CM eluted from a heparin affinity with increasing concentrations of NaCl (0.5, 1.0, 1.5, or 2.0 M). After a 5-min stimulation, whole cell lysates were prepared and Western blot analysis was performed with anti-STAT3-PY antibody. Blots were stripped and reprobed with anti-STAT3 antibody. Results are representative of three separate experiments.
|
|
Identification of a heparin binding autocrine/paracrine factor
Efforts to identify the activating factor were first directed toward the traditional activator of STAT3, IL-6. We determined in a series of studies that IL-6 was released from postconfluent preadipocytes and that IL-6 activated STAT3 in these cells. However, removal of IL-6 from the CM had no effect on STAT3 tyrosine phosphorylation (data not shown). This indicated that IL-6 was not responsible for the autocrine/paracrine activation of STAT3.
Because STAT3 has been implicated in the proliferative phases of adipogenesis, efforts to identify the activating factor were next directed toward factors known to stimulate preadipocyte proliferation. Heparin binding growth factors are released into the culture medium and act as autocrine/paracrine factors contributing to preadipocyte proliferation (2). Therefore, to narrow our search, we determined whether the STAT3-activating factor had heparin binding properties. Twenty-four-hour CM was applied to a heparin affinity column and eluted with increasing concentrations of NaCl. Treatment of unstimulated postconfluent preadipocytes with 24-h CM eluted from the heparin affinity column induced STAT3 tyrosine phosphorylation (Fig. 3B
). The greatest effect was seen with CM eluted at 12 M NaCl. This led us to search for STAT3-activating ligands with heparin binding properties.
Midkine is the autocrine/paracrine activator of STAT3
The heparin-binding growth factor midkine is a regulator of normal and transformed cell proliferation. Additionally, midkine stimulates tyrosine phosphorylation of STAT1 in other cell lines (25). Therefore, we tested the ability of recombinant midkine to activate STAT3 in 3T3-L1 cells. Postconfluent preadipocytes were cultured in the presence of varying doses of recombinant midkine and STAT3 tyrosine phosphorylation was measured by Western blot analysis at several time points after stimulation. As shown in Fig. 4A
, the addition of midkine induced STAT3 tyrosine phosphorylation in a dose-dependent manner. Figure 4B
shows that midkine also induced STAT3 tyrosine phosphorylation in a time-dependent manner. Because STAT3 tyrosine phosphorylation peaked after a 10-min stimulation with 10.0 ng/ml recombinant midkine, this time and dose were used for all subsequent experiments.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 4. Effect of recombinant midkine stimulation on STAT3 tyrosine phosphorylation in 3T3-L1 preadipocytes. A, 3T3-L1 preadipocytes were cultured in the presence of varying concentrations (0.1, 1.0, 10.0, or 100.0 ng/ml) of recombinant midkine (rhMK). After a 10-min stimulation, whole cell lysates were prepared and Western blot analysis (IB) was performed with anti-STAT3-PY antibody. Blots were stripped and reprobed with anti-STAT3 antibody. B, 3T3-L1 preadipocytes were cultured in the presence of 10.0 ng/ml rhMK. After a 1, 5, 10, 30, or 60 min stimulation, whole cell lysates were prepared and Western blot analysis was performed with anti-STAT3-PY antibody. Blots were stripped and reprobed with anti-STAT3 antibody. Results are representative of three separate experiments.
|
|
Earlier studies confirmed that the STAT3 activating factor was synthesized after stimulation with MDI (Fig. 3A
). To determine whether midkine is expressed in 3T3-L1 cells, we measured midkine expression at several time points after stimulation with MDI using RT-PCR. Oligonucleotide primers were used to amplify a 386-bp fragment of mouse midkine. Figure 5
shows that midkine is expressed in 3T3-L1 preadipocytes, and that midkine expression coincides with MDI-induced STAT3 tyrosine phosphorylation. The 386-bp fragment was sequenced and confirmed to be midkine (data not shown).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 5. Midkine expression in 3T3-L1 preadipocytes. Midkine expression in 3T3-L1 cells 0, 1, 3, 6, 24, 48, and 72 h after induction of differentiation with MDI was measured by RT-PCR. GAPDH, Glyceraldehyde-3-phosphate dehydrogenase.
|
|
Because midkine is a heparin-binding growth factor expressed in 3T3-L1 cells, and because recombinant midkine activates STAT3 in 3T3-L1 cells, we hypothesized that midkine was the autocrine/paracrine activator of STAT3. Consequently, we hypothesized that neutralizing midkine in CM would lead to a decrease in CM-induced STAT3 tyrosine phosphorylation. First, to confirm efficient neutralization, recombinant midkine was neutralized with varying concentrations of anti-midkine antibody. Figure 6A
shows that midkine was efficiently neutralized with 10.0 µg/ml anti-midkine antibody. Although there were decreases in STAT3 tyrosine phosphorylation, STAT3 protein levels did not change.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 6. Effect of midkine neutralization on midkine-induced STAT3 tyrosine phosphorylation in 3T3-L1 preadipocytes. A, 3T3-L1 preadipocytes were cultured in the presence of 10.0 ng/ml recombinant midkine (rhMK) neutralized with varying concentrations of anti-midkine antibody (0.1, 1.0, or 10.0 µg/ml). After a 5-min stimulation, whole cell lysates were prepared and Western blot analysis (IB) was performed with anti-STAT3-PY antibody. Blots were stripped and reprobed with anti-STAT3 antibody. B, 3T3-L1 preadipocytes were cultured in the presence of 10.0 ng/ml recombinant IL-6 neutralized with 10.0 µg/ml anti-midkine antibody. After a 5-min stimulation, whole cell lysates were prepared and Western blot analysis was performed with anti-STAT3-PY antibody. Blots were stripped and reprobed with anti-STAT3 antibody. C, 3T3-L1 preadipocytes were cultured in the presence of 24-h CM neutralized with 10.0 µg/ml anti-midkine antibody or 10.0 µg/ml normal goat IgG. After a 5-min stimulation, whole cell lysates were prepared and Western blot analysis was performed with anti-STAT3-PY antibody. Blots were stripped and reprobed with anti-STAT3 antibody. Results are representative of three separate experiments.
|
|
Next, to demonstrate specificity of the neutralizing antibody, recombinant IL-6 was neutralized with 10.0 µg/ml anti-midkine antibody. Figure 6B
shows that anti-midkine antibody did not block IL-6-induced STAT3 tyrosine phosphorylation.
Upon confirming the efficiency and specificity of the neutralizing antibody, 24-h CM was neutralized with 10.0 µg/ml anti-midkine antibody. Postconfluent preadipocytes were then stimulated with the neutralized CM. Figure 6C
shows that 24-h CM-induced STAT3 tyrosine phosphorylation was significantly reduced after the addition of anti-midkine antibody. Addition of control IgG, however, did not affect 24-h CM-induced STAT3 activation. These data suggest that midkine is primarily responsible for the autocrine/paracrine activation of STAT3.
Midkine is sufficient for mitotic clonal expansion
We previously reported that activated STAT3 plays a regulatory role during the proliferative phases of adipogenesis (10). Because midkine is the autocrine/paracrine activator of STAT3, we hypothesized that recombinant midkine would be sufficient to stimulate 3T3-L1 proliferation. To elucidate a role for midkine in mitotic clonal expansion, postconfluent preadipocytes were cultured in the presence of 10.0 ng/ml recombinant midkine, and cell proliferation was measured at several points after stimulation. Although not as potent as MDI, the addition of recombinant midkine to postconfluent preadipocytes promoted their proliferation or at a minimum maintained cell number in a time-dependent manner relative to cells in medium containing 10% FBS (Fig. 7
). These results are consistent with other studies suggesting that heparin binding growth factors contribute to the development of adipocyte hyperplasia (2).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 7. Effect of recombinant midkine stimulation on the proliferation phases of adipogenesis. Postconfluent preadipocytes were cultured in the presence of vehicle (PBS), 10.0 ng/ml recombinant midkine (rhMK), or MDI. The degree of preadipocyte proliferation was determined via a colorimetric proliferation assay 0, 24, 48, and 72 h after stimulation. Data shown reflect the means ± SE of nine experiments. *, P < 0.05 when the vehicle group was compared with the midkine group for each time point by t test.
|
|
Midkine is necessary for adipogenesis
Mitotic clonal expansion is required for progression through the differentiation program (27, 28, 29). Mitotic clonal expansion and stimulators of this process, however, may or may not be sufficient to induce differentiation in the absence of MDI. To determine the effect of exogenous midkine on differentiation, postconfluent preadipocytes were cultured in the presence of 10.0 ng/ml recombinant midkine for 72 h. From d 38, cells were maintained in culture medium alone. At various times after stimulation with recombinant midkine, expression of adipogenic transcription factors and accumulation of cytoplasmic triglyceride were assessed. Cells treated with recombinant midkine neither accumulated cytoplasmic triglyceride nor expressed adipogenic transcription factors (data not shown), suggesting that midkine is not sufficient for adipogenesis.
To determine whether midkine is necessary for adipogenesis, postconfluent preadipocytes were stimulated with MDI or MDI neutralized with 1.0 µg/ml anti-midkine antibody for 48 h. From d 28, cells were maintained in culture medium alone. At various times after stimulation with MDI or MDI plus anti-midkine antibody, expression of adipogenic transcription factors and accumulation of cytoplasmic triglyceride were assessed. Cells treated with MDI plus anti-midkine antibody accumulated significantly less triglyceride than cells treated with MDI alone as shown by Oil Red-O staining (Fig. 8B
). Consistent with these results, expression of the adipogenic transcription factors C/EBP
and PPAR
was also significantly reduced (Fig. 8A
). Stimulation with MDI plus control IgG did not affect C/EBP
or PPAR
expression. These data suggest that midkine is necessary for adipogenesis.
 |
Discussion
|
|---|
The present study reports the identification of a midkine-STAT3 signaling pathway that plays a necessary role in adipogenesis. This investigation was prompted by our initial observation that STAT3 activation during adipogenesis was delayed. These results suggested that a mechanism other than direct activation by MDI was involved. Our data showing immediate STAT3 tyrosine phosphorylation after stimulation with CM confirmed the involvement of an autocrine/paracrine factor. The fact that an autocrine/paracrine factor was identified only in CM from differentiating preadipocytes and not in CM from growth-arrested preadipocytes and adipocytes suggested that the factor was synthesized and released in a differentiation-dependent manner, and thus likely important in the regulation of adipogenesis. Our data showing inhibitory effects of cycloheximide and actinomycin D on this factor provided strong evidence for endogenous production of the factor, rather than conversion or generation of the factor from one of the components of the differentiation cocktail. Furthermore, our findings that midkine mRNA expression preceded the appearance of the STAT3-activating factor in CM, and that midkine antibodies neutralized the STAT3-activating effects of CM confirmed the identify of the autocrine activator as midkine. Because a sensitive method to detect rodent midkine protein was not available, we were not able to measure midkine levels in CM.
Leukemia-inhibitory factor, oncostatin M, and IL-6, potent activators of STAT3 in 3T3-L1 cells, are capable of activating STAT3 at nanomolar or nanogram per milliliter doses (30). In the present study, we report that midkine also activates STAT3 in 3T3-L1 cells at nanogram per milliliter concentrations. In the context of the above mentioned traditional activators, these data demonstrate that midkine is a relatively potent activator of STAT3. Also in this dose range, midkine was sufficient to simulate postconfluent preadipocyte proliferation. Although the effect of midkine on proliferation was small when compared with the effect of MDI, midkine clearly enhanced cell number when compared with the effect of serum containing medium alone. Because it is well established that the individual components of MDI do little to induce differentiation when used alone, the small effect of midkine on clonal expansion was not surprising (10, 31). By contrast, the inhibitory effect of midkine neutralization on differentiation was near complete. This led us to the important conclusion that midkine is necessary but not sufficient to induce mitotic clonal expansion and subsequent differentiation.
These findings are consistent with other studies demonstrating that midkine is a regulator of normal and transformed cell proliferation. Under physiological conditions, midkine stimulates the proliferation of fibroblasts (32) and skeletal muscle myoblasts (33). The finding that midkine is overexpressed in a number of cancer cell lines and primary tumors (16, 17, 18, 19, 20, 21, 34) implicates it in abnormal proliferation and carcinogenesis as well. Midkine has also been shown to serve as an autocrine mitogen for tumor cells (25), possess transforming properties (22), inhibit apoptosis (23), and promote angiogenesis (24).
Lastly, the midkine-related findings described in this report may have clinical relevance. It was previously reported that preadipocytes from massively obese persons replicate to a significantly higher degree than preadipocytes from lean persons (35), and that their exaggerated proliferative capacity is due in part, to the augmented production of mitogenic proteins. These mitogenic factors are released into the culture medium and act as autocrine/paracrine factors contributing to adipocyte hyperplasia (35). Because heparin binding growth factors are the mitogenic factors released by preadipocytes from both lean and massively obese persons (2), it is quite possible based on the findings in this report, that midkine plays a role in the increased cellularity associated with some forms of obesity.
In summary, we provided evidence in this report that midkine is an autocrine activator of STAT3 during early phases of adipogenesis. We also demonstrated that midkine itself induces preadipocyte proliferation likely through a STAT3 signaling pathway and concluded that the midkine/STAT3 pathway is necessary for adipogenesis. These data provide insight into the complexity of the early stages of adipocyte differentiation and highlight the importance of tyrosine phosphorylation in the proliferative phases of adipogenesis. Further studies are needed to determine midkines mechanism of STAT3 activation (i.e. receptor and associated nonreceptor tyrosine kinase) as the midkine/STAT3 pathway may play a role in the development of adipocyte hyperplasia and severe obesity.
 |
Acknowledgments
|
|---|
We thank M. Bond for critical reading of the manuscript.
 |
Footnotes
|
|---|
This work was supported by the U.S. Public Health Service Grants DK-53398 and DK-59337 from the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK). This work was supported in part by the National Institutes of Health/NIDDK Nutrition Training Grant DK-07686 (to E.R.C.).
Disclosure Statement: E.R.C, J.D., and K.H. have nothing to declare. J.B.H is currently employed by and has equity interests in Merck & Co.
First Published Online January 4, 2007
Abbreviations: C/EBP, CCAAT/enhancer binding protein; CM conditioned medium; FBS, fetal bovine serum; MDI, isobutylmethylxanthine, dexamethasone, and insulin; PPAR, peroxisome proliferator-activated receptor; STAT, signal transducer and activator of transcription; STAT3-PY, affinity-purified rabbit polyclonal phosphotyrosine 705-specific anti-STAT3.
Received August 18, 2006.
Accepted for publication December 27, 2006.
 |
References
|
|---|
- Wasserman F The development of adipose tissue. In: Renold AE, Cahill Jr GF, eds. Handbook of physiology, sect 5. Washington, DC: American Physiological Society
- Teichert-Kuliszewska K, Hamilton B, Deitel M, Roncari D 1992 Augmented production of heparin-binding mitogenic proteins by preadipocytes from massively obese persons. J Clin Invest 90:12261231[Medline]
- Green H, Kehinde O 1974 Sublines of mouse 3T3 cells that accumulate lipid. Cell 1:113116
- Tang QQ, Lane MD 1999 Activation and centromeric localization of CCAAT/enhancer-binding proteins during the mitotic clonal expansion of adipocyte differentiation. Genes Dev 13:22312241[Abstract/Free Full Text]
- Cornelius P, MacDougald OA, Lane MD 1994 Regulation of adipocyte development. Annu Rev Nutr 14:99129[CrossRef][Medline]
- MacDougald O, Cornelius P, Lin F, Chen S, Lane M 1994 Glucocorticoids reciprocally regulate expression of the CCAAT/enhancer-binding protein
and
genes in 3T3-L1 adipocytes and white adipose tissue. J Biol Chem 269:1904119047[Abstract/Free Full Text] - MacDougald O, Lane M 1995 Adipocyte differentiation. When precursors are also regulators. Curr Biol 5:618621[CrossRef][Medline]
- Tontonoz P, Hu E, Spiegelman B 1995 Regulation of adipocyte gene expression and differentiation by peroxisome proliferator activated receptor
. Curr Opin Genet Dev 5:571576[CrossRef][Medline] - Cao Z, Umek R, McKnight S 1991 Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev 9:15381552
- Deng J, Hua K, Lesser SS, Harp JB 2000 Activation of signal transducer and activator of transcription-3 during proliferative phases of 3T3-L1 adipogenesis. Endocrinology 141:23702376[Abstract/Free Full Text]
- Rosen ED, Spiegelman BM 2000 Molecular regulators of adipogenesis. Annu Rev Cell Dev Biol 16:145171[CrossRef][Medline]
- Wellstein A, Fang WJ, Khatri A, Lu Y, Swain SS, Dickson RB, Sasse J, Riegel AT, Lippman ME 1992 A heparin-binding growth factor secreted from breast cancer cells homologous to a developmentally regulated cytokine. J Biol Chem 267:25822587[Abstract/Free Full Text]
- Tomomura M, Kadomatsu K, Nakamoto M, Muramatsu H, Kondoh H, Imagawa K, Muramatsu T 1990 A retinoic acid responsive gene, MK, produces a secreted protein with heparin binding activity. Biochem Biophys Res Commun 171:603609[CrossRef][Medline]
- Muramatsu T 1993 Midkine (MK), the product of a retinoic acid responsive gene, and pleiotrophin constitute a new protein family regulating growth and differentiation. Int J Dev Biol 37:183188[Medline]
- Horiba M, Kadomatsu K, Nakamura E, Muramatsu H, Ikematsu S, Sakuma S, Hayashi K, Yuzawa Y, Matsuo S, Kuzuya M, Kaname T, Hirai M, Saito H, Muramatsu T 2000 Neointima formation in a restenosis model is suppressed in midkine-deficient mice. J Clin Invest 105:489495[Medline]
- Miyauchi M, Shimada H, Kadomatsu K, Muramatsu T, Matsubara S, Ikematsu S, Takenaga K, Asano T, Ochiai T, Sakiyama S, Tagawa M 1999 Frequent expression of midkine gene in esophageal cancer suggests a potential usage of its promoter for suicide gene therapy. Jpn J Cancer Res 90:469475[CrossRef]
- Aridome K, Tsutsui J, Takao S, Kadomatsu K, Ozawa M, Aikou T, Muramatsu T 1995 Increased midkine gene expression in human gastrointestinal cancers. Jpn J Cancer Res 86:655661[CrossRef]
- Ye C, Qi M, Fan QW, Ito K, Akiyama S, Kasai Y, Matsuyama M, Muramatsu T, Kadomatsu K 1999 Expression of midkine in the early stage of carcinogenesis in human colorectal cancer. Br J Cancer 79:179184[CrossRef][Medline]
- Kaname T, Kadomatsu K, Aridome K, Yamashita S, Sakamoto K, Ogawa M, Muramatsu T, Yamamura K 1996 The expression of truncated MK in human tumors. Biochem Biophys Res Commun 219:256260[CrossRef][Medline]
- Garver RJ, Chan C, Milner P 1993 Reciprocal expression of pleiotrophin and midkine in normal versus malignant lung tissues. Am J Respir Cell Mol Biol 9:463466[Medline]
- Garver RJ, Radford D, Donis-Keller H, Wick M, Milner P 1994 Midkine and pleiotrophin expression in normal and malignant breast tissue. Cancer 74:15841590[CrossRef][Medline]
- Kadomatsu K, Hagihara M, Akhter S, Fan Q, Muramatsu H, Muramatsu T 1997 Midkine induces the transformation of NIH3T3 cells. Br J Cancer 75:354359[Medline]
- Owada K, Sanjo N, Kobayashi T, Mizusawa H, Muramatsu H, Muramatsu T, Michikawa M 1999 Midkine inhibits caspase-dependent apoptosis via the activation of mitogen-activated protein kinase and phosphatidylinositol 3-kinase in cultured neurons. J Neurochem 73:20842092[Medline]
- Choudhuri R, Zhang H, Donnini S, Ziche M, Bicknell R 1997 An angiogenic role for the neurokines midkine and pleiotrophin in tumorigenesis. Cancer Res 57:18141819[Abstract/Free Full Text]
- Ratovitski EA, Kotzbauer PT, Milbrandt J, Lowenstein CJ, Burrow CR 1998 Midkine induces tumor cell proliferation and binds to a high affinity signaling receptor associated with JAK tyrosine kinases. J Biol Chem 273:36543660[Abstract/Free Full Text]
- Marrero MB, Schieffer B, Li B, Sun J, Harp JB, Ling BN 1997 Role of janus kinase/signal transducer and activator of transcription and mitogen-activated protein kinase cascades in angiotensin II- and platelet-derived growth factor-induced vascular smooth muscle cell proliferation. J Biol Chem 272:2468424690[Abstract/Free Full Text]
- Reichert M, Eick D 1999 Analysis of cell cycle arrest in adipocyte differentiation. Oncogene 18:459466[CrossRef][Medline]
- Patel YM, Lane MD 2000 Mitotic clonal expansion during preadipocyte differentiation: calpain-mediated turnover of p27. J Biol Chem 275:1765317660[Abstract/Free Full Text]
- Tang QQ, Otto TC, Lane MD 2003 Mitotic clonal expansion: a synchronous process required for adipogenesis. Proc Natl Acad Sci USA 100:4449[Abstract/Free Full Text]
- Stephens JM, Lumpkin SJ, Fishman JB 1998 Activation of signal transducers and activators of transcription 1 and 3 by leukemia inhibitory factor, oncostatin-M, and interferon-
in adipocytes. J Biol Chem 273:3140831416[Abstract/Free Full Text] - Rubin CS, Hirsch A, Fung C, Rosen OM 1978 Development of hormone receptors and hormonal responsiveness in vitro. Insulin receptors and insulin sensitivity in the preadipocyte and adipocyte forms of 3T3-L1 cells. J Biol Chem 253:75707578[Free Full Text]
- Muramatsu H, Muramatsu T 1991 Purification of recombinant midkine and examination of its biological activities: functional comparison of new heparin binding factors. Biochem Biophys Res Commun 177:652658[CrossRef][Medline]
- Hu J, Higuchi I, Yoshida Y, Shiraishi T, Osame M 2002 Expression of midkine in regenerating skeletal muscle fibers and cultured myoblasts of human skeletal muscle. Eur Neurol 47:2025[CrossRef][Medline]
- Miyashiro I, Kaname T, Shin E, Wakasugi E, Monden T, Takatsuka Y, Kikkawa N, Muramatsu T, Monden M, Akiyama T 1997 Midkine expression in human breast cancers: expression of truncated form. Breast Cancer Res Treat 43:16[CrossRef][Medline]
- Lau D, Roncari D, Hollenberg C 1987 Release of mitogenic factors by cultured preadipocytes from massively obese human subjects. J Clin Invest 79:632636[Medline]