help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-1022
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dubois, M.
Right arrow Articles by Lang, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dubois, M.
Right arrow Articles by Lang, J.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
*GLUCOSE
Endocrinology Vol. 148, No. 4 1605-1614
Copyright © 2007 by The Endocrine Society

Glucotoxicity Inhibits Late Steps of Insulin Exocytosis

Mathilde Dubois, Pierre Vacher, Benoît Roger, Deborah Huyghe, Brigitte Vandewalle, Julie Kerr-Conte, François Pattou, Naima Moustaïd-Moussa and Jochen Lang

Université de Bordeaux, Cell Biology Program [JE2390 (M.D., B.R., D.H., J.L.) and Institut National de la Santé et de la Recherche Médicale (INSERM) E347 (P.V.)], European Institute of Chemistry and Biology, 33607 Pessac, France; INSERM ERIT-M 0106 (B.V., J.K.-C., F.P.), Cellular Therapy of Diabetes, 59045 Lille, France; and The Nutrition Department (N.M.-M.), The University of Tennessee, Knoxville, Tennessee 37996-1920

Address all correspondence and requests for reprints to: Jochen Lang, Institut Européen de Chimie et Biologie, 2 rue Robert Escarpit, F-33607 Pessac, France. E-mail: j.lang{at}iecb.u-bordeaux.fr.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Prolonged exposure of ß-cells to high glucose (glucotoxicity) diminishes insulin secretion in response to glucose and has been linked to altered generation of metabolism-secretion coupling factors. We have investigated whether glucotoxicity may also alter calcium handling and late steps in secretion such as exocytosis. Clonal INS-1E ß-cells cultured at high glucose (20 or 30 mM vs. 5.5 mM) for 72 h exhibited elevated basal intracellular calcium ([Ca2+]i), which was KATP-channel dependent and due to long-term activation of protein kinase A. An increased amplitude and shortened duration of depolarization-evoked rises in [Ca2+]i were apparent. These changes were probably linked to the observed increased filling of intracellular stores and to short-term activation of protein kinase A. Insulin secretion was reduced not only by acute stimulation with either glucose or KCl but more importantly by direct calcium stimulation of permeabilized cells. These findings indicate a defect in the final steps of exocytosis. To confirm this, we measured expression levels of some 30 proteins implicated in trafficking/exocytosis of post-Golgi vesicles. Several proteins required for calcium-induced exocytosis of secretory granules were down-regulated, such as the soluble N-ethylmaleimide-sensitive factor-sensitive factor attachment receptor (SNARE) proteins VAMP-2 [vesicle (v)-SNARE, vesicle-associated membrane protein 2] and syntaxin 1 as well as complexin. VAMP-2 was also reduced in human islets. In contrast, cell immunostaining and expression levels of several fluorescent proteins suggested that other post-trans-Golgi trafficking steps and compartments are preserved and that cells were not degranulated. Thus, these studies indicate that, in addition to known metabolic changes, glucotoxicity impedes generation of signals for secretion and diminishes the efficiency of late steps in exocytosis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TYPE 2 DIABETES IS a progressive disease due to a gradual deterioration of ß-cell function in the presence of insulin resistance (1). The ensuing hyperglycemia worsens the insulin resistance and further impairs ß-cell function, thus creating a vicious circle. Indeed, human islets exposed to chronic high-glucose concentrations become insensitive to subsequent glucose stimulation (2, 3).

Insulin secretion is induced by glucose entry into ß-cells, and its metabolism leads to the generation of metabolic coupling factors including ATP. The increase in the ATP/ADP ratio induces closure of ATP-dependent K+ channels and membrane depolarization, which, in turn, leads to the opening of voltage-dependant Ca2+ channels. The ensuing increase in the concentration of free intracellular Ca2+ ([Ca2+]i) as well as the increase in ATP induces exocytosis, i.e. the movement of insulin-containing large dense core vesicles (LDCVs) to the plasma membrane, their docking and their fusion to release the peptide hormone. Chronically elevated glucose may exert its deleterious effects at different points of the sequence of events connecting elevation of extracellular glucose concentration to insulin release. Indeed, previous reports demonstrated alterations in ß-cell differentiation, leading to reduced glucose detection (4), modifications in glucose metabolism (5), in calcium handling (6) and an increased rate of apoptosis (7). Moreover, decreased responsiveness to stimuli such as arginine or sulfonylureas in islets from type 2 diabetic patients have been reported recently (8) and raises the question of whether glucotoxicity may also impede late steps in insulin secretion.

During recent years, a number of proteins implicated in exocytosis in ß-cell have been identified (9, 10, 11). The soluble SNARE [N-ethylmaleimide-sensitive factor (NSF) attachment receptor] complex, which includes the target (t)-SNAREs syntaxin (SYX) 1 and synaptosomal-associated membrane protein of 25 kDa (SNAP-25) as well as the vesicle (v)-SNARE vesicle-associated membrane protein 2 (VAMP-2), plays key roles in membrane fusion. The SNARE complex assembly and disassembly is modulated by additional proteins, including NSF (12), complexin (CPX) (13), and Rab GTPases (14). It is generally accepted that calcium sensitivity is at least in part mediated through the vesicular calcium sensor synaptotagmins (syt) (15, 16). Several studies have shown altered expression of SNARE proteins in islets of type 2 diabetic animal strains such as Goto-Kakizaki (GK) or fa/fa rats (17, 18, 19) and most recently in the pancreata of diabetic patients (20). These observations raise the possibility that altered expression of these proteins might be involved in the alteration of insulin secretion in ß-cells from diabetic subjects.

Given the complexity of type 2 diabetes, a potential causative role of hyperglycemia in changes in exocytosis and protein expression specifically in ß-cells is rather difficult to delineate in vivo. We have therefore investigated the influence of glucotoxicity on distal steps of insulin secretion using the well differentiated clonal ß-cell line INS-1E (21). As shown here, these cells provide a useful model with minimal apoptosis and changes in calcium handling that mimic the behavior of primary cells. More importantly, functional studies using intact and semipermeabilized cells clearly demonstrated a defect in the late steps of exocytosis. These alterations were accompanied by altered expression of several key proteins essential for exocytosis in clonal ß-cells and in islets.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
The following antibodies were obtained from commercial sources: anti-actin (Abcam, Cambridge, UK), anti-syt9 (Becton Dickinson, Franklin Lakes, NJ), anti-angiotensin, anti-angiotensin II type 1 receptor (Santa Cruz Biotechnology, Santa Cruz, CA), anti-CPX, anti-Munc18, anti-NSF, anti-SV2A or B, anti-synapsin 1, anti-syt7, and anti-{alpha}/ßSNAP (Synaptic Systems GmbH, Göttingen, Germany). Antibodies against cystein string protein (CSP), ß-COP, Golgi 58K, insulin, SNAP-25, synaptic vesicle protein of 38 kDa (SVP-38), syt2, syt8, SYX 1, VAMP-2, VAMP-7, Vti1a, and Vti1b have been described previously (22, 23). Monospecific polyclonal antibodies against syt10 and syt11 had been raised against synthetic peptides (Monterrat , C., and J. Lang, manuscript in preparation). The following antibodies and plasmids were generously donated: anti-ICA512 (Dr. M. Solimena, Dresden, Germany), anti-Rab3A (Dr. Y. Takai, Osaka, Japan), anti-Rab3B and C (Dr. R. Jahn, Goettingen, Germany), anti-Rab27A (Dr. G. de Saint Basile, Paris, France), anti-SYX3 (Dr. V. Olkkonen, Helsinki, Finland), anti-pantophysin (Dr. R. Leube, Mainz, Germany), anti-syt12 (Dr. C. Thompson, Baltimore, MD) and anti-SV2C (Dr. R. Janz, Houston, TX), signal-peptide eGFP [enhanced green fluorescent protein (GFP)] (Dr. P. Halban, Genève, Switzerland), VGF-eGFP (Dr. R. Possenti, Rome, Italy), phogrin-monomeric red fluorescent protein (mRFP) (Dr. W. Almers, Portland, OR), CD63-eGFP (Dr. G. Griffiths, Oxford, UK) and SVP-38-eGFP (Dr. C. Dotti, Torino, Italy). The plasmids encoding latrophilin-eGFP or human GH (hGH) have been described previously (24). Rp- (Rp-cAMPS) and Sp-isomers (Sp-cAMPS) of adenosine 3',5'-cyclic monophosphothioate were from Alexis Biochemicals (Lausen, Switzerland).

Cell culture, insulin secretion, apoptosis, and determination of cAMP
Human islets were obtained as described according to protocols for human subjects approved by the institutional review board (3). The human islets were placed in CMRL-1066 medium at different glucose concentrations for 72 h. INS-1E cells were generously provided by Drs. P. Maechler and C. B. Wollheim (Université de Genève, Switzerland) (21). All experiments were performed between passages 67 and 82. INS-1E cells were seeded at 75,000 cells/well in 24-well plates with complete medium (11 mM glucose). Three days later, medium was replaced by medium with indicated glucose concentrations for 72 h. Rp- or Sp-cAMPS, if present, was added during the last 48 h of incubation. For growth curves, cells were detached by trypsination and counted automatically (Coulter, Roissy, France). For static secretion assays, cells were washed twice and preincubated for 30 min at 37 C in glucose-free Krebs-Ringer bicarbonate HEPES buffer [KRBH, composition in mM: 135 NaCl, 3.6 KCl, 5 NaHCO3, 0.5 NaH2PO4, 0.5 MgCl2, 1.5 CaCl2, 10 HEPES, and 0.1% BSA (pH 7.4)]. Next, cells were washed with glucose-free KRBH and incubated in KRBH and glucose or KCl. Supernatants were collected for insulin secretion and cells detached with PBS containing 10 mM EDTA to measure intracellular insulin by ELISA (Mercodia, Uppsala, Sweden) and total proteins (Bradford assay; Bio-Rad, Marnes-la-Coquette, France). The mean insulin content of INS-1E cells cultured at 5.5 mM glucose was 4.4 ± 0.3 µg/106 cells. For assays using permeabilized cells, 24-well plates coated with poly-lysine were used (Sigma-Aldrich, Saint Quentin Fallavier, France). Preparation of intracellular buffers and permeabilization with streptolysin-O were performed as described (16, 23). After permeabilization for 7 min in intracellular buffer (0.1 µM free Ca2+), cells were exposed for 7 min to intracellular buffer containing 0.1 or 10 µM free Ca2+. Transient transfections and determination of hGH were performed as described (24, 25, 26). Briefly, cells were transfected for 4 h and subsequently medium containing different concentrations of glucose was added. Intensive washes after the transfection period did not alter the expression levels of the proteins studied. Apoptosis was quantified by determination of mitochondrial membrane potential using flow cytometry (25). cAMP levels were determined using an ELISA according to the manufacturer’s instruction (R&D Systems, Minneapolis, MN).

Microfluorometry and immunofluorescence
INS-1E seeded on glass coverslips and cultured as above were loaded with indo-1/AM (Sigma-Aldrich) and assayed as described (25). For immunocytochemistry, cells were fixed using 4% paraformaldehyde in PBS and further processed as previously reported (23, 25).

Protein expression and quantitative PCR (qPCR)
INS-1E were seeded at 3 x 106 cells in 75-cm2 Falcon flasks using complete medium (11 mM glucose) and cultured at different glucose concentrations for 72 h. Cells were detached with PBS containing 10 mM EDTA. INS-1E cells or islets were then resuspended in PBS/1% Triton X-100 containing a protease inhibitor cocktail (Sigma-Aldrich) and sonicated for 30 sec on ice. Equal amounts of protein (30 µg/lane) were resolved on sodium dodecyl sulfate-polyacryalmide gel and transferred to polyvinylidene difluoride membranes (Amersham Biosciences, Uppsala, Sweden). Treatment of membranes, image acquisition and quantification was as described (22). For all antibodies revealing significant differences standard curves were obtained which showed R2-values greater than 0.971 and a slope (a) equal or smaller than 1 (except for SVP-38). Data presented were generated using different lots and passages for over 1 yr.

Total RNA was extracted using RNeasy (QIAGEN, Courtaboeuf, France) and its quality checked by spectrophotometry and capillary electrophoresis. Reverse transcription was performed using Power Script (CLONTECH, Saint-Germain-en-Laye, France) for 90 min at 42 C and aliquots kept at –80 C. Primers for qPCR were selected by Primer Express software (Applied Biosystems, Courtaboeuf, France) and experimentally validated. The following primers were used: CACNA1C (Cav1.2) forward, ACCCCCGCTCAAAGTCTGTAG, reverse, GTGGTTTGTTCTTGCTTTCGAA; CACNA1D (Cav1.3) forward, TTCTGTGCAGCCGTTCTGAGT, reverse, CATCGCTTAACAAAACGGTTCC; CPX2 forward, TCCTGGACACGGTGCTCAA, reverse, GCCGGAAGAGGACAGGTTACT; ICA512 forward, GTGGCTGCACTGTCATCGTT, reverse, ACCCTTCATCCGGCCAGTAG; insulin-2 forward, AGGCTTTTGTCAAACAGCACCT, reverse, AAGAATCCACGCTCCCCAC; SNAP-25forward, CTGGCTCTTGTTGATCACCATCT, reverse, TCTCAGCAATTTGGTTGTGCAT; SYX1A forward, ACACCAAGAAGGCCGTCAAGT, reverse, CCAGAATCACACAGCAAATGATG; SVP-38 forward, CCCGTTTGTCCCGGAATAC, reverse, CAACACACGATCACAGGCACTA; Syt9 forward, CGAGTATGTCACCAACGATAATGTG, reverse, TGCCGGCTGTTGGAAGATAG; VAMP2 forward, CCAAACTCTTCCCCCACACA, reverse, AGCATCTCTCCTACCCTTTCACAC. qPCR was performed using DNA polymerase Thermus brockianus and DyNamoTM SYBR Green qPCR Kit (Finnzymes, Saint Quentin, France) at 40 cycles and fluorescent measured using Opticon 2 (MJ Research/Bio-Rad, Marnes-la-Coquette, France). Assays were performed on four independent samples. {Delta}Ct (cycle threshold) values were normalized to EF-1a and ß-actin levels, expressed as the percentage of mean {Delta}Ct values for cells cultured at 5.5 mM glucose.

Statistical analysis
Values are presented as mean ± SEM and significance of differences assessed by t test for paired data. In the case of qPCR, one-way ANOVA was applied in view of the data transformations to test for significance of changes in gene expression in one condition (glucose) and Bonferoni’s test was used to compare different glucose incubations.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Glucotoxicity abolishes glucose-stimulated insulin secretion and reduces insulin content
INS-1E cells have been used previously as a model for glucotoxicity (27, 28) employing incubations of 48 h or less. To adapt this model for proteomic approaches, we prolonged the incubation to 72 h and first investigated parameters such as insulin secretion, hormone content, and apoptosis. As shown in Fig. 1AGo, 72 h culture at glucose above 11 mM largely reduces insulin secretion in response to an acute stimulation by 15 mM glucose compared with 2.8 mM glucose. A dose-response curve (Fig. 1AGo, inset) demonstrated that concentrations above 11 mM did not increase further the release of the hormone in cells cultured at 20 mM. In contrast to the secretion experiments, the content of mature peptide hormone was already reduced by 50% at 11 mM glucose and a further augmentation of glucose to 20 and 30 mM only slightly exacerbated the observed reduction (Fig. 1BGo). Using qPCR to assess the expression of the insulin-2 gene, we observed no change in gene expression between 5.5 and 11 mM glucose, but a –2.5-fold change (±0.4; n = 4) at 20 mM glucose. Note that only the expression of the insulin-2, but not of the insulin-1, gene was altered (data not shown). When expressing secretion data in terms of content, an elevated basal release was evident for cells cultured at glucose concentrations of 11 or higher (Fig. 1BGo, inset), which was, however, reduced in absolute terms compared with cells cultured at 5.5 mM glucose. We determined whether the effects of elevated glucose concentrations were due to induction of apoptosis. We found that the culture conditions we used here only slightly increased the percentage of apoptotic cells using a very sensitive assay relying on mitochondrial membrane potential. According to this criterion, we observed 10 and 12% of apoptotic cells at 20 and 30 mM glucose compared with 5% at 5.5 mM glucose (Fig. 1CGo). Note also that only few pycnotic nuclei were detectable using Hoechst 33258, and appreciable changes were absent in DNA laddering (data not shown). Culture at elevated glucose for 72 h increased cell number by 29% ± 8.4 (11 mM glucose) and 57% ± 9.6 (20 mM glucose) compared with 5.5 mM glucose (n = 4). These observations were made over a wide number of passages and are comparable to those described for shorter incubations (27).


Figure 1
View larger version (18K):
[in this window]
[in a new window]

 
FIG. 1. Glucotoxicity modifies glucose-stimulated insulin secretion, insulin content, and apoptosis in INS-1E cells. Cells were cultured for 72 h in the presence of indicated concentrations of glucose (Glc). A, Insulin secretion evoked by 30 min incubation with 2.8 (open symbols) or 15 mM glucose (closed symbols). Values were determined as insulin/cellular protein and are expressed as percent of control. Inset, Stimulatory response of INS-1E cells cultured at 5.5 (open symbols) or at 20 mM glucose (closed symbols) for 72 h to increasing levels of glucose (30 min). B, Insulin content normalized for protein and expressed as percent of content in cells cultured at 5.5 mM glucose. Inset, Insulin secretion data (as in panel A) expressed as percent of hormone content. C, Apoptosis. *, 2p < 0.05.

 
Glucotoxicity alters calcium handling
Glucose metabolism induces closure of KATP channels, followed by membrane depolarization, opening of voltage-dependant Ca2+ channels, and influx of the cation (10). We therefore examined whether prolonged exposure to elevated glucose levels may alter the handling of cytosolic calcium ([Ca2+]i). As shown in Fig. 2AGo, spontaneous calcium spikes were observed in single cells and the percentage of these spontaneously active cells was increased by exposure of cells to 20 or 30 mM glucose (Fig. 2BGo). Moreover, cells cultured in 20 or 30 mM glucose consistently showed an increase in the level of basal [Ca2+]i (Fig. 2Go, A and B). Acute addition of diazoxide, an opener of KATP channels, to cells precultured at 20 mM glucose completely inhibited spontaneous activity (Fig. 2AGo, right panel) and reduced the elevated basal [Ca2+]i by 40 ± 0.4 nM (n = 18). This suggests that both increased spontaneous activity and elevated basal [Ca2+]i may be induced by closure of the KATP channel subsequent to glucose metabolism. Eighty percent of cells cultured at 5.5 mM glucose responded to acute stimulation by 15 mM glucose by an increase in [Ca2+]i. Two types of responses were observed: a small but long-lasting response or a shorter prominent rise in [Ca2+]i (Fig. 2CGo, left panel). In contrast, only 25% of cells previously kept at 20 or 30 mM glucose responded to an acute challenge with 15 mM glucose (Fig. 2CGo, right panel; 2DGo) and the observed amplitude was considerably smaller (Fig. 2Go, C and D). Moreover, the duration of the response to 15 mM glucose was significantly shortened from 423 ± 30 sec (culture at 5.5 mM glucose) to 141 ± 20 and 98 ± 24 sec after culture at 20 mM or 30 mM glucose, respectively.


Figure 2
View larger version (34K):
[in this window]
[in a new window]

 
FIG. 2. Glucotoxicity alters calcium handling. Cytosolic free calcium ([Ca2+]i) was determined in individual INS-1E cells cultured for 72 h at 5.5, 20, or 30 mM glucose (Glc). Representative traces (culture at 5.5 or 20 mM glucose; A, C, E, and G) and statistics (B, D, F, and H) are given. A and B, Spontaneous activity at 2.8 mM glucose (G) after culture at 5.5, 20, or 30 mM glucose (n = 95, 59, and 86). Diazoxide (100 µM) inhibits spontaneous activity and reduces elevated basal [Ca2+]i. C, Type of responses to acute stimulation by 15 mM glucose. D, Culture at elevated glucose reduced the number of responding cells and the amplitude of [Ca2+]i rises evoked by 15 mM glucose (n = 60, 10, and 12). E–H, Culture at elevated glucose increases the amplitude in response to 30 mM KCl (E and F; n = 20, 26, and 33) or 100 µM glibenclamide (G and H; n = 13 and 9). An abrupt termination was often observed in cells cultured in 20 mM glucose (E, arrow) resulting in shortened duration (F). Recordings of similar amplitude are given in E. K, Response to thapsigargin (TG), 1 µM. *, 2p < 0.05 compared with culture in 5.5 mM glucose.

 
To get further insight into the events altered by glucotoxicity, we determined the response to KCl, which does not imply the KATP channel, and to glibenclamide, which will directly close the KATP channel. Membrane depolarization by KCl induced an increase in [Ca2+]i (Fig. 2EGo, left panel), which was considerably enhanced after culture with elevated levels of glucose (Fig. 2EGo, right panel). Similar to stimulation by glucose, the duration of the response was reduced after culturing cells in 20 or 30 mM glucose (Fig. 2FGo). In addition, the apparent plateau phase was often terminated by an abrupt decrease (Fig. 2EGo, arrow) suggestive of altered calcium transport out of the cytosol. As with KCl treatment, closure of KATP channels by glibenclamide produced a more pronounced increase in [Ca2+]i after preculture in 20 mM glucose (Fig. 2Go, G and H). We also tested the filling of intracellular stores by application of thapsigargin (1 µM). As shown in Fig. 2KGo, the response to thapsigargin was enhanced in cells cultured at 20 mM of glucose (n = 13) compared with cells cultured at 5.5 mM of glucose (n = 12). Thus, INS-1E cells precultured at elevated glucose exhibit increased basal [Ca2+]i, augmented filling of intracellular stores, and a decreased response to glucose.

In view of the acute effect of diazoxide on basal [Ca2+]i, we also examined the long-term effects of the drug. Diazoxide (100 µM) continuously present during 72 h culture in 5.5 mM glucose significantly raised the basal [Ca2+]i from 99.4 ± 1.6 (n = 24) to 115.2 ± 3.1 (n = 28; 2p < 0.01) and reduced subsequent stimulation by glucose (15 mM) by 53.8 ± 10.4% compared with the absence of diazoxide (n = 6–9). Diazoxide present in the culture did not reverse the diminution of the calcium response in cells cultured at 20 mM glucose. These findings were not due to a contaminating presence of diazoxide from the culture period during the assay. Indeed, cells cultured at 20 mM glucose and 100 µM diazoxide still responded to acutely added diazoxide (100 µM) by a reduction of the basal [Ca2+]i by 17.3 ± 9.2 nM (n = 7). Although these data are in agreement with previous reports in human islets (29), the increase in basal [Ca2+]i in cells cultured at 5.5 mM glucose even by a low dose of diazoxide renders interpretation of these findings difficult and may reflect additional effects of the drug on the mitochondria (30).

Glucose is known to stimulate certain forms of adenylate cyclase in insulin-secreting cells (31, 32). cAMP levels amounted to 10.8 ± 1.8 pmol/mg protein after 72 h of culture at 5.5 mM glucose and were increased by 16 ± 15.8 (11 mM), 14.6 ± 8.5 (20 mM), and 46 ± 25.9% (30 mM; n = 9; P < 0.05 vs. 5.5 mM). We therefore examined whether increased levels of cAMP may contribute to altered calcium handling. We used only KCl as a stimulus here to separate calcium influx from glucose metabolism. Short-term (2 h) or long-term treatment (48 h) with an agonist or antagonist of protein kinase A (PKA) was used to distinguish between genetic and nongenetic effects. As shown in Fig. 3Go, the increase in basal [Ca2+]i induced by 72 h exposure to elevated levels of glucose can be mimicked by treatment with the PKA agonist Sp-cAMPS (10 µM) of cells kept at 5.5 mM glucose. Moreover, the effect induced by 20 mM glucose is partially counteracted by 48 h treatment with the PKA antagonist Rp-cAMPS (10 µM), but not by a 2 h treatment before the recordings. Therefore, at least part of the rise in basal [Ca2+]i may be induced by prolonged activation of PKA during glucotoxicity. In contrast, the observed increase in the amplitude of the KCl-evoked response in cells cultured with elevated glucose was not altered by 2 or 48 h treatment with Rp-cAMPS (Fig. 3Go, middle panel). The increase induced by Sp-cAMPS in cells kept at 5.5 mM glucose probably just reflects the known effect of PKA on calcium influx but is probably not causally linked to glucotoxicity as Rp-cAMPS was ineffective at elevated glucose. The third parameter affected by culture at 20 mM glucose, the duration of the KCl-evoked response, was sensitive not only to 48 h exposure to Rp-cAMPS, but already affected by 2 h of treatment with the antagonist. Moreover, at 5.5 mM glucose the PKA agonist Sp-cAMPS partially mimicked the reduction in the duration of the response to KCl. An acute activation of PKA and phosphorylation of proteins without changes in gene expression provides the most straightforward explanation for this observation.


Figure 3
View larger version (41K):
[in this window]
[in a new window]

 
FIG. 3. Activation of PKA is implicated in altered basal [Ca2+]i and shortened duration of KCl-evoked increases in [Ca2+]i during glucotoxicity. [Ca2+]i was determined in individual INS-1E cells cultured for 72 h at 5.5 or 20 mM glucose (Glc) as in Fig. 2Go. Upper panel, Long-term (last 48 h of 72 h glucose pretreatment), but not short-term (last 2 h of 72 h glucose pretreatment), incubation with the PKA antagonist Rp-cAMPS reduces basal [Ca2+]i elevated by culture of cells at 20 mM glucose. Middle panel, The PKA antagonist Rp-cAMPS (10 µM) does not change the altered amplitude of KCl-evoked [Ca2+]i increase in cells cultured at 20 mM (n = 60, 10, and 12). Lower panel, Short-term treatment (2 h) with Rp-cAMPS (10 µM) of cells cultured at 20 mM glucose partially restores the duration of the KCl-induced response in cells cultured at 20 mM glucose. Note that the effects of 2 and 48 h treatment with Rp-cAMPS were not statistically different. In cells cultured at 5.5 mM glucose the PKA agonist Sp-cAMPS (10 µM) partially mimicked the effect of culture at 20 mM glucose; n = 20–95; *, 2p < 0.05 compared with culture in 5.5 mM glucose alone; +, 2p < 0.05 compared with culture in 20 mM glucose alone.

 
Glucotoxicity inhibits late steps in insulin exocytosis
To examine late steps in excitation-secretion coupling, we stimulated INS-1E with KCl to bypass the consequences of altered glucose metabolism. Because depolarization-induced insulin release is known to be more transient than glucose-induced secretion, incubation times were shortened. Preculture of cells at 20 mM glucose abolished glucose-induced insulin secretion and, most interestingly, also KCl-evoked hormone release (Fig. 4AGo). Although we had expected a reduction in KCl-induced insulin secretion in view of the shortened increase in [Ca2+]i subsequent to depolarization, we were surprised by the almost complete inhibition in terms of secretion. Therefore, we assessed directly the late steps of secretion, which take place subsequent to membrane depolarization and calcium influx. To this end, we employed cells permeabilized by streptolysin-O, which creates large and stable pores in the plasma membrane. Defined levels of cytosolic calcium can be imposed on these permeabilized cells via the pores, thus circumventing any influence of channels or endogenous soluble molecules. As shown in Fig. 4BGo, direct stimulation of exocytosis by 10 µM free calcium was again reduced after culture in 20 mM glucose. Because calcium is the final trigger for a subset of fusion competent vesicles, this indicated that the ultimate step in exocytosis was changed.


Figure 4
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 4. Glucotoxicity alters calcium-induced insulin exocytosis in intact and in streptolysin-O permeabilized cells. A, Secretion in response to 15 mM glucose (Glc) or 50 mM KCl (10 min) in intact cells cultured for 72 h at 5.5 or 20 mM glucose. B, Exocytosis from permeabilized cells (cultured as in A) in response to 0.1 or 10 µM of free Ca2+. *, 2p < 0.05 compared with culture in 5.5 mM glucose.

 
Glucotoxicity does not alter the distribution of subcellular compartments
Culture in elevated glucose reduces the cellular insulin content, and it was important to examine whether secretory vesicles were still present and localized near the plasma membrane. The reduction in insulin content may result from reduced mRNA expression, stability, or conversion of the propeptide as well as increased secretion during the culture at elevated glucose levels (33). We therefore tested the expression of insulin and of other cargos or membrane proteins of post-Golgi vesicles using transient expression of different marker proteins. Because the constructs employed did not contain any regulatory elements susceptible to be altered by glucose, their expression should inform about the capacity of the cell to store the protein products and to distribute it to the respective compartments. hGH can be transiently expressed in insulin-secreting cells. It localizes to secretory granules, is secreted in a regulated manner, and thus provides a reporter gene product that does not contain any glucose-dependent regulatory sequences (25). As shown in Fig. 5AGo, the cellular content of transiently expressed hGH is not diminished but actually increased by culture at 11–30 mM glucose compared with 5.5 mM glucose. The observed increase may be due to the known mitogenic action of glucose and resulting increased cell number (34). A similar effect was observed for several markers of exocytotic vesicles (Fig. 5BGo). The signal peptide of preproinsulin fused to eGFP directs eGFP to the secretory pathway including LDCVs (35). Similarly, the peptide hormone VGF, endogenously expressed in pancreatic ß-cells, localizes to secretory vesicles upon fusion to GFP (36, 37). We observed mainly a 35-kDa form indicating correct cleavage by prohormone convertases 1/3 (37). Pancreatic ß-cells are endowed with a second regulated secretory pathway consisting of synaptic-like microvesicles (SLMVs) (38) carrying the transmembrane protein SVP-38 as a marker. As a comparison, the transient expression of eGFP alone and of endogenous actin is shown. These data suggest that the capacity of the cells to generate exocytotic vesicles is at least not diminished.


Figure 5
View larger version (37K):
[in this window]
[in a new window]

 
FIG. 5. Glucotoxicity does not diminish expression of transiently expressed secretory proteins or alter distribution of post-Golgi vesicles. Glucose (Glc) concentrations during 72 h culture of INS-1E cells are indicated. A, Intracellular levels of transiently expressed hGH (normalized to protein and 5.5 mM Glc set as 100%). B, Immunoblots of transiently expressed VGF-eGFP, signal peptide-eGFP, SVP38-eGFP, or eGFP as well as endogenous actin. The blots are representative of four independent experiments. C, Confocal imaging of endogenous insulin, syt9 as well as transiently expressed VGF-eGFP, SVP-38-eGFP, or phogrin-mRFP.

 
We next examined whether any difference in localization may be apparent. As shown in Fig. 5CGo, immunoreactive insulin as well as the secretory granule and SLMV marker syt9 was distributed in a comparable fashion irrespective of culture conditions. The same was true for transiently expressed VGF-eGFP, SVP-38-eGFP, or phogrin-mRFP, a membrane protein on secretory granules and endocytotic vesicles. In addition we could not observe any alteration for CD63-eGFP, a marker for the multivesicular bodies in the endocytotic pathway (23), or for the transmembrane receptor LPH (25), used as a marker for the constitutive transport (data not shown). These observations indicate that the distribution of several distinct vesicle types in the post-Golgi pathway was not grossly altered and cannot explain the defects observed in late steps of exocytosis.

Glucotoxicity alters the expression of several key proteins in exocytosis
In view of the pronounced changes in late steps in exocytosis we determined the expression of 30 proteins known to be involved in different steps of the secretory pathway including exocytosis (mean changes of less than 20% were disregarded). Insulin exocytosis requires the membrane bound SNARE proteins SNAP-25, SYX 1, and VAMP-2 (9). They act most likely at the fusion step itself although SNAP-25 has a broader distribution and function (39). Similar to observations in islets (40), actin content was not altered, which allowed normalization of expression data. In contrast, the expression of VAMP-2 and SYX 1 were reduced, whereas SNAP-25 was increased (Fig. 6AGo). The effect was more pronounced at higher glucose concentrations but always present at least after culture at 20 mM glucose. In contrast, expression of SNARE proteins involved in other transport steps, such as the SYX 3, endocytototic/lysosomal VAMP-7, the Golgi/post-Golgi SNAREs Vti-1a and -b or the SNARE-interacting protein Munc18 were not changed (see Table 1Go). Cellular function of the SNARE complex requires binding of cytosolic CPX to the assembled ternary SNARE complex (13, 41). As shown in Fig. 6AGo, total levels of CPX were reduced, and we also determined its levels after separation of homogenates in membrane pellets and cytosolic supernatants. The observed decrease was considerably more pronounced in the membrane fraction (Fig. 6BGo), suggesting that culture at elevated glucose levels did not only alter expression levels but also subcellular distribution. In contrast to CPX, the expression of two other soluble components that interact with the SNARE complex subsequent to exocytosis, i.e. {alpha}SNAP and NSF, remained stable (Table 1Go). ICA512, a vesicular and plasma membrane protein (42), and SVP-38, a protein on SLMVs, as well as pantophysin, an SVP-38 homolog residing on transport vesicles (43, 44), were considerably reduced after culture in 20 or 30 mM glucose (Fig. 6AGo). In contrast, other transmembrane proteins of post-Golgi vesicles, such as SV2A, B, and C or syt9, one of the calcium sensors in INS-1E cells expressed on secretory granules (15), as well as syt7, were either slightly increased or not altered. This suggests the regulation of specific proteins, but not a generalized reduction in vesicular transmembrane proteins. We did not observe any change for several other isoforms of syt (Table 1Go), although syt12 was slightly reduced. We were also unable to detect any significant change in the total amount of Rab proteins known to participate in the regulation of insulin exocytosis (Table 1Go). In addition, several other proteins involved in the traffic along the secretory pathway such as the vesicular chaperone CSP (22), the Golgi marker G58K, the ER/Golgi coat protein ß-COP, or the cytosolic synapsin 1 were unaltered. Another peptide hormone expressed and secreted in primary ß-cells, i.e. angiotensin, and its receptor AT1 (45), remained stable.


Figure 6
View larger version (34K):
[in this window]
[in a new window]

 
FIG. 6. Glucotoxicity alters the expression of exocytotic proteins in INS-1E cells. Cells were cultured at indicated glucose (Glc) concentrations for 72 h. A, Representative immunoblots of proteins with significantly altered expression levels by culture at elevated glucose. Actin was used as control. Quantification of expression from at least four independent experiments on distinct passages is shown. Values were normalized to intensities at 5.5 mM glucose set as 0%. B, Representative immunoblots of CPX in membrane pellets and cytosolic supernatants from INS-1E cells. Quantification of CPX in membranes and cytosol, values normalized as above. *, 2p < 0.05 compared with culture in 5.5 mM glucose.

 

View this table:
[in this window]
[in a new window]

 
TABLE 1. Proteins with expression levels not significantly altered by glucotoxicity

 
We further examined whether the observed changes in SNARE protein expression may also occur in primary cells. As shown in Fig. 7Go, culture of human islets at different glucose concentrations produced comparable and significant changes in SNAP-25 and VAMP-2, as well as ICA512, whereas SYX1 was not altered.


Figure 7
View larger version (32K):
[in this window]
[in a new window]

 
FIG. 7. Glucotoxicity alters the expression of exocytotic proteins in human islets. Islets were cultured at indicated glucose (Glc) concentrations for 72 h. Left panel, Representative immunoblots of proteins with significantly altered expression levels by culture at elevated glucose. Actin was used as control. Right panel, Quantification of expression. Values were normalized to 5.5 mM glucose set as 100%. *, 2p < 0.05, n = 5.

 
To determine whether changes in protein levels follow alterations in mRNA levels we resorted to qPCR (Fig. 8Go). The results obtained demonstrate a significant increase for SNAP-25 and syt9, in parallel with the protein data, whereas no significant change was apparent for VAMP-2, SYX1A, CPX, or SVP-38. ICA512 was up-regulated in accordance with its role in signaling of vesicle utilization (42). We also assessed expression of L-type calcium channels using probes directed against Cav1.2 (CACN1C) and Cav1.3 (CACN1D). Cav1.3 was about two times more abundant than Cav1.2 (data not shown) and both were down-regulated at 11 and at 20 mM glucose.


Figure 8
View larger version (21K):
[in this window]
[in a new window]

 
FIG. 8. Glucotoxicity alters mRNA levels of exocytotic proteins and calcium channels in INS-1E cells. mRNA levels were compared by qPCR in cells cultured at indicated glucose (Glc) concentrations for 72 h. Data are presented as percent change compared with 5.5 mM glucose set as 0% (for details see Materials and Methods). *, 2p < 0.05, n = 4.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Altered secretory function of ß-cells after prolonged exposure to elevated levels of glucose has been linked to changes in glucose detection and metabolism, apoptosis, and calcium handling. We now provide evidence that, in addition to these changes, final steps in insulin secretion, i.e. exocytosis, are impeded. This dysfunction is accompanied by an altered expression of proteins known to be required for insulin exocytosis. Although clonal ß-cells do not always reflect the behavior of primary cells and islets or from rodent or humans, certain similar characteristics were apparent. Because insulin exocytosis is triggered by an increase in cytosolic calcium subsequent to glucose metabolism, it was crucial to investigate first calcium handling in glucotoxicity, which has not been performed previously in clonal ß-cells. Similar to primary human or rat ß-cells, glucotoxicity in these cells is characterized by an increase in basal [Ca2+]i and spontaneous oscillations due to closure of KATP channels, as evidenced by the effect of diazoxide (6, 29, 46). This suggests that cells cultured at high glucose are already partially depolarized. The enhanced basal levels and spontaneous activity in [Ca2+]i coincide with a well-documented augmented metabolic flow and explain the increase in basal secretion previously noted in INS-1 cells or rat islets (6, 27). The inhibitory effect of glucotoxicity on [Ca2+]i in response to an acute challenge by glucose is probably not linked to a major alteration in function of the KATP channel because the effect of glibenclamide was not reduced. In contrast, overfilling of intracellular Ca2+ stores was apparent in glucotoxicity similar to rat and human islets (6, 29). This reflects altered transport of calcium from the cytosol and may explain the initial increase in amplitude as observed for KCl or glibenclamide as well as the reduced duration of the response. The latter is most likely due to avid but retarded uptake into intracellular stores. In addition, the down-regulation of L-type calcium channels {alpha}-subunits observed at the mRNA level may further contribute to altered [Ca2+]i, although the precise contribution of distinct isoforms remains a matter of debate (47). In line with the known stimulatory effect of acutely added glucose on cellular levels of cAMP in clonal MIN6 ß-cells (31, 32) we observed increased levels after chronic exposure of INS-1E cells to the sugar. Interestingly, PKA may be involved in some, but not all, aspects of altered calcium handling in glucotoxicity. The specificity of Rp-cAMPS suggests that the observed effects are not mediated by cAMP-regulated guanine nucleotide exchange factors known to regulate the KATP channel (48).

Whereas the glucose-induced change in basal [Ca2+]i was sensitive to long-term treatment with a PKA antagonist, the altered duration of depolarization evoked calcium rises were partially restored after short-term treatment and the increase in amplitude was independent of agonist treatment. The differential requirement for long-term and short-term treatment with antagonists may imply changes in gene expression induced by PKA in the former and phosphorylation of proteins implicated in calcium handling in the latter case. These observations suggest that not only adaptive changes in glucose metabolism play a role in glucotoxicity, but glucose- mediated alterations in calcium and cAMP signaling are equally important and linked to each other.

Culture of INS-1E cells at glucose levels greater than 5.5 mM decreased the amount of insulin content as described for islets from rat, human, or from diabetic patients (8, 29, 49). Changes in expression, maturation, or storage of mature peptide hormone may cause such a reduction. Indeed, in line with our data using qPCR, a large reduction in mRNA has been reported for INS-1 cells incubated for 48 h at 16.7 mM of glucose (50), in animal models of diabetes (51) and human diabetic islets (8). Several lines of evidence suggest that the changes observed here are not due to increased release during culture resulting in degranulation. Indeed, expression levels of transiently expressed hGH, VGF-eGFP, or signal-peptide eGFP, used as markers of the secretory pathway, were not decreased. Similarly, the expression levels of syt9, a transmembrane protein of secretory granules, was not diminished but even slightly increased. In addition, we did not observe any appreciable redistribution of several endogenous as well as transiently expressed LDCV markers. Our data indicate also that other post-Golgi compartments are largely preserved. Although we found a marked reduction in the endogenous SLMV protein SVP-38, this was not the case for endogenous SV2 or transiently expressed SVP-38 that lacks regulatory sequences. In addition, endogenous or transiently expressed markers of endocytotic vesicles, such as the tetraspanin CD63 or syt7, remained stable. These observations indicate a specific regulation of certain individual proteins but preservation of the post-Golgi vesicular compartments. As far as processing is concerned, the predominant expression of VGF-eGFP as a 35-kDa fusion protein suggests correct processing of the peptide by PC1/3 (37), although minor changes cannot be excluded. Our data reported here clearly demonstrate that glucotoxicity is accompanied by a deficiency in late steps in insulin exocytosis. A reduction of depolarization-induced insulin secretion similar to glucose-induced release had also been reported in rat islets after exposure either to high glucose compared with high glucose in the presence of diazoxide (46). Although the experimental design was different, it suggests the presence of a comparable phenomenon in primary cells. Experiments in permeabilized cells allowed us to delineate the secretory defect more precisely as only such an approach really measures the final events in secretion (9). In contrast to calcium-induced secretion in permeabilized cells, KCl-induced release in intact cells was fully abolished. This more pronounced effect of depolarization-induced secretion may well reflect the combination of shortened duration of KCl-evoked calcium responses, down-regulation of calcium channels, and defects in calcium-evoked exocytosis itself. Most importantly, our observations link for the first time secretory deficiency to the calcium-dependent step.

The reduction in exocytosis was accompanied by an altered expression of SNARE proteins, which are required for membrane fusion (9, 10, 11). Interestingly, we did not observe any alteration in the putative calcium-sensors in insulin exocytosis, such as syt7, and only a minor increase in syt9, which might represent a compensatory mechanism by enhanced gene expression. In contrast, the SNARE protein VAMP-2 was diminished solely at the protein level by culture at 20 and 30 mM glucose in INS-1E and human islets as previously described in diabetic animal strains or in rat islets cultured at high glucose (17, 40). Interestingly, we also found a reduction for the soluble component CPX, which has not been reported before. CPX binds to specific SNARE complexes, is required for insulin exocytosis (13), and has been implicated in the calcium sensitivity of exocytosis (52). The reduction in membrane-bound CPX indicates a diminution in fusion-competent SNARE complexes. The reduction in SNARE complexes may in part explain deficient calcium-dependent exocytosis. In contrast, expression of the SNARE protein SNAP-25 was increased in line with reports from islets cultured at high glucose (40, 46). Because the amount of membrane bound exocytotic SNARE complexes was decreased according to our data on CPX, the increase in SNAP-25 expression may reflect its function in exocytotic pathways distinct from hormone secretion. Indeed, a role for SNAP-25 in cell differentiation and plasma membrane expansion has been reported most recently (39) and does not implicate CPX (41). Interestingly, levels of SNAP-25 are decreased in GK rats compared with wild-type Wistar rats and GK rats have an impaired rate of ß-cell regeneration (40, 53). SYX1A was decreased in INS-1E cells, but not in human islets as had been previously been reported for rat islets (40). The difference may reflect the presence of {alpha}-cells in islet preparations because glucose-induced up-regulation of syntaxin has been reported at least in a clonal {alpha}-cell line (54). The specificity of our findings is underscored by the fact that other SNARE proteins or SNARE-interacting proteins remained unaltered, such as CSP, {alpha}/ß SNAP, NSF, Munc18, Vti-1 SNAREs, or VAMP-7. In addition to altered expression of SNARE proteins, we also observed decreased mRNA levels for Cav1.2 and Cav1.3 {alpha}-subunits. Both are known to be reduced in islets of prediabetic and diabetic ZDF rats and may contribute to the observed phenotype (55, 56).

In conclusion, prolonged exposure to elevated glucose levels is not only characterized by altered metabolism and generation of coupling factors, but also exhibits a defined functional deficiency in late steps of insulin secretion and expression of exocytotic proteins. Both altered generation of calcium signals and changed sensitivity of exocytosis to the cation contribute to the final outcome. Our work has delineated some proteins as likely candidates, and future research may reveal the role of additional mechanisms such as posttranslational modifications and altered membrane lipid compositions.


    Footnotes
 
This work was supported by grants from the Region of Aquitaine (INRHA), the University of Bordeaux I (BQR2005), the National Ministry of Research and ALFEDIAM-SERVIER (to M.D. and J.L.). N.M.-M. was a recipient of a Fulbright Aquitaine Scholarship.

First Published Online January 4, 2007

Abbreviations: [Ca2+]i, Free intracellular Ca2+; CPX, complexin; CSP, cystein string protein; eGFP, enhanced GFP; GFP, green fluorescent protein; GK, Goto-Kakizaki; hGH, human GH; KATP, ATP-dependent potassium channel; LDCVs, large dense core vesicles; mRFP, monomeric red fluorescent protein; NSF, N-ethylmaleimide-sensitive factor; PKA, protein kinase A; qPCR, quantitative PCR; SLMVs, synaptic-like microvesicles; Rp-cAMPS and Sp-cAMPS, isomers of adenosine 3',5'-cyclic monophosphothioate; SNAP-25, synaptosomal-associated membrane protein of 25 kDa; SNARE, soluble NSF-sensitive factor attachment receptor; SVP-38, synaptic vesicle protein of 38 kDa; syt, synaptotagmins; SYX, t-SNARE syntaxin; t, target; v, vesicle; VAMP-2, v-SNARE vesicle-associated membrane protein 2.

Received August 1, 2006.

Accepted for publication December 27, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kahn SE 2000 The importance of the ß-cell in the pathogenesis of type 2 diabetes mellitus. Am J Med 108(Suppl 6a):2S–8S
  2. Eizirik DL, Korbutt GS, Hellerstrom C 1992 Prolonged exposure of human pancreatic islets to high glucose concentrations in vitro impairs the ß-cell function. J Clin Invest 90:1263–1268[Medline]
  3. Dubois M, Kerr-Conte J, Gmyr V, Bouckenooghe T, Muharram G, D’Herbomez M, Martin-Ponthieu A, Vantyghem MC, Vandewalle B, Pattou F 2004 Non-esterified fatty acids are deleterious for human pancreatic islet function at physiological glucose concentration. Diabetologia 47:463–469[CrossRef][Medline]
  4. Jonas JC, Sharma A, Hasenkamp W, Ilkova H, Patane G, Laybutt R, Bonner-Weir S, Weir GC 1999 Chronic hyperglycemia triggers loss of pancreatic ß cell differentiation in an animal model of diabetes. J Biol Chem 274:14112–14121[Abstract/Free Full Text]
  5. Roche E, Farfari S, Witters LA, Assimacopoulos-Jeannet F, Thumelin S, Brun T, Corkey BE, Saha AK, Prentki M 1998 Long-term exposure of ß-INS cells to high glucose concentrations increases anaplerosis, lipogenesis, and lipogenic gene expression. Diabetes 47:1086–1094[Abstract]
  6. Khaldi MZ, Guiot Y, Gilon P, Henquin JC, Jonas JC 2004 Increased glucose sensitivity of both triggering and amplifying pathways of insulin secretion in rat islets cultured for 1 wk in high glucose. Am J Physiol Endocrinol Metab 287:E207–E217
  7. Maedler K, Spinas GA, Lehmann R, Sergeev P, Weber M, Fontana A, Kaiser N, Donath MY 2001 Glucose induces ß-cell apoptosis via upregulation of the Fas receptor in human islets. Diabetes 50:1683–1690[Abstract/Free Full Text]
  8. Del Guerra S, Lupi R, Marselli L, Masini M, Bugliani M, Sbrana S, Torri S, Pollera M, Boggi U, Mosca F, Del Prato S, Marchetti P 2005 Functional and molecular defects of pancreatic islets in human type 2 diabetes. Diabetes 54:727–735[Abstract/Free Full Text]
  9. Lang J 1999 Molecular mechanisms and regulation of insulin exocytosis as a paradigm of endocrine secretion. Eur J Biochem 259:3–17[Medline]
  10. Rorsman P, Renstrom E 2003 Insulin granule dynamics in pancreatic ß cells. Diabetologia 46:1029–1045[CrossRef][Medline]
  11. Jahn R, Scheller RH 2006 SNAREs—engines for membrane fusion. Nat Rev Mol Cell Biol 7:631–643[CrossRef][Medline]
  12. Kiraly-Borri CE, Morgan A, Burgoyne RD, Weller U, Wollheim CB, Lang J 1996 Soluble N-ethylmaleimide-sensitive-factor attachment protein and N-ethylmaleimide-insensitive factors are required for Ca2+-stimulated exocytosis of insulin. Biochem J 314:199–203
  13. Abderrahmani A, Niederhauser G, Plaisance V, Roehrich ME, Lenain V, Coppola T, Regazzi R, Waeber G 2004 Complexin I regulates glucose-induced secretion in pancreatic ß-cells. J Cell Sci 117:2239–2247[Abstract/Free Full Text]
  14. Coppola T, Frantz C, Perret-Menoud V, Gattesco S, Hirling H, Regazzi R 2002 Pancreatic ß-cell protein granuphilin binds Rab3 and Munc-18 and controls exocytosis. Mol Biol Cell 13:1906–1915[Abstract/Free Full Text]
  15. Iezzi M, Kouri G, Fukuda M, Wollheim CB 2004 Synaptotagmin V and IX isoforms control Ca2+-dependent insulin exocytosis. J Cell Sci 117:3119–3127[Abstract/Free Full Text]
  16. Gut A, Kiraly CE, Fukuda M, Mikoshiba K, Wollheim CB, Lang J 2001 Expression and localisation of synaptotagmin isoforms in endocrine ß-cells: their function in insulin exocytosis. J Cell Sci 114:1709–1716[Abstract]
  17. Chan C, MacPhail R, Sheu L, Wheeler M, Gaisano H 1999 ß-Cell hypertrophy in fa/fa rats is associated with basal glucose hypersensitivity and reduced SNARE protein expression. Diabetes 48:997–1005[Abstract]
  18. Zhang W, Khan A, Ostenson CG, Berggren PO, Efendic S, Meister B 2002 Down-regulated expression of exocytotic proteins in pancreatic islets of diabetic GK rats. Biochem Biophys Res Commun 291:1038–1044[CrossRef][Medline]
  19. Nagamatsu S, Nakamichi Y, Yamamura C, Matsushima S, Watanabe T, Ozawa S, Furukawa H, Ishida H 1999 Decreased expression of t-SNARE, syntaxin 1, and SNAP-25 in pancreatic ß-cells is involved in impaired insulin secretion from diabetic GK rat islets: restoration of decreased t-SNARE proteins improves impaired insulin secretion. Diabetes 48:2367–2373[Abstract]
  20. Ostenson CG, Gaisano H, Sheu L, Tibell A, Bartfai T 2006 Impaired gene and protein expression of exocytotic soluble N-ethylmaleimide attachment protein receptor complex proteins in pancreatic islets of type 2 diabetic patients. Diabetes 55:435–440[Abstract/Free Full Text]
  21. Merglen A, Theander S, Rubi B, Chaffard G, Wollheim CB, Maechler P 2004 Glucose sensitivity and metabolism-secretion coupling studied during two-year continuous culture in INS-1E insulinoma cells. Endocrinology 145:667–678[Abstract/Free Full Text]
  22. Boal F, Zhang H, Tessier C, Scotti P, Lang J 2004 The variable C-terminus of cysteine string proteins modulates exocytosis and protein-protein interactions. Biochemistry 43:16212–16223[CrossRef][Medline]
  23. Monterrat C, Boal F, Grise F, Hemar A, Lang J 2006 Synaptotagmin 8 is expressed both as a calcium-insensitive soluble and membrane protein in neurons, neuroendocrine and endocrine cells. Biochim Biophys Acta Mol Cell Res 1763:73–81[Medline]
  24. Lajus S, Lang J 2006 Splice variant 3, but not 2 of receptor protein-tyrosine phosphatase {varsigma} can mediate stimulation of insulin-secretion by {alpha}-latrotoxin. J Cell Biochem 98:1552–1559[CrossRef][Medline]
  25. Lajus S, Vacher P, Huber D, Dubois M, Benassy MN, Ushkaryov Y, Lang J 2006 {alpha}-Latrotoxin induces exocytosis by inhibition of voltage-dependent K+ channels and by stimulation of L-type Ca2+ channels via latrophilin in ß-cells. J Biol Chem 281:5522–5531[Abstract/Free Full Text]
  26. Lang J, Ushkaryov Y, Grasso A, Wollheim CB 1998 Ca2+-independent insulin exocytosis induced by {alpha}-latrotoxin requires latrophilin, a G protein-coupled receptor. EMBO J 17:648–657[CrossRef][Medline]
  27. Roche E, Assimacopoulos-Jeannet F, Witters LA, Perruchoud B, Yaney G, Corkey B, Asfari M, Prentki M 1997 Induction by glucose of genes coding for glycolytic enzymes in a pancreatic ß-cell line (INS-1). J Biol Chem 272:3091–3098[Abstract/Free Full Text]
  28. Wang H, Kouri G, Wollheim CB 2005 ER stress and SREBP-1 activation are implicated in ß-cell glucolipotoxicity. J Cell Sci 118:3905–3915[Abstract/Free Full Text]
  29. Bjorklund A, Lansner A, Grill VE 2000 Glucose-induced [Ca2+]i abnormalities in human pancreatic islets: important role of overstimulation. Diabetes 49:1840–1848[Abstract]
  30. Grimmsmann T, Rustenbeck I 1998 Direct effects of diazoxide on mitochondria in pancreatic B-cells and on isolated liver mitochondria. Br J Pharmacol 123:781–788[CrossRef][Medline]
  31. Costes S, Longuet C, Broca C, Faruque O, Hani el H, Bataille D, Dalle S 2004 Cooperative effects between protein kinase A and p44/p42 mitogen-activated protein kinase to promote cAMP-responsive element binding protein activation after ß cell stimulation by glucose and its alteration due to glucotoxicity. Ann NY Acad Sci 1030:230–242[CrossRef][Medline]
  32. Landa Jr LR, Harbeck M, Kaihara K, Chepurny O, Kitiphongspattana K, Graf O, Nikolaev VO, Lohse MJ, Holz GG, Roe MW 2005 Interplay of Ca2+ and cAMP signaling in the insulin-secreting MIN6 ß-cell line. J Biol Chem 280:31294–31302[Abstract/Free Full Text]
  33. Poitout V, Hagman D, Stein R, Artner I, Robertson RP, Harmon JS 2006 Regulation of the insulin gene by glucose and fatty acids. J Nutr 136:873–876[Abstract/Free Full Text]
  34. Maestre I, Jordan J, Calvo S, Reig JA, Cena V, Soria B, Prentki M, Roche E 2003 Mitochondrial dysfunction is involved in apoptosis induced by serum withdrawal and fatty acids in the ß-cell line INS-1. Endocrinology 144:335–345[Abstract/Free Full Text]
  35. Molinete M, Lilla V, Jain R, Joyce PB, Gorr SU, Ravazzola M, Halban PA 2000 Trafficking of non-regulated secretory proteins in insulin secreting (INS-1) cells. Diabetologia 43:1157–1164[CrossRef][Medline]
  36. Garcia AL, Han SK, Janssen WG, Khaing ZZ, Ito T, Glucksman MJ, Benson DL, Salton SR 2005 A prohormone convertase cleavage site within a predicted {alpha}-helix mediates sorting of the neuronal and endocrine polypeptide VGF into the regulated secretory pathway. J Biol Chem 280:41595–41608[Abstract/Free Full Text]
  37. Possenti R, Rinaldi AM, Ferri GL, Borboni P, Trani E, Levi A 1999 Expression, processing, and secretion of the neuroendocrine VGF peptides by INS-1 cells. Endocrinology 140:3727–3735[Abstract/Free Full Text]
  38. MacDonald PE, Obermuller S, Vikman J, Galvanovskis J, Rorsman P, Eliasson L 2005 Regulated exocytosis and kiss-and-run of synaptic-like microvesicles in INS-1 and primary rat ß-cells. Diabetes 54:736–743[Abstract/Free Full Text]
  39. Darios F, Davletov B 2006 Omega-3 and omega-6 fatty acids stimulate cell membrane expansion by acting on syntaxin 3. Nature 440:813–817[CrossRef][Medline]
  40. Gaisano HY, Ostenson C-G, Sheu L, Wheeler MB, Efendic S 2002 Abnormal expression of pancreatic islet exocytotic soluble N-ethylmaleimide-sensitive factor attachment protein receptors in Goto-Kakizaki rats is partially restored by phlorizin treatment and accentuated by high glucose treatment. Endocrinology 143:4218–4226[Abstract/Free Full Text]
  41. Bajohrs M, Darios F, Peak-Chew SY, Davletov B 2005 Promiscuous interaction of SNAP-25 with all plasma membrane syntaxins in a neuroendocrine cell. Biochem J 392:283–289[CrossRef][Medline]
  42. Trajkovski M, Mziaut H, Altkruger A, Ouwendijk J, Knoch K-P, Muller S, Solimena M 2004 Nuclear translocation of an ICA512 cytosolic fragment couples granule exocytosis and insulin expression in ß-cells. J Cell Biol 167:1063–1074[Abstract/Free Full Text]
  43. Haass NK, Kartenbeck MA, Leube RE 1996 Pantophysin is a ubiquitously expressed synaptophysin homologue and defines constitutive transport vesicles. J Cell Biol 134:731–746[Abstract/Free Full Text]
  44. Thomas-Reetz A, Hell JW, During MJ, Walch-Solimena C, Jahn R, De Camilli P 1993 A {gamma}-aminobutyric acid transporter driven by a proton pump is present in synaptic-like microvesicles of pancreatic ß cells. Proc Natl Acad Sci USA 90:5317–5321[Abstract/Free Full Text]
  45. Lau T, Carlsson PO, Leung PS 2004 Evidence for a local angiotensin-generating system and dose-dependent inhibition of glucose-stimulated insulin release by angiotensin II in isolated pancreatic islets. Diabetologia 47:240–248[CrossRef][Medline]
  46. Yoshikawa H, Ma Z, Bjorklund A, Grill V 2004 Short-term intermittent exposure to diazoxide improves functional performance of ß-cells in a high-glucose environment. Am J Physiol Endocrinol Metab 287:E1202–E1208
  47. Yang SN, Berggren PO 2006 The role of voltage-gated calcium channels in pancreatic ß-cell physiology and pathophysiology. Endocr Rev 27:621–676[Abstract/Free Full Text]
  48. Kang G, Chepurny OG, Malester B, Rindler MJ, Rehmann H, Bos JL, Schwede F, Coetzee WA, Holz GG 2006 cAMP sensor Epac as a determinant of ATP-sensitive potassium channel activity in human pancreatic ß cells and rat INS-1 cells. J Physiol 573:595–609[Abstract/Free Full Text]
  49. Zhou Y-P, Marlen K, Palma JF, Schweitzer A, Reilly L, Gregoire FM, Xu GG, Blume JE, Johnson JD 2003 Overexpression of repressive cAMP response element modulators in high glucose and fatty acid-treated rat islets: a common mechanism for glucose toxicity and lipotoxicity? J Biol Chem 278:51316–51323[Abstract/Free Full Text]
  50. Olson LK, Qian J, Poitout V 1998 Glucose rapidly and reversibly decreases INS-1 cell insulin gene transcription via decrements in STF-1 and C1 activator transcription factor activity. Mol Endocrinol 12:207–219[Abstract/Free Full Text]
  51. Seufert J, Weir GC, Habener JF 1998 Differential expression of the insulin gene transcriptional repressor CCAAT/enhancer-binding protein ß and transactivator islet duodenum homeobox-1 in rat pancreatic ß-cells during the development of diabetes mellitus. J Clin Invest 101:2528–2539[Medline]
  52. Tadokoro S, Nakanishi M, Hirashima N 2005 Complexin II facilitates exocytotic release in mast cells by enhancing Ca2+ sensitivity of the fusion process. J Cell Sci 118:2239–2246[Abstract/Free Full Text]
  53. Plachot C, Movassat J, Portha B 2001 Impaired beta-cell regeneration after partial pancreatectomy in the adult Goto-Kakizaki rat, a spontaneous model of type II diabetes. Histochem Cell Biol 116:131–139[CrossRef][Medline]
  54. McGirr R, Ejbick CE, Carter DE, Andrews JD, Nie Y, Friedman TC, Dhanvantari S 2005 Glucose dependence of the regulated secretory pathway in {alpha}TC1–6 cells. Endocrinology 146:4514–4523[Abstract/Free Full Text]
  55. Roe MW, Worley 3rd JF, Tokuyama Y, Philipson LH, Sturis J, Tang J, Dukes ID, Bell GI, Polonsky KS 1996 NIDDM is associated with loss of pancreatic ß-cell L-type Ca2+ channel activity. Am J Physiol Endocrinol Metab 270:E133–E140
  56. Iwashima Y, Pugh W, Depaoli AM, Takeda J, Seino S, Bell GI, Polonsky KS 1993 Expression of calcium channel mRNAs in rat pancreatic islets and downregulation after glucose infusion. Diabetes 42:948–955[Abstract]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
L. F. Waanders, K. Chwalek, M. Monetti, C. Kumar, E. Lammert, and M. Mann
Quantitative proteomic analysis of single pancreatic islets
PNAS, November 10, 2009; 106(45): 18902 - 18907.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
B. R. Gauthier and C. B. Wollheim
Synaptotagmins bind calcium to release insulin
Am J Physiol Endocrinol Metab, December 1, 2008; 295(6): E1279 - E1286.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
H.-E. Kim, S.-E Choi, S.-J. Lee, J.-H. Lee, Y.-J. Lee, S. S. Kang, J. Chun, and Y. Kang
Tumour necrosis factor-{alpha}-induced glucose-stimulated insulin secretion inhibition in INS-1 cells is ascribed to a reduction of the glucose-stimulated Ca2+ influx
J. Endocrinol., September 1, 2008; 198(3): 549 - 560.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
V. Poitout and R. P. Robertson
Glucolipotoxicity: Fuel Excess and {beta}-Cell Dysfunction
Endocr. Rev., May 1, 2008; 29(3): 351 - 366.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dubois, M.
Right arrow Articles by Lang, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dubois, M.
Right arrow Articles by Lang, J.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
*GLUCOSE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals