help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-1707
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
148/5/1996    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tirard, J.
Right arrow Articles by Naville, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tirard, J.
Right arrow Articles by Naville, D.
Endocrinology Vol. 148, No. 5 1996-2005
Copyright © 2007 by The Endocrine Society

A Novel Inhibitory Protein in Adipose Tissue, the Aldo-Keto Reductase AKR1B7: Its Role in Adipogenesis

Julien Tirard, Johann Gout, Anne Marie Lefrançois-Martinez, Antoine Martinez, Martine Begeot and Danielle Naville

Institut National de la Santé et de la Recherche Médicale, Unité 449; Institut National de la Recherche Agronomique, Unité Mixte de Recherche 1235; and Université Claude Bernard (J.T., J.G., M.B., D.N.), F-69000 Lyon, France; and Centre National de la Recherche Scientifique, Unité Mixte de Recherche 6547 (A.M.L.-M., A.M.), F-63170 Aubière, France

Address all correspondence and requests for reprints to: Danielle Naville, Institut National de la Santé et de la Recherche Médicale Unité 449-Institut National de la Recherche Agronomique Unité Mixte de Recherche 1235, Faculté de Médecine Laennec, 8, rue Guillaume Paradin, 69372 Lyon Cedex 08, France. E-mail: naville{at}lyon.inserm.fr.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The aldo-keto reductase 1B7 (AKR1B7) encodes an aldose-reductase that has been reported as a detoxification enzyme until now. We have demonstrated that AKR1B7 is differently expressed in various mouse white adipose tissues depending on their location. Its expression is associated with a higher ratio of preadipocytes vs. adipocytes. The cells that express AKR1B7 did not contain lipid droplets, and the expression level of akr1b7 was very low in mature adipocytes. We have defined the role of AKR1B7 in adipogenesis using either primary cultures of adipose stromal cells (containing adipocyte precursors) or the 3T3-L1 cell line. Under the same differentiation conditions, adipose stromal cells from tissues that expressed AKR1B7 had a decreased capacity to accumulate lipids compared with those that did not express it. Moreover, the overexpression of sense or antisense AKR1B7 in 3T3-L1 preadipocytes inhibited or accelerated, respectively, their rate of differentiation into adipocytes. In vivo experiments demonstrated that AKR1B7-encoding mRNA expression decreased in adipose tissues from mice where obesity was induced by a high-fat diet. All these results attributed for the first time a novel role to AKR1B7, which is the inhibition of adipogenesis in some adipose tissues.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ALDO-KETO REDUCTASES (AKRs) are monomeric oxidoreductases that catalyze the reduced nicotinamide adenine dinucleotide phosphate-dependent conversion of aldehydes and ketones to their corresponding alcohols (1). Among the AKR superfamily, AKR1B1 has been in focus because of its potential role in the development of secondary diabetic complications in humans (2).

Akr1b7 encodes an aldose-reductase (molecular mass, 34.5 kDa) (3) that has been described to be involved in detoxification processes until now. In the mouse, it is the major enzyme responsible for the reduction of isocaproaldehyde derived from the side-chain cleavage of cholesterol by P450 side-chain cleavage enzyme (P450scc) that is the first step of steroidogenesis (4).

We have also shown that AKR1B7 is able to detoxify the cytotoxic {alpha}-, ß-unsaturated acyl aldehyde 4-hydroxynonenal (4-HNE) (4). This product is a natural compound resulting from the lipid peroxidation and cleavage that occur in response to oxidative stress and aging (5).

AKR1B7 was initially described as a secretory mouse vas deferens protein (MVDP) (3) and is also highly expressed in the adrenal cortex in rodents (6). Consistent with the enzy-matic activity of AKR1B7, a significant expression has also been detected in rodent testis, ovaries, and intestine, whereas low levels are expressed in kidney, lung, and liver (6, 7).

We have recently shown the presence of AKR1B7-encoding mRNA in the mouse white adipose tissue as well as a decrease of its expression in the whole epididymal fat during obesity induced by a high-fat diet (8).

The white adipose tissue is the main site of energy storage of the body. The adipocytes store large amounts of triglycerides during periods of energy excess and deliver fatty acids to other tissues when required. The white adipose tissue is disseminated in different locations, and these different adipose tissues display different metabolic properties and functions (9). In addition to adipocytes, the adipose tissue contains stromal-vascular cells including fibroblastic cells, connective tissue cells, leukocytes, macrophages, and preadipocytes (adipocyte precursors), which contribute to its physiological integrity (10).

During adipocyte differentiation, the acquisition of the adipocyte phenotype is characterized by chronological changes in the expression of numerous genes. This is reflected by the appearance of early, such as the transcription factor CCAAT/enhancer binding protein-{delta} (C/EBP{delta}); intermediate, such as the type 2 melanocortin receptor (MC2-R); and late markers that follows the triglyceride accumulation (11, 12).

These changes take place primarily at the transcriptional level although a posttranscriptional regulation can occur for some genes expressed in adipocytes. In addition to the gene activation, genes that have an inhibitory effect on adipogenesis or genes unnecessary for adipose cell function are repressed (11). This is the case for the transcription factor GATA-3 (13).

The white adipose tissue expansion during adulthood results from an increase of both the size and the number of the adipocytes (11). Obesity is a disorder that results from an enlargement of the white adipose tissue mass, and this is a major risk factor for type 2 diabetes and cardiovascular diseases (14). Therefore, understanding the cellular and molecular basis of the adipose tissue growth is an important research goal.

In this study, we reported that only some mouse white adipose tissues expressed AKR1B7 depending on their location. In addition, by in vitro studies, we demonstrated for the first time that AKR1B7 could inhibit the adipocyte differentiation process by limiting the lipid accumulation. Moreover, we showed that its expression is reduced in obese mouse adipose tissues that normally express high levels of AKR1B7-encoding mRNA in control mice.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Penicillin, streptomycin, glutamine, fetal bovine serum (FBS), bovine serum, and culture media were purchased from Invitrogen (Cergy-Pontoise, France) and ascorbic acid, T3, insulin, isobutylmethylxanthine, and dexamethasone from Sigma-Aldrich (Saint-Quentin Fallavier, France). Oligonucleotides were prepared by Sigma-Genosys (Cambridge, UK).

Animals
Four-week-old male C57BL/6J mice were purchased from Harlan (Le Malcourlet, France) and housed two animals per cage with free access to water and chow. Room temperature was maintained at 24 C, and lights were on for 12 h/d. After 1 wk acclimatization, mice were divided into two groups: one with free access to control chow and another group with free access to a commercial high-fat diet from Harlan. Control chow (3.1% fat and 3.3 kcal/g) and high-fat chow (36.1% fat and 5.4 kcal/g) have been previously described (8). After 8 wk, all mice were killed by cervical dislocation. Adipose tissues from various locations, femoral sc fat, fat surrounding the adrenal gland, and two different regions of the epididymal fat (proximal and distal), were removed and immediately processed or frozen in liquid N2 and stored at –80 C until use. All procedures were performed in accordance with the principles and guidelines established by the French Department of Agriculture for the care and use of laboratory animals.

Adipose tissue fractionation
Freshly excised fat pads were rinsed in PBS, minced, and digested for 30 min at 37 C in Krebs-Ringer bicarbonate (pH 7.4) containing 4% BSA and 0.5 g/liter collagenase (Sigma-Aldrich). The digested tissues were filtered through a 250-µm nylon mesh to remove undigested tissue and centrifuged at 750 x g for 5 min.

The floating adipocyte fraction was saved and processed or frozen in liquid N2 and stored at –80 C. The stromal-vascular pellet was resuspended in a lysis buffer (154 mM NH4Cl, 10 mM KHCO3, and 1 mM EDTA), incubated 10 min at room temperature, and pelleted at 750 x g for 5 min. Cells were processed or frozen in liquid N2 and stored at –80 C until use.

Adipose stromal cell (ASC) culture and differentiation
The stromal-vascular pellet was resuspended in DMEM/F12 medium containing 100 U/ml penicillin, 0.1 g/liter streptomycin (antibiotics), and 100 U/ml glutamine (Gln). The number of isolated cells was counted and their viability assessed by trypan blue exclusion.

Preadipocytes were incubated in the growth medium (DMEM/F12 medium supplemented with 10% FBS, 100 µM ascorbic acid, 100 nM insulin, 200 pM T3, Gln, and antibiotics) at 37 C in a humidified atmosphere of 5% CO2. After 24 h, the medium was changed. When cells reached confluency, the medium was removed and replaced by the differentiation medium (DMEM/F12 medium supplemented with 10% FBS, 250 µM isobutylmethylxanthine, 100 µM ascorbic acid, 100 nM insulin, 2 µM dexamethasone, 200 pM T3, Gln, and antibiotics).

Culture and differentiation of 3T3-L1 cells
The 3T3-L1 preadipocytes were cultured and induced to differentiate as previously described (15). Briefly, cells were maintained in DMEM containing 10% bovine serum, Gln, and antibiotics at 37 C in a humidified atmosphere of 5% CO2. Differentiation was induced in confluent 3T3-L1 cells by incubating them in DMEM supplemented with 10% FBS, 500 µM isobutylmethylxanthine, 70 nM insulin, 500 nM dexamethasone, Gln, and antibiotics. After 3 d, the medium was replaced by DMEM containing 10% FBS, 70 nM insulin, 500 nM dexamethasone, Gln, and antibiotics. On d 5, the medium was replaced by DMEM containing only 10% FBS, Gln, and antibiotics.

Transfection and selection of 3T3-L1 cells stably expressing sense or antisense AKR1B7 mRNA
The full-length coding sequence of akr1b7 (4) was cloned into the mammalian expression vector pcDNA3 (Invitrogen). To generate cell lines stably expressing akr1b7, 3T3-L1 cells were transfected with the akr1b7 expression vector using Lipofectamine Plus Reagent (Invitrogen) according to the manufacturer’s protocol. Transfected cells were selected for 2 wk in medium containing 400 mg/liter geneticin (G418; Sigma-Aldrich). The cells were screened for AKR1B7 expression by Western blot, and stably expressing transfectants (MV clones) were further grown in culture medium supplemented with 200 mg/liter geneticin. The 3T3-L1 cells transfected with the empty vector (pcDNA3) were selected in the same way to give empty vector (EV) clones.

To generate cell lines expressing an antisense AKR1B7 mRNA, the complete AKR1B7 cDNA was inserted in inverted orientation in the pEGFP-N2 vector (Clontech, Ozyme, Montigny-le-Bretonneux, France). The 3T3-L1 cells were transfected with this pEGFP-N2-AS vector using Lipofectamine Plus Reagent (Invitrogen). G418-resistant cells were selected to give antisense clones. Clones expressing a decreased AKR1B7 protein were used for additional studies.

Lipid staining
The lipid accumulation in primary cultures or differentiated 3T3-L1 was visualized by staining with Oil Red O. Briefly, differentiated adipocytes were fixed in 2% formaldehyde and stained for 15 min in a 0.4% Oil Red O (Sigma-Aldrich) solution in isopropanol. In some experiments, 3T3-L1 cells were cultured and induced to differentiate in a LabTek chamber slide. The lipid accumulation in adipocytes was visualized using Sudan III, and nuclei were colored by using conventional hematoxylin staining.

RNA and protein preparation
Total RNA was isolated from mouse tissues or cells by using Trizol (Invitrogen) according to the manufacturer’s protocol.

To prepare proteins, cells were rapidly lysed in a mixture containing HEPES (20 mM), dithiothreitol (0.5 mM), EDTA (0.2 mM), NaCl (420 mM), MgCl2 (1.5 mM), glycerol (25%), IGEPAL CA-630 (0.2%), and protease inhibitors. After 10 min at room temperature, the samples were centrifuged at 10,000 x g for 5 min. The clear supernatant was frozen at –20 C.

RT-PCR
One microgram of total RNA was treated with DNase I (Invitrogen). The RT reaction was carried out with the Moloney murine leukemia virus reverse transcriptase (Invitrogen) and the PCR by using Eurobiotaq polymerase (Eurobio, Courtaboeuf, France). The following primer pairs and programs were used: AKR1B7 (annealing temperature, 52 C; 35 cycles), CCCTCTCGGATCTGAAGCTG (sense) and GGGAATCTCCATTACTACG (antisense); GAPDH (57 C; 26 cycles), ATGGGTGTGAACCACGAAATA (sense) and TGTCATACCAGGAAATGAGCTTG (antisense); GATA-3 (61 C; 32 cycles), CTACCGGGTTCGGATGTAA (sense) and AGGGAGAGATGTGGCTCAGG (antisense); and Cox 2 (50 C; 35 cycles), GACAGTCCACCTACTTACAA (sense) and CTATGAGTATGAGTCTGCTG (antisense).

Real-time RT-PCR
One microgram of RNA served as a template for the SuperScriptII reverse transcriptase (Invitrogen) in the presence of random hexamer and oligo(dT) primers (Promega, Charbonnieres-les-Bains, France). All samples were treated by DNase I before the RT. PCR were performed using the Light Cycler Fast Start DNA Master SyBR Green I kit (Roche, Meylan, France). The following primer pairs were used: AKR1B7 (annealing temperature, 55 C), CAGATTGAGAGCCACCCTTA (sense) and TGGGAATCTCCATTACTACG (antisense); cyclophilin (55 C), CTGCACTGCCAAGACTGAATG (sense); TTGCCATTCCTGGACCCAAA (antisense); aP2 (59 C), CAGAAGTGGGATGGAAAGTCG (sense) and CGACTGACTATTGTAGTGTTTGA (antisense); CEPB{delta} (55 C), ATCGCTCGAGCTTCCTATGT (sense) and AGTCATGCTTTCCCGTGTTC (antisense); and MC2-R (53 C), ATCTGCAGTTTGGCCATTTC (sense) and GCAATGACAGACAGGCTGAA (antisense).

Western blot analysis
Protein extracts (20–80 µg) were separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Immobilon-P transfer membrane; pore size, 0.45 µm; Millipore, Saint-Quentin-en-Yvelines, France). After saturation (1 h in PBS containing 0.1% Tween 20 and 10% milk), membranes were incubated overnight at 4 C in the presence of a primary rabbit polyclonal antibody raised against the mouse AKR1B7 (1:3000) that had been prepared as previously reported (16), a rabbit polyclonal anti-P450scc (1:2000) (17), a rabbit polyclonal anti-StAR (1:5000) (kind gift of D. M. Stocco, Texas Tech University), a rabbit polyclonal anti-COX-2 (1:2000) (Cayman, Ann Arbor, MI), or a rabbit polyclonal anti-ß-actin (1:2000) (Sigma) and followed by incubation (1 h) with peroxidase-conjugated antirabbit IgG (EnVision+; Dako, Trappes, France) at 1:25. The peroxidase activity was detected using the ECL plus Western blotting detection System (Amersham Biosciences, Orsay, France).

Immunohistochemistry
Epididymal fat mass was rinsed and fixed by immersion in Bouin’s fixative for 24 h at room temperature and embedded in paraffin. Slides (20 µm) were incubated in 3% H2O2 for 5 min to block endogenous peroxidase activity, rinsed with PBS, and then incubated in the presence of the rabbit antimouse AKR1B7 antibody (1:100) (18) in the blocking buffer (PBS, 2% BSA) for 3 h at 4 C and revealed with the LSAB2 kit (Dako) using avidin-biotin-peroxidase complex as a staining reaction and azo-3-ethyl-9-carbazole as a chromogen.

Statistical analysis
Statistical analysis was performed using one-way ANOVA analysis, followed by post hoc testing with Fisher’s protected least squares difference. Differences were considered significant at P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Presence of AKR1B7 in the proximal epididymal adipose tissue
By microarray studies, we had previously demonstrated (8) that mouse epididymal fat depots express AKR1B7-encoding mRNAs. By Western blot analysis, using crude protein extracts prepared from the whole epididymal adipose tissue, we observed immunoreactive species of similar molecular size (34.5 kDa) as those obtained using mouse adrenal gland protein extracts (Fig. 1Go). However, the level of expression was much lower in epididymal adipose tissue than in adrenal gland.


Figure 1
View larger version (53K):
[in this window]
[in a new window]

 
FIG. 1. Western blot analysis of AKR1B7 in mouse epididymal adipose tissue. Lane 1, Adrenal gland (20 µg); lane 2, molecular weight markers; lanes 3–7, epididymal fat proteins (60 µg/lane) from 10-wk-old mice (each lane corresponds to a different mouse).

 
We then studied the expression profile of akr1b7 in different adipose tissues. In fact, as illustrated in Fig. 2AGo, the epididymal adipose tissue was separated in two parts of approximately equal size: one in direct contact with the testis corresponding to the proximal epididymal adipose tissue and the second part, which extended over the abdominal cavity, corresponding to the distal epididymal adipose tissue. By real-time RT-PCR, strong differences in the expression levels of AKR1B7-encoding mRNA were observed between these different adipose tissues (Fig. 2BGo). We observed that the level of AKR1B7-encoding mRNA is 2-fold higher in adrenal fat than in proximal epididymal fat and 100-fold higher than in sc fat. Moreover, this level is 10 times higher in proximal epididymal fat than in distal epididymal fat. Values in distal epididymal and sc fats were near the limit of detection of the method. A similar pattern was obtained for the protein level of AKR1B7 by using Western blot analysis (Fig. 2CGo).


Figure 2
View larger version (28K):
[in this window]
[in a new window]

 
FIG. 2. A, Picture of the epididymal fat. The testis (a) and the epididymis (b) are surrounded by a dotted line. Testis, epididymis, and the vas deferens were removed, and epididymal fat mass was cut in two parts: distal epididymal adipose tissue (c) and proximal epididymal adipose tissue (d). B, mRNA expression level of akr1b7 in different adipose tissues (by real-time RT-PCR). Ratios are between mRNA expression levels of akr1b7 vs. cyclophilin for adrenal fat (Ad.), proximal epididymal fat (Prox.Ep), distal epididymal fat (Dist.Ep), and sc fat. Total ARNs were extracted from five 10-wk-old males. C, Western blot analysis of AKR1B7. Lane 1, Adrenal (20 µg); lane 2, proximal epididymal fat (50 µg); lane 3, proximal epididymal fat (80 µg); lane 4, adrenal fat (50 µg); lane 5, distal epididymal fat (80 µg); lane 6, sc fat (80 µg). Proteins were extracted from a group of 10 10-wk-old males and pooled.

 
Akr1b7 is mainly expressed in the proximal epididymal ASC fraction
We have compared the expression of two genes that are characteristic of the preadipocytes, gata-3 and cox 2, in the different fat depots. GATA-3 is a transcription factor specifically expressed in the adipocyte precursors (preadipocytes) of which down-regulation corresponds to the stage of preadipocyte-adipocyte transition (13). Cyclooxygenase 2 (COX2) is the inducible form of the cyclooxygenase and catalyzes the rate-limiting step of the prostanoid biosynthesis. It is also expressed in adipocyte precursors, and its expression is down-regulated during differentiation (19). As shown in Fig. 3AGo, the preadipocyte markers gata-3 and cox 2 were highly expressed in the same adipose tissues as akr1b7, whereas GAPDH mRNA was expressed at the same levels in the different fat depots.


Figure 3
View larger version (41K):
[in this window]
[in a new window]

 
FIG. 3. mRNA expression of akr1b7, cox 2, gata-3, and gapdh in different adipose tissues (A) or adipocytes and ASC prepared from proximal or distal epididymal fat (B) by RT-PCR. A, Lane a, adrenal fat; lane b, proximal epididymal fat; lane c, distal epididymal fat; lane d, sc fat. The picture was representative of three different experiments. B, Lane 1, distal epididymal adipocytes; lane 2, proximal epididymal adipocytes; lane 3, distal epididymal ASC fraction; lane 4, proximal epididymal ASC fraction. The picture was representative of three different preparations.

 
We then separated adipocyte and ASC fractions from proximal epididymal and distal epididymal fats and studied the expression of the genes encoding AKR1B7, GATA-3, and COX2. Figure 3BGo showed, as expected, that gata-3 and cox 2 were strongly expressed in the ASC fraction containing preadipocytes and at very low levels in the adipocyte fraction. The levels of expression were similar in the ASC fractions prepared from both proximal epididymal and distal epididymal tissue. On the contrary, akr1b7 was detected only in proximal epididymal tissue, but the ASC fraction gave a higher signal than the adipocyte fraction, indicating that, when specifically expressed in this tissue, AKR1B7 encoding mRNAs were mainly present in cells also expressing high levels of preadipocyte markers.

The expression level of akr1b7 was much higher in proximal epididymal and adrenal fat masses compared with distal epididymal and sc adipose tissues, and as previously shown in Fig. 3AGo, no difference in the gata-3 and cox 2 expression levels was observed in the ASC fractions prepared from proximal epididymal or from distal epididymal tissue. These results could suggest that the ratio between preadipocytes and adipocytes is higher in adrenal and proximal epididymal adipose tissues, where akr1b7 is mainly expressed, than in the other adipose tissues that express akr1b7 very weakly.

The steroidogenesis markers P450scc and steroidogenic acute regulatory protein (StAR) are not expressed in the ASC fraction
Because the expression of akr1b7 was described in all steroid-producing tissues, we checked for the expression of two steroidogenic markers, P450scc and StAR, in ASC by Western blot analysis. As expected, P450scc and StAR were abundantly expressed, as was AKR1B7, in adrenal gland (Fig. 4Go). The preadipocyte marker COX2 was present in both ASC fractions, in contrast to P450scc and StAR, which were undetectable even in the AKR1B7-expressing proximal epididymal fat ASC fraction. Thus, we can conclude that cells from ASC fractions expressing AKR1B7 are not steroidogenic cells.


Figure 4
View larger version (52K):
[in this window]
[in a new window]

 
FIG. 4. Expression of the steroidogenic markers P450scc and StAR in ASC fractions. Western blot analysis of ASC fractions from proximal (Prox.Ep) and distal (Dist.Ep) part of epididymal adipose tissue were conducted using anti-AKR1B7, anti-P450scc, anti-StAR, and anti-COX2 antibodies. Protein extracts from three different preparations of ASC fractions were loaded (50 µg). Adrenal protein extracts were used as controls (20 µg).

 
Immunohistochemical detection of AKR1B7 in the epididymal adipose tissue
Immunohistochemical staining using antibodies directed against AKR1B7 was performed to localize the protein in sagittal sections of epididymal fat mass. In proximal epididymal fat, as shown in Fig. 5Go, A and C, we observed a positive staining in some cells that do not contain any lipid vacuoles and that are surrounded by large adipocytes that represent the majority of the cells. These cells measured between 20 and 30 µm. No staining was observed on sagittal sections of distal epididymal fat (Fig. 5BGo).


Figure 5
View larger version (113K):
[in this window]
[in a new window]

 
FIG. 5. Fat mass immunohistochemistry. Arrows labeled 1 point to adipocytes; arrows labeled 2 point to positive cells after using a polyclonal antibody directed against AKR1B7 and after detection with azo-ethyl-carbazol. A, Proximal epididymal fat (scale bar, 90 µm; magnification, x100); B, distal epididymal fat (scale bar, 90 µm; magnification, x100); C, proximal epididymal fat (scale bar, 45 µm; magnification, x400).

 
Differentiation of ASC into adipocytes
To address the question of the role of AKR1B7 in the epididymal adipose tissue, ASC fractions (proximal epididymal and distal epididymal) were plated onto tissue culture dishes. No difference in the time to reach confluence (corresponding to d 0 of adipocyte differentiation) was observed between both preparations, and the cells exhibited the same morphological characteristics with no apparent lipid droplets (data not shown).

Distal epididymal cells, however, exhibited morphological changes between d 3 and 6 of differentiation after confluence. They developed a rounded shape and accumulated numerous lipid droplets in their cytoplasm on d 6 (Fig. 6AGo). On the contrary, a more limited number of intracytoplasmic vacuoles were observed in proximal epididymal cells (Fig. 6BGo). These results suggest that the lipid accumulation in proximal epididymal ASC was considerably delayed and/or limited.


Figure 6
View larger version (35K):
[in this window]
[in a new window]

 
FIG. 6. Lipid accumulation during adipocyte differentiation of the ASC fraction were visualized (by microscopy and Oil Red O staining) at d 6 of differentiation. A, Distal epididymal cells; B, proximal epididymal cells (scale bars, 300 µm; magnification, x150); C, ratio between mRNA expression level of ap2 vs. cyclophilin by real-time RT-PCR at d 0, 3, and 6 of differentiation (black bars, distal epididymal ASC fractions; white bars, proximal epididymal ASC fractions; n = 4; P < 0.05 compared with distal epididymal ASC fractions at d 0); D, Western blot analysis of ASC fractions from either proximal (Prox. Ep) or distal (Dist. Ep) part of epididymal adipose tissue at confluence (d 0) and after 6 d of differentiation. Proteins were extracted on d 0 from three different preparations of ASC fractions (50 µg) and on d 6 from two or three different preparations of ASC fractions (60 µg). Adrenal protein extracts were used as controls (20 µg). Western blot analyses were conducted using anti-AKR1B7 and anti-ß-actin antibodies.

 
To reinforce this hypothesis, we studied by real-time RT-PCR the expression of ap2 gene encoding a fatty acid-binding protein that is well known as a marker of adipocyte maturation (20, 21) on both types of ASC fractions on d 0, 3, and 6 of differentiation. Figure 6CGo showed that the expression level of aP2-encoding mRNA significantly increased during differentiation of the distal epididymal ASC. Interestingly, aP2-encoding mRNA was less expressed in proximal epididymal ASC than in distal epididymal ASC (5-fold lower in proximal epididymal than in distal epididymal on d 0 and 10-fold lower in proximal epididymal than in distal epididymal on d 6), and its expression level did not increase from d 0 to d 6. Day 0 corresponded to the confluence state obtained 1 wk after ASC plating, which could explain the presence of aP2 mRNA, in particular, at this stage (Fig. 6CGo). Protein level of AKR1B7 was higher in proximal epididymal ASC than in distal epididymal ASC on d 0 (Fig. 6DGo). After 6 d of differentiation the level of mRNA encoding AKR1B7 was not significantly different from on d 0, but the level of protein became undetectable as also observed in distal epididymal ASC (Fig. 6DGo)

Differentiation of 3T3-L1 cells stably expressing AKR1B7
The 3T3-L1 cell line is known to have the capacity to convert to mature adipose cells at confluence. To better define the role of AKR1B7 on the differentiating process, confluent 3T3-L1 cells stably transfected with an EV or an akr1b7 expression vector (MV), and parental 3T3-L1 cells were induced to differentiate into adipocytes. By Western blot analysis, we observed that the AKR1B7 protein is clearly overexpressed in MV cells compared with 3T3-L1 cells (Fig. 7AGo).


Figure 7
View larger version (40K):
[in this window]
[in a new window]

 
FIG. 7. Differentiation of 3T3-L1 cells stably expressing AKR1B7. A, Western blot analysis of AKR1B7 in 3T3-L1 cells (50 µg) and MV1 cells (50 µg); B, the extent of lipid accumulation was determined by Oil Red O staining on d 10 of differentiation (1, 3T3-L1 cells; 2, MV cells; scale bars, 600 µm; magnification, x60); C, the extent of lipid accumulation was determined by Soudan III staining on d 10 of differentiation. Nuclei were stained blue by hematoxylin (1, 3T3-L1 cells; 2, MV cells; scale bars, 50 µm; magnification, x200); D–F, ratio between mRNA expression level of C/EBP{delta} (D), MC2-R (E), and aP2 (F) vs. cyclophilin on d 0, 3, and 6 of differentiation (black bars, 3T3-L1 cells; white bars, MV cells; n = 5).

 
Cell differentiation into adipocytes was assessed by visualizing the lipid accumulation and by measuring the expression genes encoding adipocyte differentiation markers. After 10 d of differentiation, the parental 3T3-L1 cells accumulated the same amount of lipid droplets in the cytoplasm as the EV clones (data not shown), whereas akr1b7 overexpressing MV cells accumulated much fewer lipid droplets, as judged by the weak lipid staining (Fig. 7Go, B and C). On d 10 of differentiation, 3T3-L1 exhibited a spherical shape with many lipid droplets in contrast to MV cells, which accumulated lipid droplets to a lesser extend (Fig. 7CGo).

The mRNA expression level of the early adipocyte differentiation-stage marker C/EBP{delta} was not significantly different between parental 3T3-L1 and MV cells (Fig. 7DGo). However, in accordance with our results on lipid accumulation, mRNA expression level of MC2-R, which is an intermediate and late adipogenesis marker (12) increased during the differentiation of parental 3T3-L1 cells but not MV cells (d 3 compared with d 6) (Fig. 7EGo). This level remained significantly lower in MV cells compared with parental 3T3-L1 cells (on d 3 and 6). In addition, the expression of the mRNA encoding aP2 was lower in MV cells than in parental 3T3-L1 cells, whatever the day of differentiation (Fig. 7FGo), and a significant difference was observed on d 6 of differentiation. These results suggest that when stably expressed in 3T3-L1 cells, AKR1B7 inhibited the transition from early to intermediate stage of adipocyte differentiation and prevented the lipid accumulation.

Differentiation of 3T3-L1 cells stably expressing antisense AKR1B7
The level of AKR1B7 mRNA was almost undetectable in antisense cells (expressing an antisense AKR1B7) compared with parental 3T3-L1 cells (Fig. 8AGo). Cell differentiation into adipocytes was assessed by visualizing the lipid accumulation and by measuring the level of aP2-encoding mRNA. After 6 d of differentiation, the parental 3T3-L1 cells accumulated a lesser amount of lipid droplets in the cytoplasm than antisense clones, as judged by the weaker lipid staining by Oil Red O (Fig. 8BGo). In addition, the expression of the mRNA encoding aP2 was higher in antisense cells than in parental 3T3-L1 cells (Fig. 8CGo); the differences were statistically significant on d 3 and 6 of differentiation. These results suggest that in the absence of AKR1B7, the adipocyte differentiation and lipid accumulation were higher in 3T3-L1 cells than in antisense clones.


Figure 8
View larger version (64K):
[in this window]
[in a new window]

 
FIG. 8. A, Western blot analysis of AKR1B7 in 3T3-L1 cells (50 µg) and AS cells (50 µg); B, the extent of lipid accumulation was determined by Oil Red O staining on d 6 of differentiation (1, 3T3-L1 cells; 2, AS cells; scale bars, 600 µm; magnification, x60); C, aP2-encoding mRNA expression during adipocyte differentiation by real-time RT-PCR: aP2 mRNA vs. cyclophilin on d 0, 3, and 6 of differentiation (black bars, 3T3-L1 cells; white bars, AS cells; n = 3).

 
Akr1b7 expression decreases in adipose tissues of diet-induced obesity (DIO) mice
We had previously shown that a high-fat diet promoted a significant increase in animal body weight over an 8-wk period (8). The DIO mice exhibited the biological features of obesity associated with hyperinsulinemia and mild hyperglycemia (8). By real-time RT-PCR, similar profiles in the expression levels of AKR1B7-encoding mRNA were observed between control and DIO animals because AKR1B7-encoding mRNAs were more abundantly expressed in adrenal fat than in proximal epididymal and very slightly in distal epididymal and sc fat (Fig. 9Go). Interestingly, AKR1B7-encoding mRNA expression is strongly decreased in all adipose tissues from DIO mice compared with the same tissues from control mice. We observed that the level of AKR1B7-encoding mRNAs is 2.5-fold lower in adrenal fat from DIO than from control mice and 10-fold lower in proximal epididymal fat from DIO than from control mice. In DIO mice, the levels of AKR1B7-encoding mRNA became not different between proximal epididymal and distal epididymal fats.


Figure 9
View larger version (9K):
[in this window]
[in a new window]

 
FIG. 9. mRNA expression level of akr1b7 in the different control and DIO mouse adipose tissues, by real-time RT-PCR. Ratios are between mRNA expression levels of akr1b7 vs. cyclophilin for adrenal fat (Ad.), proximal epididymal fat (Prox.Ep), distal epididymal fat (Dist.Ep), and sc fat of control (black bars) and DIO (white bars) mice (n = 5 for control; n = 4 for DIO).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
AKR1B7 is an aldose-reductase able to catalyze the reduction of aldehyde and ketone functions in alcohol. At present, two substrates of AKR1B7 are known: the isocaproaldehyde (a steroidogenesis metabolite) and the 4-HNE (a product of lipid peroxidation).

Adipose tissue has not been described to be able to perform the side-chain cleavage of cholesterol, and we showed herein that P450scc is absent in adipose tissue. It is then unlikely that the role of AKR1B7 in this particular tissue will be to catalyze the reduction of isocaproaldehyde. The 4-HNE has been suggested to contribute to oxidative stress-mediated cell injury and to be involved in apoptotic death (22). The detoxification of 4-HNE is necessary, but glutathione-S-transferase-{alpha}4 is present in all fat depots (data not shown), in contrast to AKR1B7, and plays this role in the adipose tissue (23). We have demonstrated an expression of akr1b7 in the mouse abdominal adipose tissue (8) but despite high homologies (24), no other AKR1B family members have yet been described in adipose tissues. Most of the studies performed to determine the role of AKR1B7 have focused on the characterization of this enzyme in adrenals (4), and no studies have been performed on its role in adipose tissue.

Previous studies have shown that white adipose tissues located at different sites display some disparities in their metabolic properties (9), mRNA expression (25), and protein secretion (26). Moreover, according to the fat depot origin, the preadipocyte number (27) and the rate of adipogenesis (28) are different. These variations are observed mostly when the intraabdominal fat (omental in men and epididymal in rodent) is compared with the sc fat. In our study, we have shown that some differences could also exist within the same fat mass. The epididymal adipose tissue could be divided into two different tissues depending on their akr1b7 expression levels; proximal epididymal and adrenal adipose tissues, which both express akr1b7, are in direct contact with two endocrine glands (testis and adrenal gland, respectively). On the contrary, tissues such as sc and distal epididymal adipose tissues, which are located at a more distal position, do not express akr1b7. Interestingly, AKR1B7 undergoes multiple tissue-specific hormonal regulations. Initially described as an androgen-dependent marker specific to the mouse vas deferens, it has now been shown to be expressed in adrenal glands, testis, ovaries, and intestine under the control of ACTH, androgen, LH, and oxysterol, respectively (4, 7, 16, 29, 30, 31, 32). In this context, the question of a specific role of AKR1B7 in expressing adipose tissues was addressed. Our data showed that besides akr1b7, two preadipocyte markers, gata-3 and cox 2, were more highly expressed in proximal epididymal and adrenal adipose tissues than in distal epididymal. Because both markers were equally expressed in ASC fractions from proximal epididymal and distal epididymal tissues, we conclude that proximal epididymal tissue contained a greater proportion of preadipocytes than distal epididymal tissue. However, we cannot exclude a heterogeneity inside both ASC fractions. In fact, the ASC fraction contains not only preadipocytes but also other cell types such as immune cells, macrophages, and leukocytes representing around 30 and 10%, respectively, of an ASC fraction (10, 33). Moreover, gata-3 and cox 2 expression has been documented in various immunity cells (34, 35). However, despite this heterogeneity, ASC cultures are classically used to investigate the preadipocyte differentiation into mature adipocytes. Our results showed that during the course of differentiation, the lipid accumulation was much higher in ASC cultures from distal epididymal tissue than in ASC cultures from proximal epididymal tissue. These proximal epididymal adipose cells exhibited a limited number of lipid droplets even in the latest days of differentiation studied, although the size of these lipid droplets was very similar in both cell preparations. This reflects that ASC cultures from proximal epididymal tissue contain fewer mature adipocytes than those from distal epididymal tissue after 6 d of differentiation. In parallel, aP2, a well-known marker of adipocyte maturation, was consequently less expressed in proximal epididymal than in the distal epididymal cell preparation and increased only in cells from distal epididymal, indicating clear differences in the differentiation capabilities between the two cell fractions. The presence of aP2-encoding mRNA on d 0 in distal epididymal cultured cells was because d 0 corresponded to the confluence step that is reached 1 wk after the beginning of the culture. This would indicate that at this stage, a fraction of the cells is already engaged in the differentiation process, although the level of COX2 (a preadipocyte marker) remained elevated and only a limited number of lipid droplets was present. The maturation process was considerably slowed down in proximal epididymal ASC cultures despite the fact that the culture conditions were strictly identical for both ASC fractions and that cells are growing at the same speed and did not exhibit any morphological differences except for the lipid storage. It is clear that both precursor ASC cell pools contained heterogeneous cell populations, but Rodriguez et al. (36) have reported that the fast-adherent ASC correspond to a preadipocyte-enriched fraction. From these results obtained with ASC cells, our hypothesis was that the high expression of akr1b7 would slow down adipogenesis and inhibit lipid storage in adipose cells. The fact that the protein AKR1B7 decreased during the course of differentiation is in good agreement with this hypothesis. To test it, we have developed 3T3-L1 cell lines stably overexpressing akr1b7 (MV clones). Under differentiating conditions, the 3T3-L1 cell line is able to differentiate into mature adipose cells. In contrast to the ASC fraction of adipose tissue, the 3T3-L1 cell line is considered as a homogeneous adipocyte precursor-containing population, and it is one of the most frequently used cell lines for the study of adipogenesis. As expected, the overexpression of akr1b7 in 3T3-L1 cells was sufficient to slow down the transition from undifferentiated fibroblast-like preadipocytes into mature round fat cells. MV cells accumulated less lipid than parental 3T3-L1 cells. This was not an inhibitory effect due to the transfection because 3T3-L1 cells stably transfected with the EV displayed the same profile of maturation as wild-type 3T3-L1 cells. Moreover, the level of aP2-encoding mRNA was lower in MV clones than in parental 3T3-L1 cells and did not increase during the course of adipocyte differentiation. We have also developed 3T3-L1 cells stably expressing AKR1B7 antisense mRNA (antisense cells) to study the effect of a decreased AKR1B7 expression in adipogenesis. Lipid accumulation was accelerated in antisense cells compared with 3T3-L1. As well, the level of aP2-encoding mRNA was higher in antisense clones than in parental 3T3-L1 cells, and this late adipogenesis marker appeared more quickly. These results corroborate those obtained using ASC fractions and demonstrate that AKR1B7 plays a key role in adipogenesis by limiting the rate of adipocyte differentiation and reducing lipid storage.

We have studied two other adipocyte differentiation markers in MV cells. The transcription factor C/EBP{delta} is implicated in the activation of peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}) (11). MC2-R-encoding mRNA is activated by PPAR{gamma} (12). No significant change was observed in the C/EBP{delta} mRNA levels in MV cells compared with parental 3T3-L1. On the contrary, MC2-R mRNA expression is significantly inhibited in the MV cells compared with 3T3-L1. PPAR{gamma} could then be a possible target of the inhibitory effect of AKR1B7, although the mechanism by which AKR1B7 inhibits the maturation of preadipocytes remains to be elucidated. However, one hypothesis could be that this factor acts through another putative activity involved in adipogenesis such as a prostaglandin (PG)-synthase activity. Indeed, the bovine AKR, AKR1B5 (also named 20{alpha}-hydroxysteroid dehydrogenase) catalyzes the reduction of PGH2 (the common precursor of PG) to PGF2{alpha} (37). The protein sequence of this AKR displays 69% homology with AKR1B7 (1). Moreover, a good correlation was observed between the expression of akr1b7 and cox 2 genes. COX2 is an enzyme able to produce PGH2 (38), and a treatment of 3T3-L1 preadipocytes with PGF2{alpha} inhibits the adipocyte differentiation (17). Also in human subcutaneous adipose tissue, Quinkler et al. (39) have suggested that AKR1C3 generates PGF2{alpha}. PGF2{alpha} is a PPAR{gamma} antagonist and is capable of inhibiting the formation of mature adipocytes (40).

Our in vivo observation on obese mice is in good agreement with our in vitro studies. Obesity of DIO mice results from an enlargement of the fat depots, particularly of the epididymal fat that fills the whole abdominal cavity. The levels of AKR1B7 mRNA in expressing fat tissues such as proximal epididymal fat were decreased compared with control mice.

In conclusion, our results suggest for the first time that AKR1B7 is an important inhibitory factor of the differentiation process leading from preadipocytes to fully mature adipocytes and could be implicated in obesity. This role might be extended to other reductases of the same family such as the human AKR1B1, which is the functional homolog in the adrenal gland (31) displaying a great homology with AKR1B7, and is an important goal for future direction.


    Acknowledgments
 
We thank Nicolas Gadot (from the Anipath platform), Virginie Bosiacki for technical assistance, and Frederic Volland for animal care.


    Footnotes
 
J.T. was supported by the French Ministère de l’Enseignement Supérieur et de la Recherche and by a grant from the Fondation pour la Recherche Médicale (Paris).

The authors have nothing to disclose.

First Published Online February 1, 2007

Abbreviations: AKR, Aldo-keto reductase; ASC, adipose stromal cell; C/EBP{delta}, CCAAT/enhancer binding protein-{delta}; COX2, cyclooxygenase 2; DIO, diet-induced obesity; EV, empty vector; FBS, fetal bovine serum; 4-HNE, 4-hydroxynonenal; MC2-R, type 2 melanocortin receptor; PG, prostaglandin; PPAR{gamma}, peroxisome proliferator-activated receptor-{gamma}; P450scc, P450 side-chain cleavage enzyme; StAR, steroidogenic acute regulatory protein.

Received December 19, 2006.

Accepted for publication January 19, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bohren KM, Bullock B, Wermuth B, Gabbay KH 1989 The aldo-keto reductase superfamily. cDNAs and deduced amino acid sequences of human aldehyde and aldose reductases. J Biol Chem 264:9547–9551[Abstract/Free Full Text]
  2. Donaghue KC, Margan SH, Chan AK, Holloway B, Silink M, Rangel T, Bennetts B 2005 The association of aldose reductase gene (AKR1B1) polymorphisms with diabetic neuropathy in adolescents. Diabet Med 22:1315–1320[CrossRef][Medline]
  3. Taragnat C, Berger M, Jean C 1988 Preliminary characterization, androgen-dependence and ontogeny of an abundant protein from mouse vas deferens. J Reprod Fertil 83:835–842[Abstract]
  4. Lefrancois-Martinez AM, Tournaire C, Martinez A, Berger M, Daoudal S, Tritsch D, Veyssiere G, Jean C 1999 Product of side-chain cleavage of cholesterol, isocaproaldehyde, is an endogenous specific substrate of mouse vas deferens protein, an aldose reductase-like protein in adrenocortical cells. J Biol Chem 274:32875–32880[Abstract/Free Full Text]
  5. Comporti M 1998 Lipid peroxidation and biogenic aldehydes: from the identification of 4-hydroxynonenal to further achievements in biopathology. Free Radic Res 28:623–635[Medline]
  6. Lau ET, Cao D, Lin C, Chung SK, Chung SS 1995 Tissue-specific expression of two aldose reductase-like genes in mice: abundant expression of mouse vas deferens protein and fibroblast growth factor-regulated protein in the adrenal gland. Biochem J 312:609–615[Medline]
  7. Val P, Martinez A, Sahut-Barnola I, Jean C, Veyssiere G, Lefrancois-Martinez AM 2002 A 77-base pair LINE-like sequence elicits androgen-dependent MVDP/akr1–b7 expression in mouse vas deferens, but is dispensable for adrenal expression in rats. Endocrinology 143:3435–3448[Abstract/Free Full Text]
  8. Moraes RC, Blondet A, Birkenkamp-Demtroeder K, Tirard J, Orntoft TF, Gertler A, Durand P, Naville D, Begeot M 2003 Study of the alteration of gene expression in adipose tissue of diet-induced obese mice by microarray and reverse transcription-polymerase chain reaction analyses. Endocrinology 144:4773–4782[Abstract/Free Full Text]
  9. Wajchenberg BL 2000 Subcutaneous and visceral adipose tissue: their relation to the metabolic syndrome. Endocr Rev 21:697–738[Abstract/Free Full Text]
  10. Prunet-Marcassus B, Cousin B, Caton D, Andre M, Penicaud L, Casteilla L 2006 From heterogeneity to plasticity in adipose tissues: site-specific differences. Exp Cell Res 312:727–736[CrossRef][Medline]
  11. Gregoire FM, Smas CM, Sul HS 1998 Understanding adipocyte differentiation. Physiol Rev 78:783–809[Abstract/Free Full Text]
  12. Noon LA, Clark AJ, King PJ 2004 A peroxisome proliferator-response element in the murine mc2-r promoter regulates its transcriptional activation during differentiation of 3T3–L1 adipocytes. J Biol Chem 279:22803–22808[Abstract/Free Full Text]
  13. Tong Q, Dalgin G, Xu H, Ting CN, Leiden JM, Hotamisligil GS 2000 Function of GATA transcription factors in preadipocyte-adipocyte transition. Science 290:134–138[Abstract/Free Full Text]
  14. Must A, Spadano J, Coakley EH, Field AE, Colditz G, Dietz WH 1999 The disease burden associated with overweight and obesity. JAMA 282:1523–1529[Abstract/Free Full Text]
  15. Student AK, Hsu RY, Lane MD 1980 Induction of fatty acid synthetase synthesis in differentiating 3T3-L1 preadipocytes. J Biol Chem 255:4745–4750[Abstract/Free Full Text]
  16. Val P, Aigueperse C, Ragazzon B, Veyssiere G, Lefrancois-Martinez AM, Martinez A 2004 Adrenocorticotropin/3',5'-cyclic AMP-mediated transcription of the scavenger akr1–b7 gene in adrenocortical cells is dependent on three functionally distinct steroidogenic factor-1-responsive elements. Endocrinology 145:508–518[Abstract/Free Full Text]
  17. Black SM, Szklarz GD, Harikrishna JA, Lin D, Wolf CR, Miller WL 1993 Regulation of proteins in the cholesterol side-chain cleavage system in JEG-3 and Y-1 cells. Endocrinology 132:539–545[Abstract]
  18. Taragnat C, Berger M, Jean CL 1990 Tissue and species specificity of mouse ductus deferens protein. J Androl 11:279–286[Abstract/Free Full Text]
  19. Yan H, Kermouni A, Abdel-Hafez M, Lau DC 2003 Role of cyclooxygenases COX-1 and COX-2 in modulating adipogenesis in 3T3-L1 cells. J Lipid Res 44:424–429[Abstract/Free Full Text]
  20. MacDougald OA, Lane MD 1995 Transcriptional regulation of gene expression during adipocyte differentiation. Annu Rev Biochem 64:345–373[CrossRef][Medline]
  21. Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM 2000 Transcriptional regulation of adipogenesis. Genes Dev 14:1293–1307[Free Full Text]
  22. Kutuk O, Adli M, Poli G, Basaga H 2004 Resveratrol protects against 4-HNE induced oxidative stress and apoptosis in Swiss 3T3 fibroblasts. Biofactors 20:1–10[Medline]
  23. Hubatsch I, Ridderstrom M, Mannervik B 1998 Human glutathione transferase A4-4: an {alpha}-class enzyme with high catalytic efficiency in the conjugation of 4-hydroxynonenal and other genotoxic products of lipid peroxidation. Biochem J 330:175–179[Medline]
  24. Jez JM, Bennett MJ, Schlegel BP, Lewis M, Penning TM 1997 Comparative anatomy of the aldo-keto reductase superfamily. Biochem J 326:625–636[Medline]
  25. Vohl MC, Sladek R, Robitaille J, Gurd S, Marceau P, Richard D, Hudson TJ, Tchernof A 2004 A survey of genes differentially expressed in subcutaneous and visceral adipose tissue in men. Obes Res 12:1217–1222[Medline]
  26. Fain JN, Madan AK, Hiler ML, Cheema P, Bahouth SW 2004 Comparison of the release of adipokines by adipose tissue, adipose tissue matrix, and adipocytes from visceral and subcutaneous abdominal adipose tissues of obese humans. Endocrinology 145:2273–2282[Abstract/Free Full Text]
  27. Bakker AH, Van Dielen FM, Greve JW, Adam JA, Buurman WA 2004 Preadipocyte number in omental and subcutaneous adipose tissue of obese individuals. Obes Res 12:488–498[Medline]
  28. Tchkonia T, Giorgadze N, Pirtskhalava T, Tchoukalova Y, Karagiannides I, Forse RA, DePonte M, Stevenson M, Guo W, Han J, Waloga G, Lash TL, Jensen MD, Kirkland JL 2002 Fat depot origin affects adipogenesis in primary cultured and cloned human preadipocytes. Am J Physiol Regul Integr Comp Physiol 282:R1286–R1296
  29. Aigueperse C, Val P, Pacot C, Darne C, Lalli E, Sassone-Corsi P, Veyssiere G, Jean C, Martinez A 2001 SF-1 (steroidogenic factor-1), C/EBPß (CCAAT/enhancer binding protein), and ubiquitous transcription factors NF1 (nuclear factor 1) and Sp1 (selective promoter factor 1) are required for regulation of the mouse aldose reductase-like gene (AKR1B7) expression in adrenocortical cells. Mol Endocrinol 15:93–111[Abstract/Free Full Text]
  30. Martinez A, Val P, Sahut-Barnola I, Aigueperse C, Veyssiere G, Lefrancois-Martinez AM 2003 Steroidogenic factor-1 controls the aldose reductase akr1b7 gene promoter in transgenic mice through an atypical binding site. Endocrinology 144:2111–2120[Abstract/Free Full Text]
  31. Ragazzon B, Lefrancois-Martinez AM, Val P, Sahut-Barnola I, Tournaire C, Chambon C, Gachancard-Bouya JL, Begue RJ, Veyssiere G, Martinez A 2006 Adrenocorticotropin-dependent changes in SF-1/DAX-1 ratio influence steroidogenic genes expression in a novel model of glucocorticoid-producing adrenocortical cell lines derived from targeted tumorigenesis. Endocrinology 147:1805–1818[Abstract/Free Full Text]
  32. Brockstedt E, Peters-Kottig M, Badock V, Hegele-Hartung C, Lessl M 2000 Luteinizing hormone induces mouse vas deferens protein expression in the murine ovary. Endocrinology 141:2574–2581[Abstract/Free Full Text]
  33. Caspar-Bauguil S, Cousin B, Galinier A, Segafredo C, Nibbelink M, Andre M, Casteilla L, Penicaud L 2005 Adipose tissues as an ancestral immune organ: site-specific change in obesity. FEBS Lett 579:3487–3492[CrossRef][Medline]
  34. Finotto S, De Sanctis GT, Lehr HA, Herz U, Buerke M, Schipp M, Bartsch B, Atreya R, Schmitt E, Galle PR, Renz H, Neurath MF 2001 Treatment of allergic airway inflammation and hyperresponsiveness by antisense-induced local blockade of GATA-3 expression. J Exp Med 193:1247–1260[Abstract/Free Full Text]
  35. Suram S, Brown GD, Ghosh M, Gordon S, Loper R, Taylor PR, Akira S, Uematsu S, Williams DL, Leslie CC 2006 Regulation of cytosolic phospholipase A2 activation and cyclooxygenase 2 expression in macrophages by the ß-glucan receptor. J Biol Chem 281:5506–5514[Abstract/Free Full Text]
  36. Rodriguez AM, Pisani D, Dechesne CA, Turc-Carel C, Kurzenne JY, Wdziekonski B, Villageois A, Bagnis C, Breittmayer JP, Groux H, Ailhaud G 2005 Transplantation of a multipotent cell population from human adipose tissue induces dystrophin expression in the immunocompetent mdx mouse. J Exp Med 201:1397–1405[Abstract/Free Full Text]
  37. Madore E, Harvey N, Parent J, Chapdelaine P, Arosh JA, Fortier MA 2003 An aldose reductase with 20{alpha}-hydroxysteroid dehydrogenase activity is most likely the enzyme responsible for the production of prostaglandin F2{alpha} in the bovine endometrium. J Biol Chem 278:11205–11212[Abstract/Free Full Text]
  38. Vane J 1994 Towards a better aspirin. Nature 367:215–216[CrossRef][Medline]
  39. Quinkler M, Bujalska IJ, Tomlinson JW, Smith DM, Stewart PM 2006 Depot-specific prostaglandin synthesis in human adipose tissue: a novel possible mechanism of adipogenesis. Gene 380:137–143[CrossRef][Medline]
  40. Adams M, Montague CT, Prins JB, Holder JC, Smith SA, Sanders L, Digby JE, Sewter CP, Lazar MA, Chatterjee VK, O’Rahilly S 1997 Activators of peroxisome proliferator-activated receptor {gamma} have depot-specific effects on human preadipocyte differentiation. J Clin Invest 100:3149–3153[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
148/5/1996    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tirard, J.
Right arrow Articles by Naville, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tirard, J.
Right arrow Articles by Naville, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals