| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Institut National de la Santé et de la Recherche Médicale, Unité 449; Institut National de la Recherche Agronomique, Unité Mixte de Recherche 1235; and Université Claude Bernard (J.T., J.G., M.B., D.N.), F-69000 Lyon, France; and Centre National de la Recherche Scientifique, Unité Mixte de Recherche 6547 (A.M.L.-M., A.M.), F-63170 Aubière, France
Address all correspondence and requests for reprints to: Danielle Naville, Institut National de la Santé et de la Recherche Médicale Unité 449-Institut National de la Recherche Agronomique Unité Mixte de Recherche 1235, Faculté de Médecine Laennec, 8, rue Guillaume Paradin, 69372 Lyon Cedex 08, France. E-mail: naville{at}lyon.inserm.fr.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Akr1b7 encodes an aldose-reductase (molecular mass, 34.5 kDa) (3) that has been described to be involved in detoxification processes until now. In the mouse, it is the major enzyme responsible for the reduction of isocaproaldehyde derived from the side-chain cleavage of cholesterol by P450 side-chain cleavage enzyme (P450scc) that is the first step of steroidogenesis (4).
We have also shown that AKR1B7 is able to detoxify the cytotoxic
-, ß-unsaturated acyl aldehyde 4-hydroxynonenal (4-HNE) (4). This product is a natural compound resulting from the lipid peroxidation and cleavage that occur in response to oxidative stress and aging (5).
AKR1B7 was initially described as a secretory mouse vas deferens protein (MVDP) (3) and is also highly expressed in the adrenal cortex in rodents (6). Consistent with the enzy-matic activity of AKR1B7, a significant expression has also been detected in rodent testis, ovaries, and intestine, whereas low levels are expressed in kidney, lung, and liver (6, 7).
We have recently shown the presence of AKR1B7-encoding mRNA in the mouse white adipose tissue as well as a decrease of its expression in the whole epididymal fat during obesity induced by a high-fat diet (8).
The white adipose tissue is the main site of energy storage of the body. The adipocytes store large amounts of triglycerides during periods of energy excess and deliver fatty acids to other tissues when required. The white adipose tissue is disseminated in different locations, and these different adipose tissues display different metabolic properties and functions (9). In addition to adipocytes, the adipose tissue contains stromal-vascular cells including fibroblastic cells, connective tissue cells, leukocytes, macrophages, and preadipocytes (adipocyte precursors), which contribute to its physiological integrity (10).
During adipocyte differentiation, the acquisition of the adipocyte phenotype is characterized by chronological changes in the expression of numerous genes. This is reflected by the appearance of early, such as the transcription factor CCAAT/enhancer binding protein-
(C/EBP
); intermediate, such as the type 2 melanocortin receptor (MC2-R); and late markers that follows the triglyceride accumulation (11, 12).
These changes take place primarily at the transcriptional level although a posttranscriptional regulation can occur for some genes expressed in adipocytes. In addition to the gene activation, genes that have an inhibitory effect on adipogenesis or genes unnecessary for adipose cell function are repressed (11). This is the case for the transcription factor GATA-3 (13).
The white adipose tissue expansion during adulthood results from an increase of both the size and the number of the adipocytes (11). Obesity is a disorder that results from an enlargement of the white adipose tissue mass, and this is a major risk factor for type 2 diabetes and cardiovascular diseases (14). Therefore, understanding the cellular and molecular basis of the adipose tissue growth is an important research goal.
In this study, we reported that only some mouse white adipose tissues expressed AKR1B7 depending on their location. In addition, by in vitro studies, we demonstrated for the first time that AKR1B7 could inhibit the adipocyte differentiation process by limiting the lipid accumulation. Moreover, we showed that its expression is reduced in obese mouse adipose tissues that normally express high levels of AKR1B7-encoding mRNA in control mice.
| Materials and Methods |
|---|
|
|
|---|
Animals
Four-week-old male C57BL/6J mice were purchased from Harlan (Le Malcourlet, France) and housed two animals per cage with free access to water and chow. Room temperature was maintained at 24 C, and lights were on for 12 h/d. After 1 wk acclimatization, mice were divided into two groups: one with free access to control chow and another group with free access to a commercial high-fat diet from Harlan. Control chow (3.1% fat and 3.3 kcal/g) and high-fat chow (36.1% fat and 5.4 kcal/g) have been previously described (8). After 8 wk, all mice were killed by cervical dislocation. Adipose tissues from various locations, femoral sc fat, fat surrounding the adrenal gland, and two different regions of the epididymal fat (proximal and distal), were removed and immediately processed or frozen in liquid N2 and stored at 80 C until use. All procedures were performed in accordance with the principles and guidelines established by the French Department of Agriculture for the care and use of laboratory animals.
Adipose tissue fractionation
Freshly excised fat pads were rinsed in PBS, minced, and digested for 30 min at 37 C in Krebs-Ringer bicarbonate (pH 7.4) containing 4% BSA and 0.5 g/liter collagenase (Sigma-Aldrich). The digested tissues were filtered through a 250-µm nylon mesh to remove undigested tissue and centrifuged at 750 x g for 5 min.
The floating adipocyte fraction was saved and processed or frozen in liquid N2 and stored at 80 C. The stromal-vascular pellet was resuspended in a lysis buffer (154 mM NH4Cl, 10 mM KHCO3, and 1 mM EDTA), incubated 10 min at room temperature, and pelleted at 750 x g for 5 min. Cells were processed or frozen in liquid N2 and stored at 80 C until use.
Adipose stromal cell (ASC) culture and differentiation
The stromal-vascular pellet was resuspended in DMEM/F12 medium containing 100 U/ml penicillin, 0.1 g/liter streptomycin (antibiotics), and 100 U/ml glutamine (Gln). The number of isolated cells was counted and their viability assessed by trypan blue exclusion.
Preadipocytes were incubated in the growth medium (DMEM/F12 medium supplemented with 10% FBS, 100 µM ascorbic acid, 100 nM insulin, 200 pM T3, Gln, and antibiotics) at 37 C in a humidified atmosphere of 5% CO2. After 24 h, the medium was changed. When cells reached confluency, the medium was removed and replaced by the differentiation medium (DMEM/F12 medium supplemented with 10% FBS, 250 µM isobutylmethylxanthine, 100 µM ascorbic acid, 100 nM insulin, 2 µM dexamethasone, 200 pM T3, Gln, and antibiotics).
Culture and differentiation of 3T3-L1 cells
The 3T3-L1 preadipocytes were cultured and induced to differentiate as previously described (15). Briefly, cells were maintained in DMEM containing 10% bovine serum, Gln, and antibiotics at 37 C in a humidified atmosphere of 5% CO2. Differentiation was induced in confluent 3T3-L1 cells by incubating them in DMEM supplemented with 10% FBS, 500 µM isobutylmethylxanthine, 70 nM insulin, 500 nM dexamethasone, Gln, and antibiotics. After 3 d, the medium was replaced by DMEM containing 10% FBS, 70 nM insulin, 500 nM dexamethasone, Gln, and antibiotics. On d 5, the medium was replaced by DMEM containing only 10% FBS, Gln, and antibiotics.
Transfection and selection of 3T3-L1 cells stably expressing sense or antisense AKR1B7 mRNA
The full-length coding sequence of akr1b7 (4) was cloned into the mammalian expression vector pcDNA3 (Invitrogen). To generate cell lines stably expressing akr1b7, 3T3-L1 cells were transfected with the akr1b7 expression vector using Lipofectamine Plus Reagent (Invitrogen) according to the manufacturers protocol. Transfected cells were selected for 2 wk in medium containing 400 mg/liter geneticin (G418; Sigma-Aldrich). The cells were screened for AKR1B7 expression by Western blot, and stably expressing transfectants (MV clones) were further grown in culture medium supplemented with 200 mg/liter geneticin. The 3T3-L1 cells transfected with the empty vector (pcDNA3) were selected in the same way to give empty vector (EV) clones.
To generate cell lines expressing an antisense AKR1B7 mRNA, the complete AKR1B7 cDNA was inserted in inverted orientation in the pEGFP-N2 vector (Clontech, Ozyme, Montigny-le-Bretonneux, France). The 3T3-L1 cells were transfected with this pEGFP-N2-AS vector using Lipofectamine Plus Reagent (Invitrogen). G418-resistant cells were selected to give antisense clones. Clones expressing a decreased AKR1B7 protein were used for additional studies.
Lipid staining
The lipid accumulation in primary cultures or differentiated 3T3-L1 was visualized by staining with Oil Red O. Briefly, differentiated adipocytes were fixed in 2% formaldehyde and stained for 15 min in a 0.4% Oil Red O (Sigma-Aldrich) solution in isopropanol. In some experiments, 3T3-L1 cells were cultured and induced to differentiate in a LabTek chamber slide. The lipid accumulation in adipocytes was visualized using Sudan III, and nuclei were colored by using conventional hematoxylin staining.
RNA and protein preparation
Total RNA was isolated from mouse tissues or cells by using Trizol (Invitrogen) according to the manufacturers protocol.
To prepare proteins, cells were rapidly lysed in a mixture containing HEPES (20 mM), dithiothreitol (0.5 mM), EDTA (0.2 mM), NaCl (420 mM), MgCl2 (1.5 mM), glycerol (25%), IGEPAL CA-630 (0.2%), and protease inhibitors. After 10 min at room temperature, the samples were centrifuged at 10,000 x g for 5 min. The clear supernatant was frozen at 20 C.
RT-PCR
One microgram of total RNA was treated with DNase I (Invitrogen). The RT reaction was carried out with the Moloney murine leukemia virus reverse transcriptase (Invitrogen) and the PCR by using Eurobiotaq polymerase (Eurobio, Courtaboeuf, France). The following primer pairs and programs were used: AKR1B7 (annealing temperature, 52 C; 35 cycles), CCCTCTCGGATCTGAAGCTG (sense) and GGGAATCTCCATTACTACG (antisense); GAPDH (57 C; 26 cycles), ATGGGTGTGAACCACGAAATA (sense) and TGTCATACCAGGAAATGAGCTTG (antisense); GATA-3 (61 C; 32 cycles), CTACCGGGTTCGGATGTAA (sense) and AGGGAGAGATGTGGCTCAGG (antisense); and Cox 2 (50 C; 35 cycles), GACAGTCCACCTACTTACAA (sense) and CTATGAGTATGAGTCTGCTG (antisense).
Real-time RT-PCR
One microgram of RNA served as a template for the SuperScriptII reverse transcriptase (Invitrogen) in the presence of random hexamer and oligo(dT) primers (Promega, Charbonnieres-les-Bains, France). All samples were treated by DNase I before the RT. PCR were performed using the Light Cycler Fast Start DNA Master SyBR Green I kit (Roche, Meylan, France). The following primer pairs were used: AKR1B7 (annealing temperature, 55 C), CAGATTGAGAGCCACCCTTA (sense) and TGGGAATCTCCATTACTACG (antisense); cyclophilin (55 C), CTGCACTGCCAAGACTGAATG (sense); TTGCCATTCCTGGACCCAAA (antisense); aP2 (59 C), CAGAAGTGGGATGGAAAGTCG (sense) and CGACTGACTATTGTAGTGTTTGA (antisense); CEPB
(55 C), ATCGCTCGAGCTTCCTATGT (sense) and AGTCATGCTTTCCCGTGTTC (antisense); and MC2-R (53 C), ATCTGCAGTTTGGCCATTTC (sense) and GCAATGACAGACAGGCTGAA (antisense).
Western blot analysis
Protein extracts (2080 µg) were separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Immobilon-P transfer membrane; pore size, 0.45 µm; Millipore, Saint-Quentin-en-Yvelines, France). After saturation (1 h in PBS containing 0.1% Tween 20 and 10% milk), membranes were incubated overnight at 4 C in the presence of a primary rabbit polyclonal antibody raised against the mouse AKR1B7 (1:3000) that had been prepared as previously reported (16), a rabbit polyclonal anti-P450scc (1:2000) (17), a rabbit polyclonal anti-StAR (1:5000) (kind gift of D. M. Stocco, Texas Tech University), a rabbit polyclonal anti-COX-2 (1:2000) (Cayman, Ann Arbor, MI), or a rabbit polyclonal anti-ß-actin (1:2000) (Sigma) and followed by incubation (1 h) with peroxidase-conjugated antirabbit IgG (EnVision+; Dako, Trappes, France) at 1:25. The peroxidase activity was detected using the ECL plus Western blotting detection System (Amersham Biosciences, Orsay, France).
Immunohistochemistry
Epididymal fat mass was rinsed and fixed by immersion in Bouins fixative for 24 h at room temperature and embedded in paraffin. Slides (20 µm) were incubated in 3% H2O2 for 5 min to block endogenous peroxidase activity, rinsed with PBS, and then incubated in the presence of the rabbit antimouse AKR1B7 antibody (1:100) (18) in the blocking buffer (PBS, 2% BSA) for 3 h at 4 C and revealed with the LSAB2 kit (Dako) using avidin-biotin-peroxidase complex as a staining reaction and azo-3-ethyl-9-carbazole as a chromogen.
Statistical analysis
Statistical analysis was performed using one-way ANOVA analysis, followed by post hoc testing with Fishers protected least squares difference. Differences were considered significant at P < 0.05.
| Results |
|---|
|
|
|---|
|
|
|
The expression level of akr1b7 was much higher in proximal epididymal and adrenal fat masses compared with distal epididymal and sc adipose tissues, and as previously shown in Fig. 3A
, no difference in the gata-3 and cox 2 expression levels was observed in the ASC fractions prepared from proximal epididymal or from distal epididymal tissue. These results could suggest that the ratio between preadipocytes and adipocytes is higher in adrenal and proximal epididymal adipose tissues, where akr1b7 is mainly expressed, than in the other adipose tissues that express akr1b7 very weakly.
The steroidogenesis markers P450scc and steroidogenic acute regulatory protein (StAR) are not expressed in the ASC fraction
Because the expression of akr1b7 was described in all steroid-producing tissues, we checked for the expression of two steroidogenic markers, P450scc and StAR, in ASC by Western blot analysis. As expected, P450scc and StAR were abundantly expressed, as was AKR1B7, in adrenal gland (Fig. 4
). The preadipocyte marker COX2 was present in both ASC fractions, in contrast to P450scc and StAR, which were undetectable even in the AKR1B7-expressing proximal epididymal fat ASC fraction. Thus, we can conclude that cells from ASC fractions expressing AKR1B7 are not steroidogenic cells.
|
|
Distal epididymal cells, however, exhibited morphological changes between d 3 and 6 of differentiation after confluence. They developed a rounded shape and accumulated numerous lipid droplets in their cytoplasm on d 6 (Fig. 6A
). On the contrary, a more limited number of intracytoplasmic vacuoles were observed in proximal epididymal cells (Fig. 6B
). These results suggest that the lipid accumulation in proximal epididymal ASC was considerably delayed and/or limited.
|
Differentiation of 3T3-L1 cells stably expressing AKR1B7
The 3T3-L1 cell line is known to have the capacity to convert to mature adipose cells at confluence. To better define the role of AKR1B7 on the differentiating process, confluent 3T3-L1 cells stably transfected with an EV or an akr1b7 expression vector (MV), and parental 3T3-L1 cells were induced to differentiate into adipocytes. By Western blot analysis, we observed that the AKR1B7 protein is clearly overexpressed in MV cells compared with 3T3-L1 cells (Fig. 7A
).
|
The mRNA expression level of the early adipocyte differentiation-stage marker C/EBP
was not significantly different between parental 3T3-L1 and MV cells (Fig. 7D
). However, in accordance with our results on lipid accumulation, mRNA expression level of MC2-R, which is an intermediate and late adipogenesis marker (12) increased during the differentiation of parental 3T3-L1 cells but not MV cells (d 3 compared with d 6) (Fig. 7E
). This level remained significantly lower in MV cells compared with parental 3T3-L1 cells (on d 3 and 6). In addition, the expression of the mRNA encoding aP2 was lower in MV cells than in parental 3T3-L1 cells, whatever the day of differentiation (Fig. 7F
), and a significant difference was observed on d 6 of differentiation. These results suggest that when stably expressed in 3T3-L1 cells, AKR1B7 inhibited the transition from early to intermediate stage of adipocyte differentiation and prevented the lipid accumulation.
Differentiation of 3T3-L1 cells stably expressing antisense AKR1B7
The level of AKR1B7 mRNA was almost undetectable in antisense cells (expressing an antisense AKR1B7) compared with parental 3T3-L1 cells (Fig. 8A
). Cell differentiation into adipocytes was assessed by visualizing the lipid accumulation and by measuring the level of aP2-encoding mRNA. After 6 d of differentiation, the parental 3T3-L1 cells accumulated a lesser amount of lipid droplets in the cytoplasm than antisense clones, as judged by the weaker lipid staining by Oil Red O (Fig. 8B
). In addition, the expression of the mRNA encoding aP2 was higher in antisense cells than in parental 3T3-L1 cells (Fig. 8C
); the differences were statistically significant on d 3 and 6 of differentiation. These results suggest that in the absence of AKR1B7, the adipocyte differentiation and lipid accumulation were higher in 3T3-L1 cells than in antisense clones.
|
|
| Discussion |
|---|
|
|
|---|
Adipose tissue has not been described to be able to perform the side-chain cleavage of cholesterol, and we showed herein that P450scc is absent in adipose tissue. It is then unlikely that the role of AKR1B7 in this particular tissue will be to catalyze the reduction of isocaproaldehyde. The 4-HNE has been suggested to contribute to oxidative stress-mediated cell injury and to be involved in apoptotic death (22). The detoxification of 4-HNE is necessary, but glutathione-S-transferase-
4 is present in all fat depots (data not shown), in contrast to AKR1B7, and plays this role in the adipose tissue (23). We have demonstrated an expression of akr1b7 in the mouse abdominal adipose tissue (8) but despite high homologies (24), no other AKR1B family members have yet been described in adipose tissues. Most of the studies performed to determine the role of AKR1B7 have focused on the characterization of this enzyme in adrenals (4), and no studies have been performed on its role in adipose tissue.
Previous studies have shown that white adipose tissues located at different sites display some disparities in their metabolic properties (9), mRNA expression (25), and protein secretion (26). Moreover, according to the fat depot origin, the preadipocyte number (27) and the rate of adipogenesis (28) are different. These variations are observed mostly when the intraabdominal fat (omental in men and epididymal in rodent) is compared with the sc fat. In our study, we have shown that some differences could also exist within the same fat mass. The epididymal adipose tissue could be divided into two different tissues depending on their akr1b7 expression levels; proximal epididymal and adrenal adipose tissues, which both express akr1b7, are in direct contact with two endocrine glands (testis and adrenal gland, respectively). On the contrary, tissues such as sc and distal epididymal adipose tissues, which are located at a more distal position, do not express akr1b7. Interestingly, AKR1B7 undergoes multiple tissue-specific hormonal regulations. Initially described as an androgen-dependent marker specific to the mouse vas deferens, it has now been shown to be expressed in adrenal glands, testis, ovaries, and intestine under the control of ACTH, androgen, LH, and oxysterol, respectively (4, 7, 16, 29, 30, 31, 32). In this context, the question of a specific role of AKR1B7 in expressing adipose tissues was addressed. Our data showed that besides akr1b7, two preadipocyte markers, gata-3 and cox 2, were more highly expressed in proximal epididymal and adrenal adipose tissues than in distal epididymal. Because both markers were equally expressed in ASC fractions from proximal epididymal and distal epididymal tissues, we conclude that proximal epididymal tissue contained a greater proportion of preadipocytes than distal epididymal tissue. However, we cannot exclude a heterogeneity inside both ASC fractions. In fact, the ASC fraction contains not only preadipocytes but also other cell types such as immune cells, macrophages, and leukocytes representing around 30 and 10%, respectively, of an ASC fraction (10, 33). Moreover, gata-3 and cox 2 expression has been documented in various immunity cells (34, 35). However, despite this heterogeneity, ASC cultures are classically used to investigate the preadipocyte differentiation into mature adipocytes. Our results showed that during the course of differentiation, the lipid accumulation was much higher in ASC cultures from distal epididymal tissue than in ASC cultures from proximal epididymal tissue. These proximal epididymal adipose cells exhibited a limited number of lipid droplets even in the latest days of differentiation studied, although the size of these lipid droplets was very similar in both cell preparations. This reflects that ASC cultures from proximal epididymal tissue contain fewer mature adipocytes than those from distal epididymal tissue after 6 d of differentiation. In parallel, aP2, a well-known marker of adipocyte maturation, was consequently less expressed in proximal epididymal than in the distal epididymal cell preparation and increased only in cells from distal epididymal, indicating clear differences in the differentiation capabilities between the two cell fractions. The presence of aP2-encoding mRNA on d 0 in distal epididymal cultured cells was because d 0 corresponded to the confluence step that is reached 1 wk after the beginning of the culture. This would indicate that at this stage, a fraction of the cells is already engaged in the differentiation process, although the level of COX2 (a preadipocyte marker) remained elevated and only a limited number of lipid droplets was present. The maturation process was considerably slowed down in proximal epididymal ASC cultures despite the fact that the culture conditions were strictly identical for both ASC fractions and that cells are growing at the same speed and did not exhibit any morphological differences except for the lipid storage. It is clear that both precursor ASC cell pools contained heterogeneous cell populations, but Rodriguez et al. (36) have reported that the fast-adherent ASC correspond to a preadipocyte-enriched fraction. From these results obtained with ASC cells, our hypothesis was that the high expression of akr1b7 would slow down adipogenesis and inhibit lipid storage in adipose cells. The fact that the protein AKR1B7 decreased during the course of differentiation is in good agreement with this hypothesis. To test it, we have developed 3T3-L1 cell lines stably overexpressing akr1b7 (MV clones). Under differentiating conditions, the 3T3-L1 cell line is able to differentiate into mature adipose cells. In contrast to the ASC fraction of adipose tissue, the 3T3-L1 cell line is considered as a homogeneous adipocyte precursor-containing population, and it is one of the most frequently used cell lines for the study of adipogenesis. As expected, the overexpression of akr1b7 in 3T3-L1 cells was sufficient to slow down the transition from undifferentiated fibroblast-like preadipocytes into mature round fat cells. MV cells accumulated less lipid than parental 3T3-L1 cells. This was not an inhibitory effect due to the transfection because 3T3-L1 cells stably transfected with the EV displayed the same profile of maturation as wild-type 3T3-L1 cells. Moreover, the level of aP2-encoding mRNA was lower in MV clones than in parental 3T3-L1 cells and did not increase during the course of adipocyte differentiation. We have also developed 3T3-L1 cells stably expressing AKR1B7 antisense mRNA (antisense cells) to study the effect of a decreased AKR1B7 expression in adipogenesis. Lipid accumulation was accelerated in antisense cells compared with 3T3-L1. As well, the level of aP2-encoding mRNA was higher in antisense clones than in parental 3T3-L1 cells, and this late adipogenesis marker appeared more quickly. These results corroborate those obtained using ASC fractions and demonstrate that AKR1B7 plays a key role in adipogenesis by limiting the rate of adipocyte differentiation and reducing lipid storage.
We have studied two other adipocyte differentiation markers in MV cells. The transcription factor C/EBP
is implicated in the activation of peroxisome proliferator-activated receptor-
(PPAR
) (11). MC2-R-encoding mRNA is activated by PPAR
(12). No significant change was observed in the C/EBP
mRNA levels in MV cells compared with parental 3T3-L1. On the contrary, MC2-R mRNA expression is significantly inhibited in the MV cells compared with 3T3-L1. PPAR
could then be a possible target of the inhibitory effect of AKR1B7, although the mechanism by which AKR1B7 inhibits the maturation of preadipocytes remains to be elucidated. However, one hypothesis could be that this factor acts through another putative activity involved in adipogenesis such as a prostaglandin (PG)-synthase activity. Indeed, the bovine AKR, AKR1B5 (also named 20
-hydroxysteroid dehydrogenase) catalyzes the reduction of PGH2 (the common precursor of PG) to PGF2
(37). The protein sequence of this AKR displays 69% homology with AKR1B7 (1). Moreover, a good correlation was observed between the expression of akr1b7 and cox 2 genes. COX2 is an enzyme able to produce PGH2 (38), and a treatment of 3T3-L1 preadipocytes with PGF2
inhibits the adipocyte differentiation (17). Also in human subcutaneous adipose tissue, Quinkler et al. (39) have suggested that AKR1C3 generates PGF2
. PGF2
is a PPAR
antagonist and is capable of inhibiting the formation of mature adipocytes (40).
Our in vivo observation on obese mice is in good agreement with our in vitro studies. Obesity of DIO mice results from an enlargement of the fat depots, particularly of the epididymal fat that fills the whole abdominal cavity. The levels of AKR1B7 mRNA in expressing fat tissues such as proximal epididymal fat were decreased compared with control mice.
In conclusion, our results suggest for the first time that AKR1B7 is an important inhibitory factor of the differentiation process leading from preadipocytes to fully mature adipocytes and could be implicated in obesity. This role might be extended to other reductases of the same family such as the human AKR1B1, which is the functional homolog in the adrenal gland (31) displaying a great homology with AKR1B7, and is an important goal for future direction.
| Acknowledgments |
|---|
| Footnotes |
|---|
The authors have nothing to disclose.
First Published Online February 1, 2007
Abbreviations: AKR, Aldo-keto reductase; ASC, adipose stromal cell; C/EBP
, CCAAT/enhancer binding protein-
; COX2, cyclooxygenase 2; DIO, diet-induced obesity; EV, empty vector; FBS, fetal bovine serum; 4-HNE, 4-hydroxynonenal; MC2-R, type 2 melanocortin receptor; PG, prostaglandin; PPAR
, peroxisome proliferator-activated receptor-
; P450scc, P450 side-chain cleavage enzyme; StAR, steroidogenic acute regulatory protein.
Received December 19, 2006.
Accepted for publication January 19, 2007.
| References |
|---|
|
|
|---|
-class enzyme with high catalytic efficiency in the conjugation of 4-hydroxynonenal and other genotoxic products of lipid peroxidation. Biochem J 330:175179[Medline]
-hydroxysteroid dehydrogenase activity is most likely the enzyme responsible for the production of prostaglandin F2
in the bovine endometrium. J Biol Chem 278:1120511212
have depot-specific effects on human preadipocyte differentiation. J Clin Invest 100:31493153[Medline]This article has been cited by other articles:
![]() |
Z. Kabututu, M. Manin, J.-C. Pointud, T. Maruyama, N. Nagata, S. Lambert, A.-M. Lefrancois-Martinez, A. Martinez, and Y. Urade Prostaglandin F2{alpha} Synthase Activities of Aldo-Keto Reductase 1B1, 1B3 and 1B7 J. Biochem., February 1, 2009; 145(2): 161 - 168. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |