Endocrinology, doi:10.1210/en.2006-0041
Endocrinology Vol. 148, No. 5 2138-2147
Copyright © 2007 by The Endocrine Society
Delayed Mammary Gland Involution in Mice with Mutation of the Insulin-Like Growth Factor Binding Protein 5 Gene
Yun Ning1,
Bao Hoang1,
Alwin G. P. Schuller1,
Tara P. Cominski,
Ming-Sing Hsu,
Teresa L. Wood and
John E. Pintar
Department of Neuroscience and Cell Biology (Y.N., B.H., A.G.P.S., T.P.C., M.-S.H., J.E.P.), University of Medicine and Dentistry of New Jersey, Piscataway, New Jersey 08854; and Department of Neurology and Neurosciences (T.L.W.), New Jersey Medical School, University of Medicine and Dentistry of New Jersey, Newark, New Jersey 07103
Address all correspondence and requests for reprints to: John E. Pintar Department of Neuroscience and Cell Biology, University of Medicine and Dentistry of New Jersey, Piscataway, New Jersey 08854. E-mail: pintar{at}cabm.rutgers.edu.
 |
Abstract
|
|---|
IGFs (IGF-I and IGF-II) are essential for development, and their bioactivities are tightly regulated by six related IGF-binding proteins (IGFBPs). IGFBP-5 is the most highly conserved binding protein and is expressed in several key developmental lineages as well as in multiple adult tissues including the mammary gland. To explore IGFBP-5 actions in vivo, we produced IGFBP-5 knockout (KO) mice. Whole-body growth, selected organ weights, and body composition were essentially normal in IGFBP-5 KO mice, presumably because of substantial compensation by remaining IGFBP family members. The IGFBP-5 KO mice also exhibited normal mammary gland development and were capable of nursing their pups. We then directly evaluated the proposed role of IGFBP-5 in apoptosis and remodeling of mammary gland during involution. We found that the process of involution after forced weaning was delayed in IGFBP-5 KO mice, with both the appearance of apoptotic cells and the reappearance of adipocytes retarded in mutant mice, compared with controls. We also determined the effects of IGFBP-5 deletion on mammary gland development in pubertal females after ovariectomy and stimulation with estradiol/progesterone. In this paradigm, IGFBP-5 KO mammary glands exhibited enhanced alveolar bud formation consistent with enhanced IGF-I action. These results demonstrate that IGFBP-5, although not essential for normal growth, is required for normal mammary gland involution and can regulate mammary gland morphogenesis in response to hormone stimulation.
 |
Introduction
|
|---|
THE IGFs (IGF-I and IGF-II) regulate cellular proliferation, survival, and differentiation (1, 2, 3). IGF bioactivity is modulated by a family of six IGF-binding proteins (IGFBPs) (4) that bind to IGFs with high affinity and thus, on one hand, can prevent IGFs from binding to their cell membrane receptors. Conversely, the binding between IGFBPs and IGFs can also stabilize IGF and thus potentially enhance subsequent IGF presentation to its receptors. The IGFBPs are expressed in spatial and temporally specific expression patterns during development and thus have been implicated in multiple processes (5), although specific roles have remained elusive.
In the IGFBP family, IGFBP-5 is a 29-kDa highly conserved protein, which is secreted by a wide variety of cell types during different growth conditions in vitro (4). In vivo, IGFBP-5 is expressed in many cell types and is up-regulated during the differentiation of neural (6), osteoblast (7, 8), myoblast (9, 10, 11), and adult rat forebrain (12) lineages. IGFBP-5 has been suggested to play a role in central nervous system formation, at least in lower vertebrates, which is supported by enlarged head structures and cement glands in Xenopus embryos after IGFBP-5 mRNA injection (13). Postnatally, serum IGFBP-5, as well as IGFBP-3, can form ternary complexes with IGF-I or IGF-II and an acid-labile subunit to regulate IGF effects (14). The high-affinity binding between IGFBP-5 and IGFs is thought to not only stabilize the IGF in circulation but also inhibit IGF activity by preventing IGF interaction with the type 1 receptor. Consistent with the postulate that IGFBP-5 is generally an inhibitory protein, IGFBP-5-overexpressing mice were found to be severely growth retarded, accompanied by significantly reduced proportional skeletal muscle mass as well as neonatal morbidity and reduced fertility (15). In addition to the presumed IGF-dependent effects, IGF-independent effects of IGFBP-5 have also been suggested. For example, IGFBP-5 can bind components of the extracellular matrix and the cell membrane (16, 17) and thus has been implicated in osteoblast differentiation and mammary gland apoptosis. IGFBP-5 has also been localized in the nucleus in vascular smooth muscle cells and has an N domain with strong transactivation activity (10), which provides a potential mechanism to stimulate mitogenesis by a pathway that is independent of IGF action.
IGFBP-5 is also expressed in mammary and breast tissue of mammals (18, 19, 20, 21, 22). The mammary gland is a particularly useful model because most of its development occurs after birth and involves repeated phases of growth, differentiation, and apoptosis that is coordinated by multiple growth factors and steroid/peptide hormones (23, 24, 25). Morphogenesis commences with ductal elongation and branching during puberty, followed by lobuloalveolar expansion during pregnancy, terminal differentiation of these units in late pregnancy and lactation, and finally involution of the gland after lactation (23, 24, 25). The expression pattern of IGFBP-5 indicates potential roles in the development of the mammary gland and branching morphogenesis during puberty, pregnancy, and involution (21, 26). For example, IGFBP-5 is highly expressed in the body cell layer of the terminal end buds and throughout the developing ductal epithelium during puberty (21). In addition, levels of IGFBP-5 protein, which decrease during lactation (21), are increased after pup removal during forced involution (18). Results from several previous studies have led to the proposal that IGFBP-5 is important in promoting cell death and remodeling during involution, through both IGF-dependent and IGF-independent actions (18, 19, 27, 28). Moreover, transgenic overexpression of IGFBP-5 in mammary tissue resulted in increased apoptotic death of the epithelial cells (20).
In this study, we produced IGFBP-5 null mice and examined growth rate, body composition, alterations in the remaining IGFBPs, and total circulating IGF-I levels in serum of IGFBP-5 null mice. We further explored in more detail the role of IGFBP-5 during pubertal ductal growth in mammary gland development as well as during involution after weaning. Our study demonstrates that IGFBP-5 is not essential for normal mouse growth but is required in aspects of mammary gland involution and responses to exogenous hormones.
 |
Materials and Methods
|
|---|
All experiments were conducted in accordance with the guidelines of the Institutional Care and Use Committees of University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School and the National Institutes of Health in facilities accredited by the American Association for the Accreditation of Laboratory Animal Care.
Production and characterization of IGFBP-5-deficient mice
The procedure to produce the IGFBP-5-deficient mice was previously described (29). Screening of a 129ReJ genomic library with a rat IGFBP-5 cDNA probe identified several genomic clones containing the mouse IGFBP-5 gene. To produce the targeting vector, a 9-kb EcoRI/SalI fragment containing part of intron 1 up to the 5' region of exon 4 was cloned between neo and HSV-TK gene of the knockout (KO) vector (see Fig. 1
) and then another 1.3-kb PvuII/EcoRV fragment was cloned 3' of the neo sequence of the KO vector. Introduction of this targeting construct into CCE embryonic stem cells followed by the genomic Southern screening of DNA identified three targeted lines in which the coding region of exon 1 (about 385 bp), including the translation start site and all N-terminal sequences that may have biological activity (30), had been replaced by the neomycin resistance cassette that introduced a new EcoR1 site. ES cells from one targeted line were injected into C57BL/6J blastocysts and transferred into pseudopregnant females to generate germline-transmitting chimeras. Male chimeras were bred with C57BL/6J females to obtain mice carrying the IGFBP-5 mutation. IGFBP-5 heterozygous offspring were bred to obtain IGFBP-5-deficient mice and wild-type control littermates used for all subsequent studies.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1. Strategy used to produce IGFBP-5 KO mice. A, Part of exon1 that included the IGFBP-5 translation start site was replaced by the neomycin gene; this substitution introduced a new EcoRI site that was used to distinguish the 4-kb wild-type (WT) and 2-kb mutant alleles. B, Southern blot of EcoRI-digested DNA from ES clones. +/+ cells show a single 4-kb wild-type fragment, whereas +/ cells show a 4-kb wild-type fragment and 2-kb mutant fragment. C, Southern blot of DNA from offspring from IGFBP5(+/) mating. +/+ mice exhibit a single 4-kb fragment, +/mice exhibit both a 4-kb wild-type fragment and a 2-kb mutant fragment, and / mice exhibit a single 2-kb fragment. D, Analysis of WT and IGFBP-5 mutant DNA. Left panel, Northern blot of adult total RNA extracted from the kidney shows that the WT IGFBP-5 mRNA band is approximately 6 kb. RNA samples from four wild-type (+/+) and four homozygote (/) mutant mice show that IGFBP-5/ mice completely lack any hybridizing sequences. Right panel, IGFBP-5 mRNA was also absent from total RNA extracted from kidney (K), brain (B), heart (H), and liver (L) of IGFBP-5 KO mice (n = 3) after RT-PCR.
|
|
Southern genotyping
Mouse tail tip DNA was digested with EcoRI, run on 0.7% agarose gels and transferred to Hybond (Amersham Pharmacia, Arlington Heights, IL). Membranes were prehybridized for 1 h at 65 C in Rapid Hyb and then hybridized overnight at 65 C in the same solution containing 32P-labeled probe derived from screening fragment shown in Fig. 1
. Membranes were washed at 68 C in 1x saline sodium citrate (SSC)/0.1% sodium dodecyl sulfate three times for 1.5 h and then exposed to film. Both a wild-type 4-kb fragment and a mutant 2-kb fragment were observed in EcoRI-digested DNA from IGFBP-5 heterozygous mice (see Fig. 1
).
RT-PCR analyses
Total RNA was purified from key tissues (kidney, brain, heart, and liver) (n = 3 per genotype) by using the RNeasy Midi protocol (QIAGEN, Valencia, CA) and analyzed by RT-PCR. The primers were chosen based the sequence of exon 1 from the moue IGFBP-5 gene. The 5' primer sequence was GCTCGCCGTAGCTCTTTTC, 3' primer sequence was GGTTCTTTCGTGCACTGTGA, and the expected amplified fragment is 261 bp in length.
Measurement of postnatal growth and organ size
Litters from IGFBP-5(+/) mating were analyzed daily from postnatal d 0 (day of birth) until 30 d and then 2 times per week for another month. Postnatal litters were earmarked, tail clipped for genotyping, and weights of individuals correlated with genotypes from the Southern blotting of tail DNA. Then the different organs and fat pad were collect from adult mice and analyzed based on the genotype.
Western ligand blotting and Western blotting
One to three microliters serum from each animal were run on 1216% polyacrylamide gels using either the Mini-Protean II or the Protean IIxi system (Bio-Rad Laboratories, Inc., Richmond, CA). Samples were electrophoresed and run through 5- to 6-cm gels at 85 V for approximately 3 h. Proteins were transferred to a polyvinylidene fluoride nylon membrane (Millipore Corp., Bedford, MA), which provided a signal intensity equivalent to that observed after transfer to nitrocellulose. Membranes were preblocked with 1% BSA in Tris-buffered saline (TBS) containing 3% Nonidet P-40 and 0.1% Tween 20 before overnight incubation with 400,000 cpm of 125I-IGF-I at 4 C or incubation with IGFBP-2 Ab (Upstate, Temecula, CA). After sequential washes in TBS containing 0.1% Tween 20 and TBS alone, ligand blots were exposed to XAR-5 film (Kodak, Rochester, NY) for varying durations ranging from 1 d to 3 wk; Western blots were visualized using the Western lighting chemiluminescence kit (PerkinElmer Life Science, Shelton, CT).
Circulating IGF-I concentrations
Mice were fasted for 16 h (17000900 h) and whole venous blood was obtained from the tail vein in EDTA-containing tubes and centrifuged. Total IGF-I levels were measured using a RIA rat IGF-I kit (Diagnostic Systems Laboratories, Inc., Webster, TX).
In situ hybridization
In situ hybridizations were performed essentially as described elsewhere (11, 31). Briefly, fresh frozen cryostat sections were mounted onto 3-aminopropyltriethoxysilane-coated microscope slides and stored at 80 C until use. Sections were fixed in 4% paraformaldehyde in PBS, dehydrated in ethanol series, acetylated in 0.25% acetic anhydride/50 mM triethanolamine, washed in 0.2x SSC, dehydrated in ethanol series, and prehybridized at room temperature. Then sections were hybridized overnight at 50 C with 2 x 104 cpm/µl 35S-labeled antisense and sense RNA probes, washed in 50% formamide/10 mM dithiothreitol/1x SSC, RNase treated in 100 µg/ml RNase A, washed in 0.5x SSC, dehydrated, and subjected to autoradiography.
35S-labeled antisense RNA probes were transcribed using SP6, T7, or T3 RNA polymerases in the presence of 35S-uridine 5-triphosphate from linearized plasmids pRBP1501 (rat BP1: nt 486892) (32), pG32-11 (rat BP2: nt 502-1087) (33), pRBP3-AR (rat BP3: nt 163861) (34), pRBP4-SH (rat BP4: nt 435878) (35), pGEM3Z/mBP5, 23 (mouse BP5: nt 512988) (9), pRBP6-PP (rat: BP6 nt 229475) (36), and pRIGF-II-BP (rat IGF-II, 551 nt BamH1/Pst-1 fragment) (37). The sense RNA probes were transcribed using T3 or T7 RNA polymerases to produce the reversed sequence using the same plasmid templates.
Whole-mount staining and quantification
The no. 4 inguinal mammary glands were removed and placed in tissue cassettes between filter paper and sponges (Whatman, Middlesex, UK) and fixed overnight in 3:1 100% EtOH-glacial acetic acid. The glands were washed three times in acetone for 1 h, 30 min in 100% EtOH and 95% EtOH, and subsequently stained overnight in hematoxylin [0.13 g FeCL3, 13.5ml dH2O, 1.74 ml stock hematoxylin, 200 ml 95% ethanol (pH to 1.25) with concentrated HCl]. After staining, the cassettes were rinsed with tap water, and the glands were then dehydrated with acidic 50% ethanol two to three times for 1 h each. Thirty-minute washes were then performed with 70 and 95% ethanol, following by 100% ethanol. Glands were placed in xylene for 20 min, removed from cassettes, coverslipped, and mounted with cytoseal. The terminal or lateral buds, defined as the bulb structure at the ends of all ductal branches, and lateral side branches, defined as the lateral branches with or without terminal buds, were assessed in a 1 mm2 region of the distal portion of the mammary gland whole mount. The quantification of terminal or lateral buds and lateral side branches was performed by counting the numbers of club-shaped structures and intersecting branches in four random areas (4 mm2 total) for each mammary inguinal whole-mount preparation.
Hormonal control in mammary gland development
Four-week-old female mice from both wild-type and IGFBP-5-deficient mice (n = 6 per group) were ovariectomized and allowed to recover for 3 wk. Ovariectomized mice were then given daily ip injections of 17 ß-estradiol benzoate (1 µg) and progesterone (1 mg) in 50 µl sesame oil (all reagents were from Sigma, St. Louis, MO). After 21 d, mice were killed and the inguinal no. 4 mammary glands were collected and fixed in 4% paraformaldehyde overnight for further whole-mount analysis as above.
Induction of involution and assessment of apoptosis
After pregnant wild-type and IGFBP-5 KO mice delivered their pups, the litter sizes were normalized to six to nine pups per litter. After full lactation was established (10 d of nursing), pups were removed to initiate involution. The glands were then harvested at 0, 3, 6, and 10 d after forced weaning.
Gland morphology during involution was analyzed after hematoxylin-eosin (H/E) staining. The area occupied by adipocytes, defined as groups of unstained (white) cells, was scored from H/E-stained slides. Under x100 magnification, these areas were outlined and the areas were calculated as a percentage of the total area of the field of view. The average of two representative fields was used for each section. Terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end labeling (TUNEL) staining was carried out on formalin-fixed, paraffin-embedded sections with the TACS TdT DAB in situ apoptosis detection kit (R&D, Minneapolis, MN) according to the manufacturers instructions. A minimum of 500 cells were scored per section, from two to three randomly chosen fields with x400 magnification. The TUNEL-positive cells were scored and calculated as a percentage of the total cell count.
Statistical analyses
For comparison between two groups, the statistical analyses were performed using a Students t test with P < 0.05 (*) and P < 0.01 (**).
 |
Results
|
|---|
Production and characterization of IGFBP-5-deficient mice
To produce a null mutation of the IGFBP-5 gene by homologous recombination, we deleted most of the 3' region of exon 1 including the translation start site (Fig. 1A
), introduced this targeting vector into ES cells, and identified the targeted ES clones by Southern blot analysis (Fig. 1B
). Then the targeted ES cells were used to generate chimeric males, which carried the mutation through the germ line. Mice heterozygous for the mutant gene were mated, offspring were genotyped (Fig. 1C
), and subsequently the absence of IGFBP-5 mRNA was confirmed by Northern blot analysis and RT-PCR (Fig. 1D
).
Normal growth and body composition in IGFBP-5-deficient mice
The successful disruption of the IGFBP-5 locus, combined with the observation that IGFBP-5 mRNA was eliminated, enabled us to determine the consequence of IGFBP-5 deficiency during mouse development. Mating of IGFBP-5 heterozygous mice generated neonatal mice of all genotypes in the normal Mendelian ratios (26%, +/+; 49%, +/; 25%, /), indicating the absence of embryonic lethality. To determine whether the absence of IGFBP-5 resulted in altered growth, mice from multiple heterozygote crosses were weighed from the birthday through postnatal d 42. Both male and female body weights of wild-type, IGFBP-5 mutant, and heterozygous mice were indistinguishable during this period, demonstrating that postnatal growth was not affected by the IGFBP-5 mutation (Fig. 2A
). Moreover, different organs including brain, heart, lung, spleen, kidney, and testis as well as fat pads were collected from adult wild-type and mutant mice. There is no difference in the weight of fat pads and most organs except for lung, which exhibited a small but significant increase in the IGFBP-5 null mice (Fig. 2B
). The skeletal muscle and olfactory bulb from both adult wild-type and IGFBP-5 KO mice, in which IGFBP-5 has a high expression during prenatal development (11), were histologically stained and exhibited no difference in morphology as well (Fig. 2C
).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 2. Body weight and body composition of IGFBP-5 KO mice. A, Growth curves of mice from IGFBP5(+/) heterozygous matings. There is no difference in body weight among wild-type, IGFBP-5 heterozygous, and homozygous mice of either gender. B, Organ weight analysis. The IGFBP-5 KO mice have fat pad and organ weights for brain, heart, spleen, kidney, and testis that are unchanged from wild-type. However, the lungs in IGFBP-5 KO mice are slightly, but significantly, heavier than those of wild-type mice (*, P < 0.05). C, Histologically stained sections of skeletal muscle and olfactory bulb from both wild-type and IGFBP-5 KO mice (n = 3 per group) exhibit similar morphologies.
|
|
Increased IGFBP-3 levels and normal total circulating IGF-I levels in IGFBP-5-deficient mice
IGFBP-5 mutant mice were viable and fertile, which allowed us to assess the effect of the mutation on IGFBP-5 expression at both pre- and postnatal stages. IGFBP-5 wild-type, heterozygous, and homozygous embryos were coembedded, and the expression patterns of the IGFBP genes at embryonic d 14.5 were explored using in situ hybridization. As shown in Fig. 3A
, IGFBP-5 mRNA expression was not detectable in IGFBP-5/ embryos at embryonic d 14.5, demonstrating that we had successfully disrupted the IGFBP-5 gene. We also determined that expression patterns of the other IGFBP genes, as shown in Fig. 3A
, were not significantly altered in IGFBP-5/ embryos at embryonic d 14.5.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3. Analysis of IGFBP expression and circulating IGF-I levels in IGFBP-5 KO mice. A, In situ hybridization analysis. IGFBP-5 mRNA expression is not detectable in IGFBP-5/ embryos at embryonic d (e) 14.5 demonstrating successful disruption of the IGFBP-5 gene, whereas other IGFBP genes (IGFBP-1 to -4) do not exhibit significant changes in expression patterns or levels in IGFBP-5/ embryos at embryonic d 14.5. B and C, The deletion of IGFBP-5 was confirmed in Western ligand blots of serum from adult mice (n = 5/group) because the intensity of the IGFBP-1, -2, and -5 regions is diminished, whereas there is no significant change in IGFBP-2 bands in IGFBP-5 KO mice from Western blotting (representative n = 5/group). In addition, the intensity of IGFBP-3 band was significantly increased (*, P < 0.05) in serum from IGFBP-5 homozygous mice, suggesting that IGFBP-3 is potentially compensating for loss of IGFBP-5. D, The IGFBP-5 KO mice exhibited normal circulating IGF-I levels, compared with wild-type (WT) mice.
|
|
To test whether the loss of IGFBP-5 was accompanied by compensatory changes in circulatory IGFBPs, we analyzed the IGFBP profiles in serum from adult IGFBP-5 null and wild-type mice by Western ligand blotting. IGFBP-4 levels were unchanged (Fig. 3
, B and C), which allowed relative changes in other regions of the blot to be assessed. There was a significant increase in the IGFBP-3 region, indicating that IGFBP-3 is likely up-regulated to compensate for the loss of IGFBP-5. There was also a significant decrease in IGFBP-1/2/5 mixture band (Fig. 3
, B and C). To further explore this decrease, IGFBP-2 was measured using Western blotting, and no significant change was found in IGFBP-5 KO mice (Fig. 3B
), although at present it is not known whether a decrease in IGFBP-1, in addition to the demonstrated complete loss of IGFBP-5, also contributes to this decrease.
IGFBP-5 KO mice exhibited normal circulating IGF-I levels (408 ± 35 ng/ml), compared with wild-type mice (407 ± 40 ng/ml) (Fig. 3D
), suggesting that IGFBP-5 is not indispensable for stabilization of IGF-I.
Normal development in mammary gland in virgin IGFBP-5-deficient mice
The mouse mammary gland undergoes a specific pattern of morphogenesis and differentiation during postnatal development. Previous studies indicate that IGFBP-5 may be involved in the development of the mammary gland and branching morphogenesis (26). Therefore, the morphology of IGFBP-5 KO and wild-type mammary glands were assessed. Whole-mount staining of 5-wk-old, 4-month-old, and 8-month-old virgin mouse mammary glands showed that, under normal circumstances, the overall organization of the ductal tree was normal in the absence of IGFBP-5 (Fig. 4
, AC). H/E-stained sections also showed no significant differences in either the ductal structures or their density (Fig. 4D
). In addition, the litter sizes from IGFBP-5 KO mice mating were normal, compared with wild type (Fig. 4D
), and all pups were normal in size, indicating adequate milk production. All those findings indicate that IGFBP-5 KO mice have normal mammary gland development and physiology.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 4. Mammary gland development in virgin adult IGFBP-5 KO mice. A, Whole-mount stained mammary glands from 5-wk-old, 4-month-old, and 8-month-old wild-type (WT) and IGFBP-5 KO mice (n = 3 for 5 wk old mice, n = 3 for 4 month old mice, n = 4 for 8 month old mice). B, The lateral/alveolar buds (AB) and side lateral branches (SLB) were assessed in whole mount-stained glands. IGFBP-5 KO mice exhibit normal unit number in both AB and SLB, compared with wild-type, mice at 5 wk old, 4 months old, and 8 months old (t test, P > 0.05). C, In H/E-stained sections, virgin adult IGFBP-5 mice exhibit normal ductal morphology, compared with that of wild-type mice (N 4 in each genotype). Moreover the adipocyte percentage is also similar in wild-type and IGFBP-5 KO mice (data not shown). D, The litter sizes from IGFBP-5 KO mice are similar to litter sizes from wild-type matings (t test, P = 0.12).
|
|
Enhanced alveolar bud formation in estradiol/progesterone-treated IGFBP-5-deficient mice
The ovarian steroids progesterone and estrogen have a central role in the growth and development of the mammary gland (38, 39) and together can increase breast cancer incidence (40, 41). Recently linkage has been suggested between ovarian steroid and IGF-1 effects. Thus, progesterone in combination with IGF-I stimulates ductal growth and branching, whereas estrogen with IGF-I promoted terminal end bud formation, side branching, and alveolar budding in puberty (42). Therefore, to accurately assess the effects, if any, of IGFBP-5 mutation on mammary gland morphology, we first wanted to provide controlled hormone stimulation to eliminate concerns about alterations in ovarian hormone production that might result directly or indirectly from systemic IGFBP-5 deletion. Second, we wanted to ensure that we were investigating mammary gland development in IGFBP-5 mutant mice under conditions when substantial stimulation of growth was being elicited with ovarian hormones, which might reveal a function for IGFBP-5 that could not be compensated by alterations in other IGFBPs. To achieve these goals, a standard ovariectomy/steroid replacement protocol was adopted. Four-week-old wild-type and mutant mice were ovariectomized, allowed to recover for 3 wk, and then injected daily with estradiol/progesterone for 3 wk to promote maximal ductal morphogenesis. Both whole-mount staining and H/E staining of mammary glands from IGFBP-5 null mice showed an increased number of alveolar buds but normal side branch numbers, compared with mammary glands from wild-type mice (Fig. 5
, A and B); such a change could result from augmented IGF-I effects due to the loss of IGFBP-5.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 5. Enhanced alveolar bud formation in hormone-controlled mammary gland development in virgin IGFBP-5 KO mice. A, Whole mount and H/E staining of mammary glands from estradiol/progesterone-treated wild-type (WT) and IGFBP-5 mice (n = 6 in each genotype). B, The alveolar buds (AB) and side lateral branches (SLB) were assessed in whole mount-stained glands. IGFBP-5 KO mice exhibit unchanged numbers of SLB (P > 0.05) but an increased number of AB (*, P < 0.05).
|
|
Delayed involution in mammary gland in IGFBP-5-deficient mice
The involution of mammary glands is triggered when the suckling stimulus is lost. Involution takes approximately 10 days in mice and can be divided into two phases (43, 44). In the first phase, which is reversible and lasts 48 h after weaning, mammary epithelial cells lose their differentiated function. In the second phase, the basement membranes and extracellular matrix in the mammary glands are degraded by proteases, leading to destruction of the lobular-alveolar structure in the mammary glands. As involution progresses, mammary epithelial cells are removed and adipocytes concomitantly reappear to occupy the mammary gland. Involution initiated by forced weaning is normally accompanied by a significant increase in IGFBP-5 levels (26).
To explore the effects of loss of IGFBP-5 in mammary gland involution, pups were removed from their mothers at d 10 of lactation, and the mammary tissue was collected at 10-d lactation (0-d involution), 3-d involution, 6-d involution, and 10-d involution. Figure 6A
shows H/E stained sections of wild-type and IGFBP-5 KO mammary glands during lactation and involution. At d 10 of lactation (0-d involution), the majority of the gland was composed of alveoli lined by epithelial cells that can secret milk, and there was no phenotypic difference between wild-type and IGFBP-5 KO mice. As involution progressed, the wild-type mice exhibited a cellular pattern in which most of the lobules and alveoli had collapsed between d 3 and 6. Thus, by d 10 of involution, the mammary gland was remodeled with only occasional epithelial cords and ducts remaining, surrounded by stroma and adipocytes. In contrast to wild-type mice, the IGFBP-5 KO mice demonstrated a markedly delayed involution process. For example, only a few alveoli in IGFBP-5 KO mice had began to collapse at d 3, whereas even at d 10 of involution, some alveoli remained intact (Fig. 6A
, arrows), and the gland resembled that of a d-6 wild-type mammary gland (Fig. 6A
, arrows). Thus, the extent of remodeling of the lobules and alveoli in IGFBP-5 KO mice was considerably slower than in the wild-type mice.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 6. Delayed mammary gland involution in IGFBP-5 KO mice. A, Delayed involution in IGFBP-5 KO mice. The upper row shows representative micrographs from d 0, 3, 6, and 10 mammary glands from wild-type (WT) mice, The lower row shows mammary glands from IGFBP-5 KO mice at listed time points. Five mice/genotype at each time point were analyzed. At d 10 of involution, the mammary glands from wild-type mice are mainly occupied by adipocytes with few alveoli and ducts remaining (arrows). In contrast, the mammary glands from IGFBP-5 KO mice still retain many alveoli and ducts (arrows) with the morphology generally similar to the morphology of d 6 wild-type mammary glands. B, Delayed reappearance of adipocytes in IGFBP-5 mammary glands. Each bar represents the mean of data (percent area occupied by adipocytes) collected from five mice. *, P < 0.05 (t test). C, Suppression of epithelial apoptosis in IGFBP-5 KO mammary glands. The upper row shows micrographs from d 0, 3, 6, and 10 mammary glands from wild-type mice, whereas the lower row shows mammary glands from IGFBP-5 KO mice. The arrows denote TUNEL-positive cells. D, The quantification of the TUNEL-positive cells is represented in each bar as the mean ± SEM determined from five mice of each genotype, with six sections analyzed from each mouse. *, P < 0.05 (t test).
|
|
To quantify the amount of involution that had occurred, the percentage of the gland area occupied by adipocytes was measured (Fig. 6B
). The area occupied by the adipocytes in the wild-type gland was greater than that of mutant mice at all time points and reached significance at d 6 and 10 (P < 0.05). At d 10 of involution, the mammary glands from IGFBP-5 null mice was composed of only about 44% adipocytes, compared with 63% in wild-type mice, reflecting the overall lack of morphological change seen in Fig. 6A
.
Because involution is characterized by apoptosis of the epithelial cells, we used the TUNEL assay to detect any difference in apoptotic patterns in remodeled alveoli from both wild-type and IGFBP-5 KO mice (Fig. 6
, C and D). Consistent with the morphology observed in H/E staining, significantly less apoptosis was apparent at d 6 of involution in the IGFBP-5 KO mice (14.4 ± 2.3 staining cells per 500 cells), compared with the wild-type mice (30.6 ± 6.4 staining cells per 500 cells, n = 5, P < 0.05). Moreover, a decrease in TUNEL staining was seen at d 10 of involution in wild-type mice when the majority of the gland had been remodeled, whereas TUNEL-positive cells from IGFBP-5 KO mice at d 10 still remained at the same levels as in d 6 glands, consistent with the delayed involution.
 |
Discussion
|
|---|
Previous studies indicated that IGFBP-5 may normally play a role in mouse growth (15) and mammary gland development (21) as well as other developmental processes. In contrast to expectations, we found that IGFBP-5 KO mice exhibit normal growth and body composition, which provides additional evidence for functional compensation in the IGFBP family. In addition, this study demonstrates a clear effect for IGFBP-5 in mammary gland involution in vivo, with deletion of IGFBP-5 leading to a delay in this process after forced removal of suckling pups.
Growth effects of IGFBP-5 are compensated by remaining IGFBPs in IGFBP-5-deficient mice
A major finding in this study was that deletion of IGFBP-5 has little effect on growth. IGFBP-5 KO mice are viable and fertile and can be distinguished from the wild-type mice only by a small but significant increase in lung weight. Previous studies show that IGFBP-5 is expressed by, and may play a role in, the differentiation of neural (6), osteoblast (7, 8), and myoblast (9, 10) cells. However, IGFBP-5 KO mice exhibited not only normal body growth and body composition but also normal morphology in several tissues including skeletal muscle and olfactory bulb. Thus, substantial developmental effects do not result from IGFBP-5 mutation, although more subtle effects may become apparent on an inbred genetic background. IGFBP-5 KO mice did exhibit a significant increase in IGFBP-3, which can substitute for IGFBP-5 in forming the ternary complex with IGF-I and acid-labile subunit (14). Such a finding is consistent with the possibility that loss of IGFBP-5 may be compensated by the remaining IGFBPs, especially IGFBP-3, which allows IGFBP-5 KO mice to maintain normal circulating IGF-I levels. It is also consistent with the modest phenotype observed in most single IGFBP KO mice to date (45). This possibility has received recent support from analysis of combinatorial IGFBP KOs (29).
The loss of IGFBP-5 delays mammary involution
In this study we were able to evaluate directly the effect of IGFBP-5 deletion on mammary gland development and involution. The loss of IGFBP-5 in mutant mice did not significantly alter normal mammary development, at least in outbred mice derived from heterozygous mating, and the glands appeared to be fully functional, as assessed by the normal alveolar morphology and normal nursing of pups by the mutant mice. However, because ovarian steroids play a central role in mammary gland development and because levels of these hormones are difficult to synchronize during puberty (28, 40, 41, 42), mammary gland morphology was assessed after wild-type and IGFBP-5 mutant mice were ovariectomized and treated with estradiol/progesterone. This paradigm was used both to minimize possible effects of genotypic variation in steroid levels due to systemic loss of IGFBP-5 as well as substantially stimulate mammary epithelial growth and reveal potential effects of IGFBP-5 mutation for which other IGFBPs might not compensate. After chronic hormone administration, the IGFBP-5-deficient mice exhibited enhanced alveolar bud formation in the mammary gland, compared with wild-type mice. This result is consistent with the current view that IGFBP-5 functions in this tissue to sequester and inactivate IGF-I, which acts as a cell proliferation factor in mouse development. Thus, the loss of IGFBP-5 may augment the effects of IGF-I on proliferation of epithelial cells in the mammary gland. Several recent studies suggest that IGF-I is involved in branching morphogenesis as well (46, 47). It is possible that IGFBP-5 normally regulates these actions of IGF-I, however, but that these functions can be compensated for by other IGFBPs under normal hormonal stimulation.
The most significant finding emerging from this study is the delayed mammary involution seen in IGFBP-5 KO mice after forced weaning. Involution of the mammary gland is characterized by a tissue remodeling process in which the milk-producing, lobuloalveolar structures regress. As a consequence, the ductal tree ultimately resembles that of the adult virgin state (48). Previous studies have indicated that IGFBP-5 may be involved in mammary gland involution. For example, IGFBP-5 synthesis in the mammary gland significantly increases within 24 h of litter removal, which is significantly before the time that the major structural changes and cell death occur (18, 21). IGFBP-5 levels in milk in this paradigm can exceed 50 mg/liter, which is several orders of magnitude greater than that of IGF-I (49), indicating that IGFBP-5 is capable of binding IGFs in mammary tissue, preventing interaction of IGF-I with its receptor and thereby decreasing IGF-mediated survival and instead promoting apoptosis (50). Overexpression of IGFBP-5 in the mammary gland accelerated this process (20). Conversely, prolactin suppresses IGFBP-5 expression and inhibits epithelial apoptosis (51).
Based on these data, loss of IGFBP-5 could be hypothesized to augment IGF-I-mediated cell survival by allowing more IGF-I to bind to the epithelial IGF-I receptors, even though circulating IGF-I levels are unchanged. Previous data support this hypothesis, at least indirectly. Conditional signal transducer and activator of transcription-3 KO in the mammary gland prevented the up-regulation of IGFBP-5 and also delayed mammary gland involution (52), although contributions from other signal transducer and activator of transcription-3 regulated genes could not be excluded. Our findings provide direct evidence for the role of IGFBP-5 in mammary involution. Intact alveoli still persisted in the IGFBP-5 KO mice 10 d after the forced removal of pups. Because IGF-I enhances mammary epithelial cell survival both in vitro (53) and in vivo (54, 55), we hypothesize that the deletion of IGFBP-5 facilitates the IGF-cell survival effect, thus resulting in delayed mammary involution.
There is also evidence that IGFBP-5 exhibits IGF-I-independent effects that may be involved in the extensive extracellular matrix remodeling that also occurs during mammary involution (27, 56) independent of direct effects on epithelia cell survival. Two potential IGF-independent actions of IGFBP-5 have been proposed. First, IGFBP-5 could interact directly with casein. This pathway would use the fact that IGFBP-5 protein has a consensus recognition site for the mammary casein kinase and can interact specifically with as2-casein, the dimeric form of this milk protein (18), to prevent additional interactions of this protein. Binding of the dimeric as2-casein to both plasminogen and tissue-type plasminogen activator (t-PA) normally enhances activity of t-PA and increases plasmin levels. Because plasmin plays an important role in cleaving a number of proenzymes, such as procollagenases, its inhibition would slow the degradation of extracellular matrix (ECM). The second pathway would use the finding that IGFBP-5 binds directly to the ECM protein plasminogen activator inhibitor-1 (57). This binding may inhibit the action of plasminogen activator inhibitor-1, which in turn influences the activation of plasminogen and the consequent breakdown of the ECM including laminin 5 and clusterin that takes place during tissue remodeling (27). Recent data indicate that IGFBP-5 may elicit the same effect by directly binding t-PA (58). Both of these hypotheses suggest an IGF-1-independent IGFBP-5 effect in inducing ECM remodeling during the mammary involution process. Thus, loss of IGFBP-5 may delay ECM remodeling in mammary gland, although more experiments are needed to establish the clear relationship between IGFBP-5 and the plasmin system and determine whether these relationships could also contribute to the apoptotic delay that accompanies the IGFBP-5 mutation.
 |
Footnotes
|
|---|
This work was supported by National Institutes of Health Grants NS-21970 (to J.E.P.) and DK-60612 (to T.L.W.) and a grant from the New Jersey Commission on Spinal Cord Research (to J.E.P.). T.P.C. was supported by National Institutes of Health Training Grant MH/AG 19957. The authors thank Nicholas Kenney for helpful discussions and David Flint for critical advice and encouragement during the earliest stages of this work.
Author Disclosure Summary: Y.N., B.H., A.G.P.S., T.P.C., M.-S.H., T.L.W., and J.E.P. all have nothing to declare.
First Published Online January 25, 2007
1 Y.N., B.H., and A.G.P.S. made equal contributions to the paper. 
Abbreviations: ECM, Extracellular matrix; H/E, hematoxylin-eosin; IGFBP, IGF-binding protein; KO, knockout; SSC, saline sodium citrate; TBS, Tris-buffered saline; t-PA, tissue-type plasminogen activator; TUNEL, terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end labeling.
Received January 11, 2006.
Accepted for publication January 16, 2007.
 |
References
|
|---|
- Cohick WS, Clemmons DR 1993 The insulin-like growth factors. Annu Rev Physiol 55:131153[Medline]
- Stewart CE, Rotwein P 1996 Growth, differentiation, and survival: multiple physiological functions for insulin-like growth factors. Physiol Rev 76:10051026[Abstract/Free Full Text]
- Lelbach A, Muzes G, Feher J 2005 The insulin-like growth factor system: IGFs, IGF-binding proteins and IGFBP-proteases. Acta Physiol Hung 92:97107[CrossRef][Medline]
- Firth SM, Baxter RC 2002 Cellular actions of the insulin-like growth factor binding proteins. Endocr Rev 23:824854[Abstract/Free Full Text]
- Cerro JA, Pintar JE 1997 Insulin-like growth factor binding protein gene expression in the pregnant rat uterus and placenta. Dev Biol 184:278295[CrossRef][Medline]
- Cheng HL, Shy M, Feldman EL 1999 Regulation of insulin-like growth factor-binding protein-5 expression during Schwann cell differentiation. Endocrinology 140:44784485[Abstract/Free Full Text]
- Thrailkill KM, Quarles LD, Nagase H, Suzuki K, Serra DM, Fowlkes JL 1995 Characterization of insulin-like growth factor-binding protein 5-degrading proteases produced throughout murine osteoblast differentiation. Endocrinology 136:35273533[Abstract]
- Thrailkill KM, Siddhanti SR, Fowlkes JL, Quarles LD 1995 Differentiation of MC3T3E1 osteoblasts is associated with temporal changes in the expression of IGF-I and IGFBPs. Bone 17:307313[Medline]
- James PL, Jones SB, Busby Jr WH, Clemmons DR, Rotwein P 1993 A highly conserved insulin-like growth factor-binding protein (IGFBP-5) is expressed during myoblast differentiation. J Biol Chem 268:2230522312[Abstract/Free Full Text]
- Xu Q, Li S, Zhao Y, Maures TJ, Yin P, Duan C 2004 Evidence that IGF binding protein-5 functions as a ligand-independent transcriptional regulator in vascular smooth muscle cells. Circ Res 94:E46E54
- Green BN, Jones SB, Streck RD, Wood TL, Rotwein P, Pintar JE 1994 Distinct expression patterns of insulin-like growth factor binding proteins 2 and 5 during fetal and postnatal development. Endocrinology 134:954962[Abstract/Free Full Text]
- Stenvers KL, Zimmermann EM, Gallagher M, Lund PK 1994 Expression of insulin-like growth factor binding protein-4 and -5 mRNAs in adult rat forebrain. J Comp Neurol 339:91105[CrossRef][Medline]
- Pera EM, Wessely O, Li SY, De Robertis EM 2001 Neural and head induction by insulin-like growth factor signals. Dev Cell 1:655665[CrossRef][Medline]
- Twigg SM, Baxter RC 1998 Insulin-like growth factor (IGF)-binding protein 5 forms an alternative ternary complex with IGFs and the acid-labile subunit. J Biol Chem 273:60746079[Abstract/Free Full Text]
- Salih DA, Tripathi G, Holding C, Szestak TA, Gonzalez MI, Carter EJ, Cobb LJ, Eisemann JE, Pell JM 2004 Insulin-like growth factor-binding protein 5 (Igfbp5) compromises survival, growth, muscle development, and fertility in mice. Proc Natl Acad Sci USA 101:43144319[Abstract/Free Full Text]
- Andress DL 1995 Heparin modulates the binding of insulin-like growth factor (IGF) binding protein-5 to a membrane protein in osteoblastic cells. J Biol Chem 270:2828928296[Abstract/Free Full Text]
- Butt AJ, Williams AC 2001 IGFBP-3 and apoptosisa license to kill. Apoptosis 6:199205[CrossRef][Medline]
- Tonner E, Barber MC, Travers MT, Logan A, Flint DJ 1997 Hormonal control of insulin-like growth factor-binding protein-5 production in the involuting mammary gland of the rat. Endocrinology 138:51015107[Abstract/Free Full Text]
- Tonner E, Allan G, Shkreta L, Webster J, Whitelaw CB, Flint DJ 2000 Insulin-like growth factor binding protein-5 (IGFBP-5) potentially regulates programmed cell death and plasminogen activation in the mammary gland. Adv Exp Med Biol 480:4553[Medline]
- Tonner E, Barber MC, Allan GJ, Beattie J, Webster J, Whitelaw CB, Flint DJ 2002 Insulin-like growth factor binding protein-5 (IGFBP-5) induces premature cell death in the mammary glands of transgenic mice. Development 129:45474557[Abstract/Free Full Text]
- Allar MA, Wood TL 2004 Expression of the insulin-like growth factor binding proteins during postnatal development of the murine mammary gland. Endocrinology 145:24672477[Abstract/Free Full Text]
- Wood TL, Richert MM, Stull MA, Allar MA 2000 The insulin-like growth factors (IGFs) and IGF binding proteins in postnatal development of murine mammary glands. J Mammary Gland Biol Neoplasia 5:3142[CrossRef][Medline]
- Hennighausen L, Robinson GW 1998 Think globally, act locally: the making of a mouse mammary gland. Genes Dev 12:449455[Free Full Text]
- Silberstein GB 2001 Postnatal mammary gland morphogenesis. Microsc Res Tech 52:155162[CrossRef][Medline]
- Hovey RC, Trott JF, Vonderhaar BK 2002 Establishing a framework for the functional mammary gland: from endocrinology to morphology. J Mammary Gland Biol Neoplasia 7:1738[CrossRef][Medline]
- Wood TL, Yee D 2000 Introduction: IGFs and IGFBPs in the normal mammary gland and in breast cancer. J Mammary Gland Biol Neoplasia 5:15[CrossRef][Medline]
- Flint DJ, Boutinaud M, Tonner E, Wilde CJ, Hurley W, Accorsi PA, Kolb AF, Whitelaw CB, Beattie J, Allan GJ 2005 Insulin-like growth factor binding proteins initiate cell death and extracellular matrix remodeling in the mammary gland. Domest Anim Endocrinol 29:274282[CrossRef][Medline]
- Tonner E, Allan GJ, Flint DJ 2000 Hormonal control of plasmin and tissue-type plasminogen activator activity in rat milk during involution of the mammary gland. J Endocrinol 167:265273[Abstract]
- Ning Y, Schuller AG, Bradshaw S, Rotwein P, Ludwig T, Frystyk J, Pintar JE 2006 Diminished growth and enhanced glucose metabolism in triple knockout mice containing mutations of insulin-like growth factor binding protein-3, -4, and -5. Mol Endocrinol 20:21732186[Abstract/Free Full Text]
- Kiepe D, Andress DL, Mohan S, Standker L, Ulinski T, Himmele R, Mehls O, Tonshoff B 2001 Intact IGF-binding protein-4 and -5 and their respective fragments isolated from chronic renal failure serum differentially modulate IGF-I actions in cultured growth plate chondrocytes. J Am Soc Nephrol 12:24002410[Abstract/Free Full Text]
- Hockfield S, Carlson S, Evans C, Levitt P, Pintar J, Silberstein L 1993 Selected methods for antibody and nucleic acid probes. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press
- Murphy LJ, Seneviratne C, Ballejo G, Croze F, Kennedy TG 1990 Identification and characterization of a rat decidual insulin-like growth factor-binding protein complementary DNA. Mol Endocrinol 4:329336[Abstract/Free Full Text]
- Brown AL, Chiariotti L, Orlowski CC, Mehlman T, Burgess WH, Ackerman EJ, Bruni CB, Rechler MM 1989 Nucleotide sequence and expression of a cDNA clone encoding a fetal rat binding protein for insulin-like growth factors. J Biol Chem 264:51485154[Abstract/Free Full Text]
- Shimasaki S, Koba A, Mercado M, Shimonaka M, Ling N 1989 Complementary DNA structure of the high molecular weight rat insulin-like growth factor binding protein (IGF-BP3) and tissue distribution of its mRNA. Biochem Biophys Res Commun 165:907912[CrossRef][Medline]
- Shimasaki S, Uchiyama F, Shimonaka M, Ling N 1990 Molecular cloning of the cDNAs encoding a novel insulin-like growth factor-binding protein from rat and human. Mol Endocrinol 4:14511458[Abstract/Free Full Text]
- Shimasaki S, Gao L, Shimonaka M, Ling N 1991 Isolation and molecular cloning of insulin-like growth factor-binding protein-6. Mol Endocrinol 5:938948[Abstract/Free Full Text]
- Whitfield HJ, Bruni CB, Frunzio R, Terrell JE, Nissley SP, Rechler MM 1984 Isolation of a cDNA clone encoding rat insulin-like growth factor-II precursor. Nature 312:277280[CrossRef][Medline]
- Russo IH, Russo J 1996 Mammary gland neoplasia in long-term rodent studies. Environ Health Perspect 104:938967[Medline]
- Medina D 2005 Mammary developmental fate and breast cancer risk. Endocr Relat Cancer 12:483495[Abstract/Free Full Text]
- Shapiro S 2003 Risks of estrogen plus progestin therapy: a sensitivity analysis of findings in the Womens Health Initiative randomized controlled trial. Climacteric 6:302310; discussion 310313[Medline]
- Stahlberg C, Pedersen AT, Lynge E, Andersen ZJ, Keiding N, Hundrup YA, Obel EB, Ottesen B 2004 Increased risk of breast cancer following different regimens of hormone replacement therapy frequently used in Europe. Int J Cancer 109:721727[CrossRef][Medline]
- Ruan W, Monaco ME, Kleinberg DL 2005 Progesterone stimulates mammary gland ductal morphogenesis by synergizing with and enhancing insulin-like growth factor-I action. Endocrinology 146:11701178[Abstract/Free Full Text]
- Lund LR, Romer J, Thomasset N, Solberg H, Pyke C, Bissell MJ, Dano K, Werb Z 1996 Two distinct phases of apoptosis in mammary gland involution: proteinase-independent and -dependent pathways. Development 122:181193[Abstract]
- Monks J, Geske FJ, Lehman L, Fadok VA 2002 Do inflammatory cells participate in mammary gland involution? J Mammary Gland Biol Neoplasia 7:163176[CrossRef][Medline]
- Wood TL, Rogler LE, Czick ME, Schuller AG, Pintar JE 2000 Selective alterations in organ sizes in mice with a targeted disruption of the insulin-like growth factor binding protein-2 gene. Mol Endocrinol 14:14721482[Abstract/Free Full Text]
- Loladze AV, Stull MA, Rowzee AM, Demarco J, Lantry 3rd JH, Rosen CJ, Leroith D, Wagner KU, Hennighausen L, Wood TL 2006 Epithelial-specific and stage-specific functions of insulin-like growth factor-I during postnatal mammary development. Endocrinology 147:54125423[Abstract/Free Full Text]
- Richards RG, Klotz DM, Walker MP, Diaugustine RP 2004 Mammary gland branching morphogenesis is diminished in mice with a deficiency of insulin-like growth factor-I (IGF-I), but not in mice with a liver-specific deletion of IGF-I. Endocrinology 145:31063110[Abstract/Free Full Text]
- Master SR, Chodosh LA 2004 Evolving views of involution. Breast Cancer Res 6:8992[CrossRef][Medline]
- Koldovsky O, Kong W, Philipps AF, Rao RK 1993 Studies on milk-borne insulin-like growth factor-1 and 2 (IGF-1 and IGF-2) and epidermal growth factor (EGF) in suckling rats. Endocr Regul 27:149153[Medline]
- Flint DJ, Tonner E, Allan GJ 2000 Insulin-like growth factor binding proteins: IGF-dependent and -independent effects in the mammary gland. J Mammary Gland Biol Neoplasia 5:6573[CrossRef][Medline]
- Allan GJ, Tonner E, Barber MC, Travers MT, Shand JH, Vernon RG, Kelly PA, Binart N, Flint DJ 2002 Growth hormone, acting in part through the insulin-like growth factor axis, rescues developmental, but not metabolic, activity in the mammary gland of mice expressing a single allele of the prolactin receptor. Endocrinology 143:43104319[Abstract/Free Full Text]
- Chapman RS, Lourenco PC, Tonner E, Flint DJ, Selbert S, Takeda K, Akira S, Clarke AR, Watson CJ 1999 Suppression of epithelial apoptosis and delayed mammary gland involution in mice with a conditional knockout of Stat3. Genes Dev 13:26042616[Abstract/Free Full Text]
- Farrelly N, Lee YJ, Oliver J, Dive C, Streuli CH 1999 Extracellular matrix regulates apoptosis in mammary epithelium through a control on insulin signaling. J Cell Biol 144:13371348[Abstract/Free Full Text]
- Neuenschwander S, Schwartz A, Wood TL, Roberts Jr CT, Hennighausen L, LeRoith D 1996 Involution of the lactating mammary gland is inhibited by the IGF system in a transgenic mouse model. J Clin Invest 97:22252232[Medline]
- Moorehead RA, Fata JE, Johnson MB, Khokha R 2001 Inhibition of mammary epithelial apoptosis and sustained phosphorylation of Akt/PKB in MMTV-IGF-II transgenic mice. Cell Death Differ 8:1629[CrossRef][Medline]
- Strange R, Li F, Saurer S, Burkhardt A, Friis RR 1992 Apoptotic cell death and tissue remodelling during mouse mammary gland involution. Development 115:4958[Abstract]
- Nam TJ, Busby Jr W, Clemmons DR 1997 Insulin-like growth factor binding protein-5 binds to plasminogen activator inhibitor-I. Endocrinology 138:29722978[Abstract/Free Full Text]
- Sorrell AM, Shand JH, Tonner E, Gamberoni M, Accorsi PA, Beattie J, Allan GJ, Flint DJ 2006 Insulin-like growth factor-binding protein-5 activates plasminogen by interaction with tissue plasminogen activator, independently of its ability to bind to plasminogen activator inhibitor-1, insulin-like growth factor-I, or heparin. J Biol Chem 281:1088310889[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
D. L. Kleinberg, T. L. Wood, P. A. Furth, and A. V. Lee
Growth Hormone and Insulin-Like Growth Factor-I in the Transition from Normal Mammary Development to Preneoplastic Mammary Lesions
Endocr. Rev.,
February 1, 2009;
30(1):
51 - 74.
[Abstract]
[Full Text]
[PDF]
|
 |
|