help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-1569
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gavi, S.
Right arrow Articles by Malbon, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gavi, S.
Right arrow Articles by Malbon, C. C.
Endocrinology Vol. 148, No. 6 2653-2662
Copyright © 2007 by The Endocrine Society

Insulin-Like Growth Factor-I Provokes Functional Antagonism and Internalization of ß1-Adrenergic Receptors

Shai Gavi, Dezhong Yin, Elena Shumay, Hsien-yu Wang and Craig C. Malbon

Departments of Pharmacology (S.G., D.Y., E.S., C.C.M.), Medicine (S.G.), and Physiology and Biophysics (H.-y.W.), Diabetes and Metabolic Diseases Research Center, School of Medicine-HSC, State University of New York at Stony Brook, Stony Brook, New York 11794

Address all correspondence and requests for reprints to: Dr. Shai Gavi, Department of Medicine, HSC, SUNY/Stony Brook, Stony Brook, New York 11794. E-mail: sgavi{at}notes.cc.sunysb.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Hormones that activate receptor tyrosine kinases have been shown to regulate G protein-coupled receptors, and herein we investigate the ability of IGF-I to regulate the ß1-adrenergic receptor. Treating Chinese hamster ovary cells in culture with IGF-I is shown to functionally antagonize the ability of expressed ß1-adrenergic receptors to accumulate intracellular cAMP in response to stimulation by the ß-adrenergic agonist Iso. The attenuation of ß1-adrenergic action was accompanied by internalization of ß1-adrenergic receptors in response to IGF-I. Inhibiting either phosphatidylinositol 3-kinase or the serine/threonine protein kinase Akt blocks the ability of IGF-I to antagonize and to internalize ß1-adrenergic receptors. Mutation of one potential Akt substrate site Ser412Ala, but not another Ser312Ala, of the ß1-adrenergic receptor abolishes the ability of IGF-I to functionally antagonize and to sequester the ß1-adrenergic receptor. We also tested the ability of IGF-I to regulate ß1-adrenergic receptors and their signaling in adult canine cardiac myocytes. IGF-I attenuates the ability of ß1-adrenergic receptors to accumulate intracellular cAMP in response to Iso and promotes internalization of ß1-adrenergic receptors in these cardiac myocytes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
G PROTEIN-COUPLED RECEPTORS (GPCRs) and tyrosine kinase receptors are well known to constitute two major pathways of cell signaling (1, 2). Recent investigations have discovered the existence of signaling crosstalk between GPCRs and tyrosine kinase receptors (3, 4, 5, 6, 7, 8). The subset of GPCRs that are regulated by tyrosine kinases includes the {alpha}1-adrenergic (8), the ß2-adrenergic (3, 7), the thrombin (5), and the endothelin (4) receptors. The crosstalk occurs at several levels and can occur at the most proximal point, i.e. receptor (tyrosine kinase)-to-receptor (GPCR). Crosstalk between insulin and ß2-adrenergic receptor (ß2AR), which can serve as a mechanism for functional antagonism of glucose homeostasis, is an example in which a GPCR is the substrate for a receptor tyrosine kinase (insulin receptor) (9, 10). Insulin stimulates phosphorylation of Y350/354 and Y364 tyrosine residues on the C terminus of the ß2AR. The Y350 residue is embedded in a sequence motif (Tyr-Gly-Asn-Gly) known to interact with a src homology 2 domain when phosphorylated. Upon phosphorylation, the src homology 2 domain can bind Grb2, p85 catalytic domain of phosphatidylinositol 3-kinase (PI3-kinase), and the GTPase dynamin, resulting in the functional antagonism of the ß2AR-mediated cAMP response and in the internalization of ß2ARs (11, 12). IGF-I also stimulates phosphorylation of tyrosine residues on the ß2AR, at sites distinct from those phosphorylated in response to insulin, namely Y132 and Y141 on the second intracellular loop of this GPCR (7). The phosphorylation of Y132 (YXXI) or Y141 (YXXL) on the ß2AR creates a Shc recognition site (7). The phosphorylation of these ß2AR sites in response to IGF-I is rapid, reaching a peak value within 2 min, declining after 5 min. The effect of IGF-I action on ß1AR function, in contrast, is not known. The possible effect of IGF-I treatment on the homologous, but pharmacologically distinct, ß1AR is a high-value target for investigation. We demonstrate that IGF-I functionally antagonizes and promotes internalization of ß1ARs.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids
The human ß1AR open reading frame (including a FLAG epitope on the C terminus) was generated by PCR using the plasmid pUC18-hß1AR as the template and a pair of primers designed with HindIII or BamHI linkers. The PCR product was digested with HindIII and BamHI and cloned into the unique HindIII/BamHI sites of GFP-N1 expression vector (Clontech, Mountain View, CA). The C terminus of the human ß1AR was fused to the N terminus of the green fluorescent protein (GFP). The fusion protein is fully functional (data not shown).

Cell culture
Chinese hamster ovary (CHO-K1) wild-type and transiently transfected cells were maintained in DMEM supplemented with 5% fetal bovine serum plus penicillin (60 µg/ml) and streptomycin (100 µg/ml) and grown in a humidified atmosphere supplied with 5% CO2 and 95% air at 37 C.

Expression of dominant-negative mutant of Akt
The triple-mutant (K179A/T308A/S473A) version of Akt was employed as a dominant-negative for Akt (DN-Akt). Expression of DN-Akt was established in whole-cell lysates using immunostaining of Western blots prepared from resolved SDS-PAGE gels. The blots were stained with anti-Akt antibodies (Santa Cruz Biotechnology, Santa Cruz, CA), as described previously (13).

Site-directed mutagenesis
Mutagenesis of Tyr 157 to phenylalanine (Y157F), Tyr 166 to phenylalanine (Y166F), Ser 312 to alanine (S312A), and Ser 412 to alanine (S412A) was performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA), according to the protocol provided by the commercial supplier. The sequences of the mutagenic primers were as follows: Y157F, GTCATTGCCCTGGACCGCTTCCTCGCCATC- ACCTCGCC; Y166F, GCCATCACCTCGCCCTTCCGCTTCCAGAG- CCTGCTGACGCGC; S312A, GCGGGTAAGCGGCGGCCCGCGCGCCTCGTGGCCCTACGC; S412A, GGAGACCGGCCGCGCGCGCCG- CGGGCTGTCTGGCCCGGCCC. The sequence of each mutated ß1AR was verified by direct DNA sequencing of the entire plasmid DNA.

Assay of intracellular accumulation of cAMP
CHO-K1 cells that are deficient in ß-adrenergic receptors were ideally suited for these studies. The CHO-K1 cells were transiently transfected with the expression vector harboring the human ß1AR and then seeded in 96-well plates for at least 24 h. On the day of experiment, cell culture medium was aspirated, and the cells were washed and then replenished with Krebs-Ringer phosphate buffer containing 10 µM RO-201724 (a cAMP phosphodiesterase inhibitor). The cells were treated with the indicated hormones in a total assay volume of 50 µl. The reaction was terminated by the addition of 50 µl of ice-cold 100% ethanol. The cAMP content was measured by the competitive binding assay, as described (9). To assay the effects of IGF-I alone, cells were incubated for 30 min with 100 nM IGF-I dissolved in a Krebs-Ringer phosphate buffer. To assay IGF-I functional antagonism, cells were pretreated for 5 min with IGF-I (100 nM) and then challenged with the ß-adrenergic agonist isoproterenol (Iso) (10 µM) for the indicated periods, in the continued presence of IGF-I. Each experimental determination was performed in triplicate, and data were obtained from at least three independent experiments performed on separate occasions. For the studies of the effects of various enzyme inhibitors, CHO cells were pretreated, before challenge with hormones, for 60 min without or with one of the following inhibitors: the PI3-kinase inhibitor LY294002 (20 µM), the Src inhibitor pyrazolopyrimidine-2 (PP2) (50 nM), or the MAPK/ERK kinase (MEK) inhibitor PD98059 (10 µM).

Assay of ß1AR expression and affinity
The expression of ß1AR was quantified by equilibrium radioligand binding. To establish the total cell complement of ß1AR, binding of the high-affinity, radioiodinated ß-adrenergic antagonist ligand iodocyanopindolol ([125I]CYP, 0.5 nM) to whole-cell CHO preparations was assayed. The incubation buffer contained 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, and 150 mM NaCl. In experiments designed to ascertain the effect, if any, of IGF-I on the affinity of the ß1AR for agonist, cells were incubated with [125I]CYP and without or with increasing concentrations of Iso to compete for radioligand binding. Cells were incubated for 90 min at 23 C. The incubation was terminated with ice-cold wash buffer and the cells washed twice rapidly and then collected on Whatman GF/C membranes by vacuum filtration. The amount of radioligand bound to the washed cell masses was quantified by the use of a {gamma}-counter. Nonspecific binding was determined by competition studies using the ß-adrenergic antagonist propranolol (10 µM). Radioligand binding that was insensitive to competition with propranolol (~10%) was considered nonspecific and was subtracted from the total binding to establish specific binding to ßAR.

Assay of ß1AR internalization
The expression of ß1AR on the cell surface of the CHO-K1 cells as well as loss of ß1AR from the cell surface (i.e. internalization) in response to either ß-adrenergic agonist or to IGF-I were quantified using the hydrophilic, cell-impermeable radiolabeled ß-adrenergic antagonist [3H]CGP-12177. Cells were treated for the indicated times with IGF-I (100 nM) or Iso (10 µM) at 37 C and then incubated at 4 C for 6 h with [3H]CGP-12177 (70 nM). The cells were rapidly washed free of unbound ligand and collected on Whatman GF/C membranes by vacuum filtration. The radioligand bound to the washed cell mass retained on the filter was quantified by liquid scintillation spectrometry. Nonspecific binding was defined as the radioligand binding insensitive to competition by the unlabeled ß-adrenergic antagonist propranolol (10 µM). For inhibitor studies, CHO-K1 cells were pretreated for 60 min without or with one of the following inhibitors: the PI3-kinase inhibitor LY294002 (20 µM), the Src inhibitor PP2 (50 nM), or the MEK inhibitor PD98059 (10 µM). Confocal microscopy of GFP-tagged ß1AR was performed as described previously (14).

Assay of intracellular accumulation of cAMP and ß1AR internalization in cardiac myocytes
Adult canine ventricular cells were isolated using a modified Langendorf procedure by perfusing a wedge of left ventricle through a coronary artery with 0.5 mg/ml collagenase (Worthington type 2) and 0.08 mg/ml protease (Sigma type XVI) for 12 to 15 min followed by tissue mincing (15). Cells were slowly replenished with calcium-containing buffers and then maintained overnight in M199 medium. For cAMP accumulation, cells were treated with Iso (10 µM) for 15 min. To assay IGF-I functional antagonism, cells were treated for 5 min with IGF-I (100 nM) and then challenged with Iso (10 µM) for 15 min. To determine the effect of IGF-I on the ß1AR only, cells were simultaneously treated with the ß2AR-specific antagonist ICI118551 (100 nM). Each experimental determination was performed in triplicate. The cAMP content was measured by the competitive binding assay, as described above. For internalization studies, cells were treated for 30 min with IGF-I (100 nM) or Iso (10 µM) at 37 C. To quantify the amount of ß1AR that is expressed on the cardiac myocyte cell surface at the basal state and after treatment with Iso or IGF-I, radioligand binding studies were performed in two steps. Initially, the expression of total ßAR 1AR and ß2AR) on the cell surface of the canine cardiac myocytes and its response to IGF-I (100 nM) or Iso (10 µM) was established using the radiolabeled nonselective ß-adrenergic antagonist [3H]CGP-12177 (70 nM). In parallel experiments using the same cells, the total expression of ß2AR on the cell surface of the canine cardiac myocytes and its response to IGF-I (100 nM) or Iso (10 µM) was established using the radiolabeled nonselective ß-adrenergic antagonist [3H]CGP-12177 (70 nM) in the presence of the high-affinity ß1-adrenergic-selective antagonist CGP20712A (5 µM). The expression of ß1AR on the cell surface at the basal condition was calculated as the difference between the expression of total ßAR and ß2AR on the cell surface before treatment. Similarly, the expression of ß1AR on the cell surface in response to treatment with IGF-I or Iso was calculated as the difference between the expression of total ßAR and the ß2AR on the cell surface after treatment. The degree of internalization of the ß1AR was then assessed by dividing the number of cell receptors on the cell surface in response to treatment by the number of cell receptors at the basal state before treatment. Neonatal rat cardiomyocytes were isolated (16) and generously provided by Dr. Barbara Rosati (State University of New York at Stony Brook). Cells were electroporated using Rat Cardiomyocyte-Neonatal Nucleofector Kit (Amaxa, Gaithersburg, MD), program G-09 and 4 µg of plasmid encoding human ß1AR-GFP according to the manufacturer’s protocol. Cells were then treated for 30 min with IGF-I (100 nM) or Iso (10 µM) at 37 C.

Statistical analysis
All data are displayed as mean values ± SEM for at least three separate experiments. Statistical significance (P value ≤ 0.05) is denoted with an asterisk and is derived from comparison of experimental data with the respective controls by ANOVA and Student’s t test for repeated measures.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IGF-I provokes functional antagonism of ß1AR signaling
The ability of the ß-adrenergic agonist Iso (10 µM) to stimulate cAMP accumulation in CHO-K1 cells was assayed in cells that were transiently transfected with an expression vector harboring the human ß1AR cDNA. The ß1AR-expressing cells display a robust increase in cAMP accumulation in response to stimulation with the ß-adrenergic agonist Iso (Fig. 1AGo). Wild-type CHO-K1 cells, essentially devoid of ß-adrenergic receptors, fail to accumulate cAMP in response to stimulation with Iso (data not shown) (17). Treating cells with IGF-I (100 nM) attenuates the Iso-stimulated cAMP response by 40–50% (Fig. 1AGo). IGF-I alone, in contrast, has no significant effect on the accumulation of intracellular cAMP.


Figure 1
View larger version (12K):
[in this window]
[in a new window]

 
FIG. 1. IGF-I treatment functionally antagonizes the Iso-stimulated cAMP response and promotes internalization of ß1AR. CHO-K1 cells transiently transfected with expression vector harboring the human ß1AR were treated with or without 100 nM IGF-I for 5 min and challenged with 10 µM Iso for 15 min. A, Cellular cAMP was measured as described in Materials and Methods. The data are mean values ± SEM representative of three separate experiments. *, P ≤ 0.05 for the difference between untreated cells and for Iso-treated cells in the absence (–) vs. the presence (+) of IGF-I. B, CHO-K1 cells were treated for with either 100 nM IGF-I or 10 µM Iso for 30 min at 37 C. The internalization of the receptor was measured by use of a hydrophilic, cell-impermeable radiolabeled ß-adrenergic antagonist, [3H]CGP-12177. The data are mean values ± SEM representative of at least three separate experiments. *, P ≤ 0.05 for the difference from untreated control. C, CHO-K1 cells stably transfected with expression vectors harboring the human ß1AR-GFP were untreated or treated for 30 min with either 100 nM IGF-I or 10 µM Iso for 30 min at 37 C. The cells were fixed, and the localization of these GFP-tagged ß1AR was examined by confocal microscopy. The results displayed are from a single experiment, representative of more than three independent experiments. White arrows highlight receptors on the cell membrane; yellow arrowheads highlight receptors that have been internalized. D, CHO-K1 cells transiently transfected with the human ß1AR were untreated (control) or treated for the indicated times with either IGF-I (100 nM) or Iso (10 µM) at 37 C and then incubated for 90 min at 23 C with the ß-adrenergic antagonist [125I]CYP. These data are mean values ± SEM representative of three separate experiments. *, P ≤ 0.05 for the difference between control and treated cells.

 
The functional antagonism of GPCRs by tyrosine kinase may be exerted by decreasing the cell surface complement of GPCR, by uncoupling the GPCR from its cognate G protein(s), and/or by stimulating a decrease in GPCR affinity for the agonist. We sought first to quantify the level of cell surface ß1AR, to test whether IGF-I induces ß1AR sequestration, based upon the well-known ability of insulin to internalize ß2AR (14). The high-affinity, radiolabeled antagonist [3H]CGP-12177 is unique because its hydrophilic nature confines it to binding only to those ßARs that are localized to the cell membrane and thereby accessible to the extracellular, aqueous environment occupied by the ligand. Using [3H]CGP-12177 binding to intact cells, the surface complement of ß1AR was quantified after treatment for 30 min in the absence or presence of either ß-adrenergic agonist (Iso, 10 µM) or with IGF-I (100 nM). The ß1AR-expressing cells treated with Iso displayed approximately 70% reduction in the cell surface complement of ß1AR (Fig. 1BGo), confirming earlier studies in HEK-293 cells (18). This agonist-induced sequestration of receptor is a hallmark of GPCRs (2). Of greater interest, the treatment of the cells with IGF-I (100 nM) also stimulates internalization of ß1ARs (Fig. 1BGo). The amount of ß1AR internalized in response to IGF-I is about half that of the level achieved by classical ß-agonist-induced desensitization/internalization.

We tested independently the results of the radioligand binding making use of confocal microscopy and a fusion protein composed of the ß1AR to which GFP was fused (Fig. 1CGo). Imaging details the localization of the ß1AR in untreated cells as well as in response to challenge with either ß-adrenergic agonist (Iso, 10 µM) or IGF-I (100 nM). In CHO-K1 cell lines expressing ß1AR-GFP, the bulk of the ß1ARs are localized in the cell membrane, providing an ideal model for visualizing receptor trafficking. Examples of ß1ARs localized to the cell membrane are highlighted on the images by white arrows (Fig. 1CGo). Treatment with Iso provokes marked agonist-induced sequestration of the ß1AR within 30 min, as shown earlier in HEK-293 cells (18). Examples of internalized ß1AR, confined to the cytoplasmic compartment, are highlighted on the images with yellow arrowheads. Of interest, treatment for 30 min with IGF-I (100 nM) provokes internalization of ß1AR (Fig. 1CGo). The results obtained from imaging of ß1AR-GFP in cells treated with IGF-I (Fig. 1CGo) agree well with the more quantitative radioligand binding data obtained with the membrane-impermeant CGP-12177 radioligand (Fig. 1BGo). Both of the assays demonstrate, for the first time, the ability of the IGF-I to induce sequestration of ß1AR.

Prolonged agonist-induced internalization of GPCRs is followed by down-regulation of the cellular complement of receptor (19). We wanted to determine whether chronic stimulation by IGF-I also provokes down-regulation of the ß1AR (Fig. 1DGo). Using high-affinity, ß-adrenergic antagonist [125I]CYP, the total complement of ß1AR was quantified in cells after a long-term (2–36 h) challenge with Iso (10 µM). The cells treated with Iso display an approximately 30% reduction in cellular complement of ß1AR, observed at 24 and at 36 h of chronic treatment with the ß-adrenergic agonist. Similar experiments were performed in cells treated chronically with IGF-I (100 nM). Unlike the classic down-regulation of ß1AR observed by chronic treatment with ß-adrenergic agonist, no significant down-regulation is observed in response to treating the cells with 100 nM IGF-I for up to 36 h (Fig. 1DGo). These observations suggest that internalized receptors may be targeted differentially by various stimuli to recycling vs. degradation, a variation of a hypothesis proposed recently for ß1AR (18).

IGF-I treatment does not alter the affinity of ß1AR for ß-adrenergic agonist
The decrease in the Iso-stimulated cAMP response of cells after treatment with IGF-I may reflect some change in the affinity of the ß1AR for agonist. The affinity of the ß1AR for the ß-agonist Iso was determined for naive (control) and IGF-I-treated (100 nM IGF-I for 30 min) cells, by radioligand competition studies using the ß-adrenergic antagonist [125I]CYP and increasing concentrations of Iso (Fig. 2Go). The EC50 for Iso under these conditions was approximately 1.5 x 10–7 M in IGF-I-treated cells and the same for the control cells (Fig. 2Go). These data demonstrate that the functional antagonism of ß1AR in response to IGF-I is not due to a decrease in affinity of the ß1AR for ß-adrenergic agonist.


Figure 2
View larger version (11K):
[in this window]
[in a new window]

 
FIG. 2. Effect of IGF-I on binding affinity of ß1AR for ß-adrenergic agonist. The affinity of the ß1AR for Iso was determined in the presence and absence of IGF-I treatment. ß1AR expression was quantified using the high-affinity, ß-adrenergic antagonist [125I]CYP in radioligand binding studies to whole-cell preparations of the transiently transfected cells. The data are mean values ± SEM representative of three separate experiments.

 
Functional antagonism and internalization of the ß1AR by IGF-I: time course
The time courses of IGF-I-induced functional antagonism and internalization of ß1AR were of interest and investigated. The time course of IGF-I functional antagonism of ß1AR-stimulated cAMP accumulation first was investigated. Cells were treated with IGF-I (100 nM) for 5 min before and then with Iso (10 µM) for 0–40 min (Fig. 3AGo). The decrease in cAMP accumulation was observed within 2.5 min, reaching a maximum at 5 min. This effect of IGF-I on ß1AR-mediated cAMP accumulation thereafter declined, providing only a 10–15% decrease in Iso-stimulated cAMP accumulation at 20–40 min of IGF-I (Fig. 3AGo). Within 20 min of IGF-I treatment (100 nM), substantial internalization of ß1AR was observed (Fig. 3BGo). The internalization of ß1AR provoked by IGF-I was progressive, reaching a maximum internalization within 40 min (Fig. 3AGo). IGF-I, like ß-adrenergic agonist, appears to functionally uncouple the ß1AR first (0–5 min), with receptor sequestration following later (20–40 min).


Figure 3
View larger version (9K):
[in this window]
[in a new window]

 
FIG. 3. Time course of IGF-I-mediated functional antagonism of cAMP accumulation and receptor internalization. A, CHO-K1 cells transiently transfected with expression vector harboring the human ß1AR were treated with or without 100 nM IGF-I for 5 min and challenged with 10 µM Iso from 0–40 min. cAMP levels were measured as described in Materials and Methods. The data are mean values ± SEM. The samples were measured in triplicates from two separate experiments. *, P ≤ 0.05 for the difference between time zero and subsequent times between cells treated with Iso in the absence (–) vs. the presence (+) of IGF-I. B, CHO-K1 cells transiently transfected with the human ß1AR were treated with 100 nM IGF-I for 0–60 min at 37 C. The internalization of the receptor was measured by [3H]CGP-12177 binding, as described in the legend to Fig. 1Go. These data are mean values ± SEM representative of three separate experiments. *, P ≤ 0.05 for the difference between time zero and subsequent times for radioligand binding to both IGF-I-treated and control cells.

 
PI3-kinase mediates functional antagonism and internalization of ß1AR by IGF-I
To probe the signaling elements employed in IGF-I-stimulated functional antagonism of ß1AR, enzyme inhibitors of well known pathways were employed. Members of the Src family of nonreceptor tyrosine kinases play essential roles in both ß-agonist-induced as well as in insulin-induced sequestration of the ß2AR (12). Therefore, we sought to evaluate the Src family kinase inhibitor PP2 for its effects, if any, on IGF-I functional antagonism of ß1ARs. ERK1/2 activation has been reported to block internalization of GPCRs, by inhibition of the activity of GPCR kinase 2 and of dynamin (12, 20, 21). The MEK inhibitor PD98059 (10 µM) was used to test whether inhibition of ERK1/2 blocks the ability of IGF-I to functionally antagonize ß1AR (Fig. 4AGo). The IGF-I receptor, like other receptor tyrosine kinases, also mediates many of its downstream effects by activation of PI3-kinase (20). We evaluated the effects of the PI3-kinase inhibitor LY294002 (20 µM) on functional antagonism of ß1AR by IGF-I. ß-Adrenergic agonist-stimulated cAMP accumulation was assayed in untreated cells and cells treated with individual enzyme inhibitors. Treating cells with either PP2 or PD98059 does not reverse the ability of IGF-I to antagonize ß1AR-mediated cAMP accumulation in response to Iso (10 µM) (Fig. 4AGo). Treating cells with PI3-kinase inhibitor LY294002, in contrast, abolishes the ability of IGF-I to functionally antagonize the Iso-stimulated cAMP response (Fig. 4AGo).


Figure 4
View larger version (9K):
[in this window]
[in a new window]

 
FIG. 4. IGF-I mediates functional antagonism and internalization of ß1AR via PI3-kinase. A, CHO-K1 cells transiently expressing human ß1AR were treated with or without 100 nM IGF-I for 5 min and challenged with 10 µM Iso for 15 min in the presence of either the PI3-kinase inhibitor LY294002 (LY; 20 µM), the Src inhibitor PP2 (50 nM), or the MEK inhibitor PD98059 (PD; 10 µM). cAMP accumulation was measured. The data are mean values ± SEM representative of three separate experiments. *, P ≤ 0.05 for the difference between cells treated with Iso in the absence (–) vs. the presence (+) of IGF-I. B, The surface complement of ß1AR in CHO-K1 cells transiently expressing the human ß1AR was quantified in either untreated cells or cells treated with IGF-I (100 nm) in the absence (–) or presence (+) of either the PI3K inhibitor LY294002 (LY; 20 µM), the Src inhibitor PP2 (50 nM), or the MEK inhibitor PD98059 (PD; 10 µM). The data are mean values ± SEM representative of three separate experiments. *, P ≤ 0.05 for the difference from untreated controls.

 
We probed the effects of these same inhibitors of IGF-I-stimulated sequestration of ß1AR (Fig. 4BGo). Addition of either the Src-family inhibitor or of the MEK inhibitor does not impair the ability of IGF-I to stimulate the sequestration of ß1AR (Fig. 4BGo). Inhibition of PI3-kinase with LY294002, in contrast, abolishes the IGF-I-provoked internalization of the ß1AR (Fig. 4BGo). The LY compound is shown to abolish IGF-I antagonism of Iso-stimulated ß1AR-mediated accumulation of intracellular cAMP (Fig. 4AGo) and IGF-I-stimulated sequestration of ß1AR. PI3-kinase appears to act downstream of the IGF-I receptor and upstream of the pathway controlling ß1AR coupling and trafficking.

Akt and antagonism of ß1AR by IGF-I
The serine/threonine protein kinase Akt (PKB) is activated in response to IGF-I (22), so we sought to investigate its role in the regulation of ß1AR by IGF-I. Although a chemical inhibitor of Akt is not available, Akt function can be abolished by expression of a dominant-negative version of Akt (DN-Akt). We made use of a DN-Akt that has triple alanine substitutions, K179A/T308A/S473A (13). Cells transiently transfected to express ß1AR were cotransfected with an empty expression vector or one harboring the triple-mutant DN-Akt. Expression of the DN-Akt was verified by SDS-PAGE and immunoblotting of whole-cell lysates (Fig. 5AGo), whereas expression of ß1AR was verified by radioligand binding analysis. Expression of DN-Akt alone does not alter the basal levels of cAMP accumulation (Fig. 5BGo). The Iso-stimulated cAMP response was partially reversed in cells expressing DN-Akt mutant (Fig. 5BGo). Inhibition of Iso-stimulated cAMP accumulation by IGF-I was attenuated in cells expressing DN-Akt (Fig. 5BGo). Treating the DN-Akt-expressing cells with IGF-I, in this case, no longer stimulated functional antagonism of Iso-stimulated cAMP accumulation (Fig. 5BGo). Because the results of these experiments were complicated by the effects of DN-Akt alone, we performed parallel experiments in which we measured cell surface ß1AR by radioligand binding (Fig. 5CGo). As before, treating cells with IGF-I resulted in internalization of ß1AR. Expression of DN-Akt abolished the ability of IGF-I to internalize the ß1AR (Fig. 5CGo). These results are consistent with a role of Akt in the ability of IGF-I to functionally antagonize and internalize the ß1AR. The basis for the ability of DN-Akt expression alone to suppress the cAMP response to Iso remains obscure.


Figure 5
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 5. Functional antagonism and internalization of ß1AR in response to IGF-I is mediated via Akt. A, CHO-K1 cells were cotransfected with the human ß1AR and either empty expression vector (EV) or expression vector harboring a DN-Akt (DN). IB, Immunoblotting analysis of Akt expression. B, Cells of the EV or DN-Akt groups were treated with (+) or without (–) 100 nM IGF-I for 5 min and challenged with 10 µM Iso for 15 min. cAMP accumulation was measured as described in Materials and Methods. The data are mean values ± SEM representative of three separate experiments. *, P ≤ 0.05 for the difference between cells treated with Iso in the absence vs. the presence of IGF-I. C, Sequestration of ß1AR was quantified in cells of the EV or DN-Akt groups after treatment without and with IGF-I (100 nM) for 30 min. The data are mean values ± SEM representative of three separate experiments. *, P ≤ 0.05 for the difference from untreated controls.

 
Mutation analysis of ß1AR and IGF-I-stimulated functional antagonism
To further investigate the potential role Akt on ß1AR action, we scanned the primary sequence of the ß1AR for putative sites of Akt-catalyzed phosphorylation. Two sites, Ser312 (S312) and Ser412 (S412), were identified in the ß1AR as potential substrate sites for Akt (23, 24). Serine-to-alanine mutation of Ser312 (S312A) of the ß1AR alone does not alter the ability of Iso to stimulate (Fig. 6AGo) or to internalize (Fig. 6BGo) the ß1AR, as noted previously in HEK-293 cells (18). Of interest, the S312A mutation also neither alters the ability of IGF-I to functionally antagonize the cAMP response mediated by ß1AR (Fig. 6AGo) nor alters the ability of IGF-I to internalize the ß1AR (Fig. 6BGo); i.e. the S312A ß1AR mutant functions as wild type in these assays.


Figure 6
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 6. IGF-I-mediated functional antagonism and internalization of the ß1AR by S412A. A, CHO-K1 cells transiently transfected with either the human wild-type ß1AR or a mutant version, S312A ß1AR or S412A ß1AR. Transfected cells were treated with or without 100 nM IGF-I for 5 min and challenged with 10 µM Iso for 15 min. cAMP accumulation was measured as described. The data are mean values ± SEM representative of three separate experiments. *, P ≤ 0.05 for the difference in Iso-stimulated cAMP accumulation in the absence (–) and presence (+) of IGF-I. B, The cell surface complement of ß1AR was quantified using [3H]CGP-12177. Cells were either untreated (–) or treated with 100 nM IGF-I or 10 µM Iso (+) for 30 min at 37 C. The data are mean values ± SEM representative of three separate experiments. *, P ≤ 0.05 for the difference between treated and untreated control values. C, Confocal analysis of the localization of GFP-tagged wild-type (WT ß1AR) and two mutant versions, S312A ß1AR and S412A ß1AR, that were individually expressed in cells and the cells treated without (basal) or with 100 nM IGF-I or 10 µM Iso for 30 min at 37 C. The data presented are representative images of three separate experiments. White arrows highlight receptor localized to the cell membrane; yellow arrowheads highlight receptor internalized in response to either Iso or IGF-I.

 
Mutation of Ser412 (S412A), in contrast, abolishes the ability of the ß1AR to be functionally antagonized (Fig. 6AGo) and sequestered (Fig. 6BGo) in response to IGF-I. Cells expressing the S412A ß1AR mutant display no response to IGF-I (100 nM); i.e. accumulation of cAMP in response to Iso is normal in the presence or the absence of IGF-I (Fig. 6AGo). Furthermore, IGF-I fails to stimulate sequestration of S412A ß1AR mutant, devoid of this Akt phosphorylation site, as determined by radioligand binding (Fig. 6BGo).

Confocal microscopy of cells expressing the GFP-tagged version of S412F ß1AR reveals essentially normal localization of the receptors to the cell membrane in untreated cells and little sequestration of ß1AR in response to IGF-I (Fig. 6CGo). The S412A ß1AR mutants do display normal sequestration, in contrast, to stimulation of the cells with the ß-agonist Iso (Fig. 6CGo). Thus, Iso provokes equivalent internalization of the GFP-tagged versions of the S312A mutant, the S412F mutant, and wild-type ß1AR. IGF-I treatment, in contrast, stimulates the internalization of the GFP-tagged wild-type ß1AR and S312A mutant ß1AR but not that of the S412A mutant ß1AR. The loss of the ß1AR S412 site for phosphorylation by Akt, much like the expression of the dominant-negative form of Akt, abolishes the ability of the ß1AR to be sequestered in response to IGF-I.

IGF-I also stimulates phosphorylation of tyrosyl residues Tyr132 and Tyr141 located in the second cytoplasmic loop of the ß2AR (7). The ß1AR, a homologue of the ß2AR, also displays two tyrosyl residues on the second intracellular loop, located on Tyr157 (YXXI) and Tyr166 (YXXL). Tyrosine-to-phenylalanine mutations of either or both Tyr157 (Y157F) and Tyr166 (Y166F) were created in the ß1AR and the mutant receptor expressed in CHO-K1 cells. These Tyr-to-Phe mutations yield no change in the ability of the ß1AR to be functionally antagonized or to be sequestered by treatment with IGF-I (data not shown).

IGF-I provokes functional antagonism and internalization of the ß1AR in cardiac myocytes
We investigated whether the ability of IGF-I to provoke functional antagonism and internalization of ß1AR observed in the Chinese hamster ovary cells in culture could be observed in acutely prepared, adult canine cardiac myocytes that express ß1AR and ß2AR. To assess the ß1AR-mediated cAMP response only, the accumulation of cAMP in response to Iso was assayed in the presence of the ß2-selective adrenergic antagonist ICI118551 (100 nM). In the presence of 100 nM ICI118551 and full suppression of ß2AR signaling, cardiac myocytes display a robust increase in cAMP accumulation in response to ß1-adrenergic stimulation with Iso (10 µM, Fig. 7AGo). IGF-I alone (100 nM) had no effect on the accumulation of intracellular cAMP. Treating the cardiac myocytes with IGF-I and Iso in combination, however, attenuates the ability of the ß-adrenergic agonist to stimulate accumulation of cAMP (Fig. 7AGo).


Figure 7
View larger version (16K):
[in this window]
[in a new window]

 
FIG. 7. IGF-I functionally antagonizes the Iso-stimulated cAMP response and internalizes the ß1AR in cardiac myocytes. A, Adult canine cardiac myocytes were isolated and then treated with or without 100 nM IGF-I for 5 min and further challenged with 10 µM Iso for 15 min in the presence of the ß2AR-specific antagonist ICI118551 (ICI, 100 nM) to block the signal from ß2AR. cAMP accumulation of cardiac myocytes was measured as described in the Materials and Methods. The data are mean values ± SEM, representative of three separate experiments. *, P ≤ 0.05 for the difference in Iso-stimulated cAMP accumulation in the absence (–) and presence (+) of IGF-I. B, Adult canine cardiac myocytes were isolated and then treated with either 100 nM IGF-I or 10 µM Iso for 30 min at 37 C. The internalization of the ß1AR was measured by use of a cell-impermeable, radiolabeled ß-adrenergic antagonist, [3H]CGP-12177, in the presence vs. absence of the ß1-adrenergic-selective receptor antagonist CGP20712A. The CGP20712A-sensitive radioligand binding represents cell surface ß1AR only. The data presented are the mean values ± SEM obtained from three separate experiments, each using different preparations of cardiac myocytes. *, P ≤ 0.05 for the difference between treated and untreated control values. C, Imaging of neonatal rat cardiac myocytes transfected (using nucleofection and electroporation) with an expression vector harboring the human GFP-tagged ß1AR-GFP. At 72 h post transfection, neonatal rat cardiac myocytes were untreated (basal) or treated for 30 min with either 100 nM IGF-I or 10 µM Iso for 30 min at 37 C. The cellular distribution of these GFP-tagged receptors was examined by confocal microscopy. White arrows highlight the GFP-tagged ß1AR localized to the cell membrane; yellow arrowheads highlight the GFP-tagged ß1AR internalized in response to either Iso or IGF-I. The images shown are representative of confocal analyses of cell preparations transfected on multiple, separate occasions.

 
We also investigated whether IGF-I provokes internalization of ß1AR in these cardiac myocytes. To make use of the [3H]CGP-12177 radioligand (which binds both ß1AR and ß2AR) for these measurements, we made use of a ß1-selective receptor antagonist, CGP20712A. The surface complement of ß1AR was quantified in the cardiac myocytes by quantification of the CGP20712A-sensitive complement of receptors. Iso provokes a 40% reduction in the cell surface complement of ß1AR (Fig. 7BGo), much like the response noted in the CHO cells. Treating the cardiac myocytes with IGF-I (100 nM) also provokes internalization of ß1AR (Fig. 7BGo). The percentage of the cellular complement of ß1AR internalized in response to IGF-I in the cardiac myocytes was less than that produced in response to the ß-agonist Iso.

We sought to test the effects of IGF-I (and Iso) on the localization of ß1AR by imaging of the adult canine cardiac myocytes. We were unable to obtain suitable expression of the GFP-tagged ß1AR and adequate viability of the cells (data not shown). As an alternative, we attempted to express the GFP-tagged ß1AR in neonatal rat cardiac myocytes using electroporation, and culturing the electroporated, viable cells overnight for confocal microscopy (Fig. 7CGo). In neonatal cardiac myocytes expressing GFP-tagged ß1AR, the bulk of the autofluorescent ß1AR was found to be localized to the cell membrane, as labeled on the images by white arrows (Fig. 7CGo). The localization of the ß1AR in response to challenge with either ß-adrenergic agonist (Iso, 10 µM) or IGF-I (100 nM) was studied next. Treatment with Iso provokes marked sequestration of the GFP-tagged ß1AR within 30 min; the loss of ß1AR from the cell membrane edges is obvious. The internalized ß1AR, confined to the cytoplasmic compartment, appear in patterns of diffuse smaller punctates. These punctates are labeled on the images with yellow arrowheads. IGF-I (100 nM) for 30 min likewise provoked the internalization of ß1AR. ß1ARs are lost from the cell membrane and now appear in the cytoplasmic compartment in response to IGF-I. Thus, the imaging results of GFP-tagged ß1AR expressed in neonatal rat cardiac myocytes agree well with the cAMP and ß1AR radioligand studies performed in adult canine cardiac myocytes, demonstrating the ability of the IGF-I to crosstalk to ß1AR.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We demonstrate, in the current work, the existence of crosstalk operating from IGF-I to the G protein-coupled ß1AR. Crosstalk between receptor tyrosine kinases and {alpha}1ARs (18, 25) as well as ß2ARs (2) has been reported earlier. We have learned a great deal about the regulation of ß1AR by protein kinase A (26), the role of A-kinase anchoring proteins in constituting receptosomes involved in recycling ß1AR (18, 27, 28, 29), and the structure/function of the interaction of ß1AR with agonist (30) as well as with G proteins (27). IGF-I is shown to functionally antagonize the ß1AR, suppressing ß1AR stimulation of cAMP accumulation. IGF-I also regulates the trafficking of ß1AR, stimulating internalization, much like the way classical agonist-induced sequestration operates for both ß1ARs and ß2ARs (2). Functional antagonism of ß2AR by insulin involves insulin receptor-catalyzed phosphorylation and internalization of the ß2AR as well as the ability of insulin to activate cAMP phosphodiesterase activity (2). For the functional antagonism of ß1AR by IGF-I shown herein, we included a phosphodiesterase inhibitor in the cAMP assays, so a role of phosphodiesterase, if any, would have been obscured.

The response of ß1AR signaling to IGF-I treatment is rapid and can be blocked by chemical inhibition of PI3-kinase, indicating the role of PI3-kinase in the signaling. The serine/threonine protein kinase Akt also is a critical element in the signaling downstream of IGF-I and insulin alike (22). The functional antagonism of the ß2AR by insulin, for example, requires Akt (13). Desensitization and trafficking of the {alpha}1AARs also involves interaction with and regulation by Akt (31). In the current work, we demonstrate that IGF-I regulation of the ß1AR is mediated by Akt. Residue Ser412 of the ß1AR was identified as one of two potential sites of Akt-catalyzed phosphorylation, the other being Ser312. The Ser312 residue has been shown to be critical to targeting the internalized ß1AR toward recycling (18) but appears to play little role in ß1AR regulation in response to IGF-I. Whereas the S312A ß1AR mutant displays normal IGF-I-induced functional antagonism, the S412A ß1AR mutant no longer responds to IGF-I treatment. Mutation of Ser412 (S412A), disrupting an Akt substrate site on the ß1AR, agrees well with the effects of expression of the DN-Akt mutant of ß1AR internalization by IGF-I, both implicating Akt as essential to IGF-I action on ß1AR.

Crosstalk exists between tyrosine kinase receptors and GPCRs (3, 4, 5, 6), discovered as operating in the regulation of the prototypic G protein-coupled ß2AR (9, 10, 11, 12) and later {alpha}1AR (32) and now is shown to operate for another prominent pair of GPCRs (ß1AR) and receptor tyrosine kinases (IGF-I receptor). The actions of agonist-induced desensitization and IGF-I-stimulated functional antagonism of ß1AR appear to achieve the same goals of uncoupling the ß2AR from its cognate G protein and later sequestering the receptor to the intracellular compartment. At least for the ß2AR, the mechanisms/pathways responsible for insulin-stimulated functional antagonism/internalization compared with ß-adrenergic agonist-induced desensitization/internalization are distinct (10, 14). IGF-I functionally antagonizes and later internalizes the ß1AR, a process with essential downstream roles of PI3-kinase and of Akt. These observations on PI3-kinase agree well with the ability of its inhibitor wortmannin to block IGF-I action on cardiac contractility (33).

Chronic heart failure is accompanied by alterations in ß-adrenergic receptor gene regulation, including that of ß1AR (34). Experimental studies demonstrate a functional and therapeutic effect of IGF-I on cardiovascular function, further supporting a possible link between IGF-I action and ß1AR function (13). We extend the work from CHO cells in culture to studies with acutely prepared primary cardiac myocytes, observing that IGF-I stimulates functional antagonism of ß1AR signaling. Although speculation, such a role of IGF-I on ß1AR signaling might explain, in part, changes in heart rate and contractility that occur with aging, a time in which there is a general decline in IGF-I levels (35). The beneficial effects of IGF-I administration on cardiac function may well reflect the ability of IGF-I to functionally antagonize ß1AR (35, 36, 37, 38, 39).


    Acknowledgments
 
We express our deep appreciation to Dr. Ira S. Cohen and to Ms. Joan Zuckerman of the Institute of Molecular Cardiology, Centers of Molecular Medicine, SUNY-Stony Brook for their advice, guidance, and generous supply of canine cardiac myocytes employed in these studies. Neonatal rat cardiomyocytes were generously provided by Dr. Barbara Rosati (Department of Physiology and Biophysics, Institute of Molecular Cardiology, Centers of Molecular Medicine, SUNY-Stony Brook). Additionally, we thank the following scientists for generous provision of reagents: Drs. Stephen Liggett (Department of Medicine, University of Cincinnati, Cincinnati, OH) for pUC18-hß1AR and Morrie Birnbaum (Department of Medicine, University of Pennsylvania, Philadelphia, PA) for the triple-mutant (K179A/T308A/S473A) DN-Akt.


    Footnotes
 
First Published Online March 15, 2007

Abbreviations: ß2AR, ß2-Adrenergic receptor; CHO, Chinese hamster ovary; [125I]CYP, iodocyanopindolol; DN-Akt, dominant-negative Akt; GFP, green fluorescent protein; GPCR, G protein-coupled receptor; Iso, isoproterenol; MEK, MAPK/ERK kinase; PI3-kinase, phosphatidylinositol 3-kinase; PP2, pyrazolopyrimidine-2.

This work was supported by United States Public Health Service Grant Award DK25410 from the National Institute of Diabetes, Kidney, and Digestive Diseases (NIDDK), National Institutes of Health (NIH) (to C.C.M.); Institutional National Research Service Award 5T32DK007521 from the NIDDK, NIH (to S.G.); and the Clinical Research Scholars Program, Center for Translational Research, School of Medicine, Health Sciences Center, State University of New York at Stony Brook (to S.G.).

Disclosure Statement: The authors have nothing to disclose.

Received November 27, 2006.

Accepted for publication March 6, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Krause DS, Van Etten RA 2005 Tyrosine kinases as targets for cancer therapy. N Engl J Med 353:172–187[Free Full Text]
  2. Morris AJ, Malbon CC 1999 Physiological regulation of G protein-linked signaling. Physiol Rev 79:1373–1430[Abstract/Free Full Text]
  3. Baltensperger K, Karoor V, Paul H, Ruoho A, Czech MP, Malbon CC 1996 The ß-adrenergic receptor is a substrate for the insulin receptor tyrosine kinase. J Biol Chem 271:1061–1064[Abstract/Free Full Text]
  4. Cazaubon SM, Ramos-Morales F, Fischer S, Schweighoffer F, Strosberg AD, Couraud PO 1994 Endothelin induces tyrosine phosphorylation and GRB2 association of Shc in astrocytes. J Biol Chem 269:24805–24809[Abstract/Free Full Text]
  5. Chen Y, Grall D, Salcini AE, Pelicci PG, Pouyssegur J, Van Obberghen-Schilling E 1996 Shc adaptor proteins are key transducers of mitogenic signaling mediated by the G protein-coupled thrombin receptor. EMBO J 15:1037–1044[Medline]
  6. Daub H, Wallasch C, Lankenau A, Herrlich A, Ullrich A 1997 Signal characteristics of G protein-transactivated EGF receptor. EMBO J 16:7032–7044[CrossRef][Medline]
  7. Karoor V, Malbon CC 1996 Insulin-like growth factor receptor-1 stimulates phosphorylation of the ß2-adrenergic receptor in vivo on sites distinct from those phosphorylated in response to insulin. J Biol Chem 271:29347–29352[Abstract/Free Full Text]
  8. del Carmen Medina L, Vazquez-Prado J, Garcia-Sainz JA 2000 Cross-talk between receptors with intrinsic tyrosine kinase activity and {alpha}1b-adrenoceptors. Biochem J 350(Pt 2):413–419
  9. Hadcock JR, Port JD, Gelman MS, Malbon CC 1992 Cross-talk between tyrosine kinase and G-protein-linked receptors. Phosphorylation of ß2-adrenergic receptors in response to insulin. J Biol Chem 267:26017–26022[Abstract/Free Full Text]
  10. Karoor V, Baltensperger K, Paul H, Czech MP, Malbon CC 1995 Phosphorylation of tyrosyl residues 350/354 of the ß-adrenergic receptor is obligatory for counterregulatory effects of insulin. J Biol Chem 270:25305–25308[Abstract/Free Full Text]
  11. Maudsley S, Pierce KL, Zamah AM, Miller WE, Ahn S, Daaka Y, Lefkowitz RJ, Luttrell LM 2000 The ß2-adrenergic receptor mediates extracellular signal-regulated kinase activation via assembly of a multi-receptor complex with the epidermal growth factor receptor. J Biol Chem 275:9572–9580[Abstract/Free Full Text]
  12. Pitcher JA, Tesmer JJ, Freeman JL, Capel WD, Stone WC, Lefkowitz RJ 1999 Feedback inhibition of G protein-coupled receptor kinase 2 (GRK2) activity by extracellular signal-regulated kinases. J Biol Chem 274:34531–34534[Abstract/Free Full Text]
  13. Doronin S, Shumay E, Wang HY, Malbon CC 2002 Akt mediates sequestration of the ß2-adrenergic receptor in response to insulin. J Biol Chem 277:15124–15131[Abstract/Free Full Text]
  14. Shumay E, Song X, Wang HY, Malbon CC 2002 pp60Src mediates insulin-stimulated sequestration of the ß2-adrenergic receptor: insulin stimulates pp60Src phosphorylation and activation. Mol Biol Cell 13:3943–3954[Abstract/Free Full Text]
  15. Zygmunt AC 1994 Intracellular calcium activates a chloride current in canine ventricular myocytes. Am J Physiol 267:H1984–H1995
  16. Protas L, Robinson RB 1999 Neuropeptide Y contributes to innervation-dependent increase in ICa,L via ventricular Y2 receptors. Am J Physiol 277:H940–H946
  17. George ST, Berrios M, Hadcock JR, Wang HY, Malbon CC 1988 Receptor density and cAMP accumulation: analysis in CHO cells exhibiting stable expression of a cDNA that encodes the ß2-adrenergic receptor. Biochem Biophys Res Commun 150:665–672[CrossRef][Medline]
  18. Gardner LA, Delos Santos NM, Matta SG, Whitt MA, Bahouth SW 2004 Role of the cyclic AMP-dependent protein kinase in homologous resensitization of the ß1-adrenergic receptor. J Biol Chem 279:21135–21143[Abstract/Free Full Text]
  19. Hadcock JR, Malbon CC 1993 Agonist regulation of gene expression of adrenergic receptors and G proteins. J Neurochem 60:1–9[CrossRef][Medline]
  20. Earnest S, Khokhlatchev A, Albanesi JP, Barylko B 1996 Phosphorylation of dynamin by ERK2 inhibits the dynamin-microtubule interaction. FEBS Lett 396:62–66[CrossRef][Medline]
  21. Eisinger DA, Schulz R 2004 Extracellular signal-regulated kinase/mitogen-activated protein kinases block internalization of {delta}-opioid receptors. J Pharmacol Exp Ther 309:776–785[Abstract/Free Full Text]
  22. Song G, Ouyang G, Bao S 2005 The activation of Akt/PKB signaling pathway and cell survival. J Cell Mol Med 9:59–71[Medline]
  23. Alessi DR, Caudwell FB, Andjelkovic M, Hemmings BA, Cohen P 1996 Molecular basis for the substrate specificity of protein kinase B: comparison with MAPKAP kinase-1 and p70 S6 kinase. FEBS Lett 399:333–338[CrossRef][Medline]
  24. Obata T, Yaffe MB, Leparc GG, Piro ET, Maegawa H, Kashiwagi A, Kikkawa R, Cantley LC 2000 Peptide and protein library screening defines optimal substrate motifs for AKT/PKB. J Biol Chem 275:36108–36115[Abstract/Free Full Text]
  25. Vazquez-Prado J, Casas-Gonzalez P, Garcia-Sainz JA 2003 G protein-coupled receptor cross-talk: pivotal roles of protein phosphorylation and protein-protein interactions. Cell Signal 15:549–557[CrossRef][Medline]
  26. Bahouth SW, Sowinski KM, Lima JJ 2001 Regulation of human ß1-adrenergic receptors and their mRNA in neuroepithelioma SK-N-MC cells: effects of agonist, forskolin, and protein kinase A. Biochem Pharmacol 62:1211–1220[CrossRef][Medline]
  27. Delos Santos NM, Gardner LA, White SW, Bahouth SW 2006 Characterization of the residues in helix 8 of the human ß1-adrenergic receptor that are involved in coupling the receptor to G proteins. J Biol Chem 281:12896–12907[Abstract/Free Full Text]
  28. Gardner LA, Naren AP, Bahouth SW 2006 Assembly of an SAP97-AKAP79-cAMP-dependent protein kinase scaffold at the type 1 PSD-95/DLG/ZO1 motif of the human ß1-adrenergic receptor generates a receptosome involved in receptor recycling and networking. J Biol Chem 282:5085–5099[CrossRef][Medline]
  29. Gardner LA, Tavalin SJ, Goehring AS, Scott JD, Bahouth SW 2006 AKAP79-mediated targeting of the cyclic AMP-dependent protein kinase to the ß1-adrenergic receptor promotes recycling and functional resensitization of the receptor. J Biol Chem 281:33537–33553[Abstract/Free Full Text]
  30. Zeitoun O, Santos NM, Gardner LA, White SW, Bahouth SW 2006 Mutagenesis within helix 6 of the human ß1-adrenergic receptor identifies lysine324 as a residue involved in imparting the high-affinity binding state of agonists. Mol Pharmacol 70:838–850[Abstract/Free Full Text]
  31. Alcantara-Hernandez R, Garcia-Sainz JA 2005 Okadaic acid increases the phosphorylation state of {alpha}1A-adrenoceptors and induces receptor desensitization. Eur J Pharmacol 525:18–23[CrossRef][Medline]
  32. Garcia-Sainz JA, Romero-Avila MT, Molina-Munoz T, Medina Ldel C 2004 Insulin induces {alpha}1B-adrenergic receptor phosphorylation and desensitization. Life Sci 75:1937–1947[CrossRef][Medline]
  33. Cittadini A, Ishiguro Y, Stromer H, Spindler M, Moses AC, Clark R, Douglas PS, Ingwall JS, Morgan JP 1998 Insulin-like growth factor-1 but not growth hormone augments mammalian myocardial contractility by sensitizing the myofilament to Ca2+ through a wortmannin-sensitive pathway: studies in rat and ferret isolated muscles. Circ Res 83:50–59[Abstract/Free Full Text]
  34. Port JD, Bristow MR 2001 Altered ß-adrenergic receptor gene regulation and signaling in chronic heart failure. J Mol Cell Cardiol 33:887–905[CrossRef][Medline]
  35. Khan AS, Sane DC, Wannenburg T, Sonntag WE 2002 Growth hormone, insulin-like growth factor-1 and the aging cardiovascular system. Cardiovasc Res 54:25–35[Abstract/Free Full Text]
  36. Friberg L, Werner S, Eggertsen G, Ahnve S 2000 Growth hormone and insulin-like growth factor-1 in acute myocardial infarction. Eur Heart J 21:1547–1554[Abstract/Free Full Text]
  37. Lembo G, Rockman HA, Hunter JJ, Steinmetz H, Koch WJ, Ma L, Prinz MP, Ross Jr J, Chien KR, Powell-Braxton L 1996 Elevated blood pressure and enhanced myocardial contractility in mice with severe IGF-1 deficiency. J Clin Invest 98:2648–2655[Medline]
  38. Omerovic E, Bollano E, Mobini R, Kujacic V, Madhu B, Soussi B, Fu M, Hjalmarson A, Waagstein F, Isgaard J 2000 Growth hormone improves bioenergetics and decreases catecholamines in postinfarct rat hearts. Endocrinology 141:4592–4599[Abstract/Free Full Text]
  39. Wannenburg T, Khan AS, Sane DC, Willingham MC, Faucette T, Sonntag WE 2001 Growth hormone reverses age-related cardiac myofilament dysfunction in rats. Am J Physiol Heart Circ Physiol 281:H915–H922




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gavi, S.
Right arrow Articles by Malbon, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gavi, S.
Right arrow Articles by Malbon, C. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals