| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Pharmacology (S.G., D.Y., E.S., C.C.M.), Medicine (S.G.), and Physiology and Biophysics (H.-y.W.), Diabetes and Metabolic Diseases Research Center, School of Medicine-HSC, State University of New York at Stony Brook, Stony Brook, New York 11794
Address all correspondence and requests for reprints to: Dr. Shai Gavi, Department of Medicine, HSC, SUNY/Stony Brook, Stony Brook, New York 11794. E-mail: sgavi{at}notes.cc.sunysb.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
1-adrenergic (8), the ß2-adrenergic (3, 7), the thrombin (5), and the endothelin (4) receptors. The crosstalk occurs at several levels and can occur at the most proximal point, i.e. receptor (tyrosine kinase)-to-receptor (GPCR). Crosstalk between insulin and ß2-adrenergic receptor (ß2AR), which can serve as a mechanism for functional antagonism of glucose homeostasis, is an example in which a GPCR is the substrate for a receptor tyrosine kinase (insulin receptor) (9, 10). Insulin stimulates phosphorylation of Y350/354 and Y364 tyrosine residues on the C terminus of the ß2AR. The Y350 residue is embedded in a sequence motif (Tyr-Gly-Asn-Gly) known to interact with a src homology 2 domain when phosphorylated. Upon phosphorylation, the src homology 2 domain can bind Grb2, p85 catalytic domain of phosphatidylinositol 3-kinase (PI3-kinase), and the GTPase dynamin, resulting in the functional antagonism of the ß2AR-mediated cAMP response and in the internalization of ß2ARs (11, 12). IGF-I also stimulates phosphorylation of tyrosine residues on the ß2AR, at sites distinct from those phosphorylated in response to insulin, namely Y132 and Y141 on the second intracellular loop of this GPCR (7). The phosphorylation of Y132 (YXXI) or Y141 (YXXL) on the ß2AR creates a Shc recognition site (7). The phosphorylation of these ß2AR sites in response to IGF-I is rapid, reaching a peak value within 2 min, declining after 5 min. The effect of IGF-I action on ß1AR function, in contrast, is not known. The possible effect of IGF-I treatment on the homologous, but pharmacologically distinct, ß1AR is a high-value target for investigation. We demonstrate that IGF-I functionally antagonizes and promotes internalization of ß1ARs. | Materials and Methods |
|---|
|
|
|---|
Cell culture
Chinese hamster ovary (CHO-K1) wild-type and transiently transfected cells were maintained in DMEM supplemented with 5% fetal bovine serum plus penicillin (60 µg/ml) and streptomycin (100 µg/ml) and grown in a humidified atmosphere supplied with 5% CO2 and 95% air at 37 C.
Expression of dominant-negative mutant of Akt
The triple-mutant (K179A/T308A/S473A) version of Akt was employed as a dominant-negative for Akt (DN-Akt). Expression of DN-Akt was established in whole-cell lysates using immunostaining of Western blots prepared from resolved SDS-PAGE gels. The blots were stained with anti-Akt antibodies (Santa Cruz Biotechnology, Santa Cruz, CA), as described previously (13).
Site-directed mutagenesis
Mutagenesis of Tyr 157 to phenylalanine (Y157F), Tyr 166 to phenylalanine (Y166F), Ser 312 to alanine (S312A), and Ser 412 to alanine (S412A) was performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA), according to the protocol provided by the commercial supplier. The sequences of the mutagenic primers were as follows: Y157F, GTCATTGCCCTGGACCGCTTCCTCGCCATC- ACCTCGCC; Y166F, GCCATCACCTCGCCCTTCCGCTTCCAGAG- CCTGCTGACGCGC; S312A, GCGGGTAAGCGGCGGCCCGCGCGCCTCGTGGCCCTACGC; S412A, GGAGACCGGCCGCGCGCGCCG- CGGGCTGTCTGGCCCGGCCC. The sequence of each mutated ß1AR was verified by direct DNA sequencing of the entire plasmid DNA.
Assay of intracellular accumulation of cAMP
CHO-K1 cells that are deficient in ß-adrenergic receptors were ideally suited for these studies. The CHO-K1 cells were transiently transfected with the expression vector harboring the human ß1AR and then seeded in 96-well plates for at least 24 h. On the day of experiment, cell culture medium was aspirated, and the cells were washed and then replenished with Krebs-Ringer phosphate buffer containing 10 µM RO-201724 (a cAMP phosphodiesterase inhibitor). The cells were treated with the indicated hormones in a total assay volume of 50 µl. The reaction was terminated by the addition of 50 µl of ice-cold 100% ethanol. The cAMP content was measured by the competitive binding assay, as described (9). To assay the effects of IGF-I alone, cells were incubated for 30 min with 100 nM IGF-I dissolved in a Krebs-Ringer phosphate buffer. To assay IGF-I functional antagonism, cells were pretreated for 5 min with IGF-I (100 nM) and then challenged with the ß-adrenergic agonist isoproterenol (Iso) (10 µM) for the indicated periods, in the continued presence of IGF-I. Each experimental determination was performed in triplicate, and data were obtained from at least three independent experiments performed on separate occasions. For the studies of the effects of various enzyme inhibitors, CHO cells were pretreated, before challenge with hormones, for 60 min without or with one of the following inhibitors: the PI3-kinase inhibitor LY294002 (20 µM), the Src inhibitor pyrazolopyrimidine-2 (PP2) (50 nM), or the MAPK/ERK kinase (MEK) inhibitor PD98059 (10 µM).
Assay of ß1AR expression and affinity
The expression of ß1AR was quantified by equilibrium radioligand binding. To establish the total cell complement of ß1AR, binding of the high-affinity, radioiodinated ß-adrenergic antagonist ligand iodocyanopindolol ([125I]CYP, 0.5 nM) to whole-cell CHO preparations was assayed. The incubation buffer contained 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, and 150 mM NaCl. In experiments designed to ascertain the effect, if any, of IGF-I on the affinity of the ß1AR for agonist, cells were incubated with [125I]CYP and without or with increasing concentrations of Iso to compete for radioligand binding. Cells were incubated for 90 min at 23 C. The incubation was terminated with ice-cold wash buffer and the cells washed twice rapidly and then collected on Whatman GF/C membranes by vacuum filtration. The amount of radioligand bound to the washed cell masses was quantified by the use of a
-counter. Nonspecific binding was determined by competition studies using the ß-adrenergic antagonist propranolol (10 µM). Radioligand binding that was insensitive to competition with propranolol (
10%) was considered nonspecific and was subtracted from the total binding to establish specific binding to ßAR.
Assay of ß1AR internalization
The expression of ß1AR on the cell surface of the CHO-K1 cells as well as loss of ß1AR from the cell surface (i.e. internalization) in response to either ß-adrenergic agonist or to IGF-I were quantified using the hydrophilic, cell-impermeable radiolabeled ß-adrenergic antagonist [3H]CGP-12177. Cells were treated for the indicated times with IGF-I (100 nM) or Iso (10 µM) at 37 C and then incubated at 4 C for 6 h with [3H]CGP-12177 (70 nM). The cells were rapidly washed free of unbound ligand and collected on Whatman GF/C membranes by vacuum filtration. The radioligand bound to the washed cell mass retained on the filter was quantified by liquid scintillation spectrometry. Nonspecific binding was defined as the radioligand binding insensitive to competition by the unlabeled ß-adrenergic antagonist propranolol (10 µM). For inhibitor studies, CHO-K1 cells were pretreated for 60 min without or with one of the following inhibitors: the PI3-kinase inhibitor LY294002 (20 µM), the Src inhibitor PP2 (50 nM), or the MEK inhibitor PD98059 (10 µM). Confocal microscopy of GFP-tagged ß1AR was performed as described previously (14).
Assay of intracellular accumulation of cAMP and ß1AR internalization in cardiac myocytes
Adult canine ventricular cells were isolated using a modified Langendorf procedure by perfusing a wedge of left ventricle through a coronary artery with 0.5 mg/ml collagenase (Worthington type 2) and 0.08 mg/ml protease (Sigma type XVI) for 12 to 15 min followed by tissue mincing (15). Cells were slowly replenished with calcium-containing buffers and then maintained overnight in M199 medium. For cAMP accumulation, cells were treated with Iso (10 µM) for 15 min. To assay IGF-I functional antagonism, cells were treated for 5 min with IGF-I (100 nM) and then challenged with Iso (10 µM) for 15 min. To determine the effect of IGF-I on the ß1AR only, cells were simultaneously treated with the ß2AR-specific antagonist ICI118551 (100 nM). Each experimental determination was performed in triplicate. The cAMP content was measured by the competitive binding assay, as described above. For internalization studies, cells were treated for 30 min with IGF-I (100 nM) or Iso (10 µM) at 37 C. To quantify the amount of ß1AR that is expressed on the cardiac myocyte cell surface at the basal state and after treatment with Iso or IGF-I, radioligand binding studies were performed in two steps. Initially, the expression of total ßAR (ß1AR and ß2AR) on the cell surface of the canine cardiac myocytes and its response to IGF-I (100 nM) or Iso (10 µM) was established using the radiolabeled nonselective ß-adrenergic antagonist [3H]CGP-12177 (70 nM). In parallel experiments using the same cells, the total expression of ß2AR on the cell surface of the canine cardiac myocytes and its response to IGF-I (100 nM) or Iso (10 µM) was established using the radiolabeled nonselective ß-adrenergic antagonist [3H]CGP-12177 (70 nM) in the presence of the high-affinity ß1-adrenergic-selective antagonist CGP20712A (5 µM). The expression of ß1AR on the cell surface at the basal condition was calculated as the difference between the expression of total ßAR and ß2AR on the cell surface before treatment. Similarly, the expression of ß1AR on the cell surface in response to treatment with IGF-I or Iso was calculated as the difference between the expression of total ßAR and the ß2AR on the cell surface after treatment. The degree of internalization of the ß1AR was then assessed by dividing the number of cell receptors on the cell surface in response to treatment by the number of cell receptors at the basal state before treatment. Neonatal rat cardiomyocytes were isolated (16) and generously provided by Dr. Barbara Rosati (State University of New York at Stony Brook). Cells were electroporated using Rat Cardiomyocyte-Neonatal Nucleofector Kit (Amaxa, Gaithersburg, MD), program G-09 and 4 µg of plasmid encoding human ß1AR-GFP according to the manufacturers protocol. Cells were then treated for 30 min with IGF-I (100 nM) or Iso (10 µM) at 37 C.
Statistical analysis
All data are displayed as mean values ± SEM for at least three separate experiments. Statistical significance (P value
0.05) is denoted with an asterisk and is derived from comparison of experimental data with the respective controls by ANOVA and Students t test for repeated measures.
| Results |
|---|
|
|
|---|
|
We tested independently the results of the radioligand binding making use of confocal microscopy and a fusion protein composed of the ß1AR to which GFP was fused (Fig. 1C
). Imaging details the localization of the ß1AR in untreated cells as well as in response to challenge with either ß-adrenergic agonist (Iso, 10 µM) or IGF-I (100 nM). In CHO-K1 cell lines expressing ß1AR-GFP, the bulk of the ß1ARs are localized in the cell membrane, providing an ideal model for visualizing receptor trafficking. Examples of ß1ARs localized to the cell membrane are highlighted on the images by white arrows (Fig. 1C
). Treatment with Iso provokes marked agonist-induced sequestration of the ß1AR within 30 min, as shown earlier in HEK-293 cells (18). Examples of internalized ß1AR, confined to the cytoplasmic compartment, are highlighted on the images with yellow arrowheads. Of interest, treatment for 30 min with IGF-I (100 nM) provokes internalization of ß1AR (Fig. 1C
). The results obtained from imaging of ß1AR-GFP in cells treated with IGF-I (Fig. 1C
) agree well with the more quantitative radioligand binding data obtained with the membrane-impermeant CGP-12177 radioligand (Fig. 1B
). Both of the assays demonstrate, for the first time, the ability of the IGF-I to induce sequestration of ß1AR.
Prolonged agonist-induced internalization of GPCRs is followed by down-regulation of the cellular complement of receptor (19). We wanted to determine whether chronic stimulation by IGF-I also provokes down-regulation of the ß1AR (Fig. 1D
). Using high-affinity, ß-adrenergic antagonist [125I]CYP, the total complement of ß1AR was quantified in cells after a long-term (236 h) challenge with Iso (10 µM). The cells treated with Iso display an approximately 30% reduction in cellular complement of ß1AR, observed at 24 and at 36 h of chronic treatment with the ß-adrenergic agonist. Similar experiments were performed in cells treated chronically with IGF-I (100 nM). Unlike the classic down-regulation of ß1AR observed by chronic treatment with ß-adrenergic agonist, no significant down-regulation is observed in response to treating the cells with 100 nM IGF-I for up to 36 h (Fig. 1D
). These observations suggest that internalized receptors may be targeted differentially by various stimuli to recycling vs. degradation, a variation of a hypothesis proposed recently for ß1AR (18).
IGF-I treatment does not alter the affinity of ß1AR for ß-adrenergic agonist
The decrease in the Iso-stimulated cAMP response of cells after treatment with IGF-I may reflect some change in the affinity of the ß1AR for agonist. The affinity of the ß1AR for the ß-agonist Iso was determined for naive (control) and IGF-I-treated (100 nM IGF-I for 30 min) cells, by radioligand competition studies using the ß-adrenergic antagonist [125I]CYP and increasing concentrations of Iso (Fig. 2
). The EC50 for Iso under these conditions was approximately 1.5 x 107 M in IGF-I-treated cells and the same for the control cells (Fig. 2
). These data demonstrate that the functional antagonism of ß1AR in response to IGF-I is not due to a decrease in affinity of the ß1AR for ß-adrenergic agonist.
|
|
|
Akt and antagonism of ß1AR by IGF-I
The serine/threonine protein kinase Akt (PKB) is activated in response to IGF-I (22), so we sought to investigate its role in the regulation of ß1AR by IGF-I. Although a chemical inhibitor of Akt is not available, Akt function can be abolished by expression of a dominant-negative version of Akt (DN-Akt). We made use of a DN-Akt that has triple alanine substitutions, K179A/T308A/S473A (13). Cells transiently transfected to express ß1AR were cotransfected with an empty expression vector or one harboring the triple-mutant DN-Akt. Expression of the DN-Akt was verified by SDS-PAGE and immunoblotting of whole-cell lysates (Fig. 5A
), whereas expression of ß1AR was verified by radioligand binding analysis. Expression of DN-Akt alone does not alter the basal levels of cAMP accumulation (Fig. 5B
). The Iso-stimulated cAMP response was partially reversed in cells expressing DN-Akt mutant (Fig. 5B
). Inhibition of Iso-stimulated cAMP accumulation by IGF-I was attenuated in cells expressing DN-Akt (Fig. 5B
). Treating the DN-Akt-expressing cells with IGF-I, in this case, no longer stimulated functional antagonism of Iso-stimulated cAMP accumulation (Fig. 5B
). Because the results of these experiments were complicated by the effects of DN-Akt alone, we performed parallel experiments in which we measured cell surface ß1AR by radioligand binding (Fig. 5C
). As before, treating cells with IGF-I resulted in internalization of ß1AR. Expression of DN-Akt abolished the ability of IGF-I to internalize the ß1AR (Fig. 5C
). These results are consistent with a role of Akt in the ability of IGF-I to functionally antagonize and internalize the ß1AR. The basis for the ability of DN-Akt expression alone to suppress the cAMP response to Iso remains obscure.
|
|
Confocal microscopy of cells expressing the GFP-tagged version of S412F ß1AR reveals essentially normal localization of the receptors to the cell membrane in untreated cells and little sequestration of ß1AR in response to IGF-I (Fig. 6C
). The S412A ß1AR mutants do display normal sequestration, in contrast, to stimulation of the cells with the ß-agonist Iso (Fig. 6C
). Thus, Iso provokes equivalent internalization of the GFP-tagged versions of the S312A mutant, the S412F mutant, and wild-type ß1AR. IGF-I treatment, in contrast, stimulates the internalization of the GFP-tagged wild-type ß1AR and S312A mutant ß1AR but not that of the S412A mutant ß1AR. The loss of the ß1AR S412 site for phosphorylation by Akt, much like the expression of the dominant-negative form of Akt, abolishes the ability of the ß1AR to be sequestered in response to IGF-I.
IGF-I also stimulates phosphorylation of tyrosyl residues Tyr132 and Tyr141 located in the second cytoplasmic loop of the ß2AR (7). The ß1AR, a homologue of the ß2AR, also displays two tyrosyl residues on the second intracellular loop, located on Tyr157 (YXXI) and Tyr166 (YXXL). Tyrosine-to-phenylalanine mutations of either or both Tyr157 (Y157F) and Tyr166 (Y166F) were created in the ß1AR and the mutant receptor expressed in CHO-K1 cells. These Tyr-to-Phe mutations yield no change in the ability of the ß1AR to be functionally antagonized or to be sequestered by treatment with IGF-I (data not shown).
IGF-I provokes functional antagonism and internalization of the ß1AR in cardiac myocytes
We investigated whether the ability of IGF-I to provoke functional antagonism and internalization of ß1AR observed in the Chinese hamster ovary cells in culture could be observed in acutely prepared, adult canine cardiac myocytes that express ß1AR and ß2AR. To assess the ß1AR-mediated cAMP response only, the accumulation of cAMP in response to Iso was assayed in the presence of the ß2-selective adrenergic antagonist ICI118551 (100 nM). In the presence of 100 nM ICI118551 and full suppression of ß2AR signaling, cardiac myocytes display a robust increase in cAMP accumulation in response to ß1-adrenergic stimulation with Iso (10 µM, Fig. 7A
). IGF-I alone (100 nM) had no effect on the accumulation of intracellular cAMP. Treating the cardiac myocytes with IGF-I and Iso in combination, however, attenuates the ability of the ß-adrenergic agonist to stimulate accumulation of cAMP (Fig. 7A
).
|
We sought to test the effects of IGF-I (and Iso) on the localization of ß1AR by imaging of the adult canine cardiac myocytes. We were unable to obtain suitable expression of the GFP-tagged ß1AR and adequate viability of the cells (data not shown). As an alternative, we attempted to express the GFP-tagged ß1AR in neonatal rat cardiac myocytes using electroporation, and culturing the electroporated, viable cells overnight for confocal microscopy (Fig. 7C
). In neonatal cardiac myocytes expressing GFP-tagged ß1AR, the bulk of the autofluorescent ß1AR was found to be localized to the cell membrane, as labeled on the images by white arrows (Fig. 7C
). The localization of the ß1AR in response to challenge with either ß-adrenergic agonist (Iso, 10 µM) or IGF-I (100 nM) was studied next. Treatment with Iso provokes marked sequestration of the GFP-tagged ß1AR within 30 min; the loss of ß1AR from the cell membrane edges is obvious. The internalized ß1AR, confined to the cytoplasmic compartment, appear in patterns of diffuse smaller punctates. These punctates are labeled on the images with yellow arrowheads. IGF-I (100 nM) for 30 min likewise provoked the internalization of ß1AR. ß1ARs are lost from the cell membrane and now appear in the cytoplasmic compartment in response to IGF-I. Thus, the imaging results of GFP-tagged ß1AR expressed in neonatal rat cardiac myocytes agree well with the cAMP and ß1AR radioligand studies performed in adult canine cardiac myocytes, demonstrating the ability of the IGF-I to crosstalk to ß1AR.
| Discussion |
|---|
|
|
|---|
1ARs (18, 25) as well as ß2ARs (2) has been reported earlier. We have learned a great deal about the regulation of ß1AR by protein kinase A (26), the role of A-kinase anchoring proteins in constituting receptosomes involved in recycling ß1AR (18, 27, 28, 29), and the structure/function of the interaction of ß1AR with agonist (30) as well as with G proteins (27). IGF-I is shown to functionally antagonize the ß1AR, suppressing ß1AR stimulation of cAMP accumulation. IGF-I also regulates the trafficking of ß1AR, stimulating internalization, much like the way classical agonist-induced sequestration operates for both ß1ARs and ß2ARs (2). Functional antagonism of ß2AR by insulin involves insulin receptor-catalyzed phosphorylation and internalization of the ß2AR as well as the ability of insulin to activate cAMP phosphodiesterase activity (2). For the functional antagonism of ß1AR by IGF-I shown herein, we included a phosphodiesterase inhibitor in the cAMP assays, so a role of phosphodiesterase, if any, would have been obscured.
The response of ß1AR signaling to IGF-I treatment is rapid and can be blocked by chemical inhibition of PI3-kinase, indicating the role of PI3-kinase in the signaling. The serine/threonine protein kinase Akt also is a critical element in the signaling downstream of IGF-I and insulin alike (22). The functional antagonism of the ß2AR by insulin, for example, requires Akt (13). Desensitization and trafficking of the
1AARs also involves interaction with and regulation by Akt (31). In the current work, we demonstrate that IGF-I regulation of the ß1AR is mediated by Akt. Residue Ser412 of the ß1AR was identified as one of two potential sites of Akt-catalyzed phosphorylation, the other being Ser312. The Ser312 residue has been shown to be critical to targeting the internalized ß1AR toward recycling (18) but appears to play little role in ß1AR regulation in response to IGF-I. Whereas the S312A ß1AR mutant displays normal IGF-I-induced functional antagonism, the S412A ß1AR mutant no longer responds to IGF-I treatment. Mutation of Ser412 (S412A), disrupting an Akt substrate site on the ß1AR, agrees well with the effects of expression of the DN-Akt mutant of ß1AR internalization by IGF-I, both implicating Akt as essential to IGF-I action on ß1AR.
Crosstalk exists between tyrosine kinase receptors and GPCRs (3, 4, 5, 6), discovered as operating in the regulation of the prototypic G protein-coupled ß2AR (9, 10, 11, 12) and later
1AR (32) and now is shown to operate for another prominent pair of GPCRs (ß1AR) and receptor tyrosine kinases (IGF-I receptor). The actions of agonist-induced desensitization and IGF-I-stimulated functional antagonism of ß1AR appear to achieve the same goals of uncoupling the ß2AR from its cognate G protein and later sequestering the receptor to the intracellular compartment. At least for the ß2AR, the mechanisms/pathways responsible for insulin-stimulated functional antagonism/internalization compared with ß-adrenergic agonist-induced desensitization/internalization are distinct (10, 14). IGF-I functionally antagonizes and later internalizes the ß1AR, a process with essential downstream roles of PI3-kinase and of Akt. These observations on PI3-kinase agree well with the ability of its inhibitor wortmannin to block IGF-I action on cardiac contractility (33).
Chronic heart failure is accompanied by alterations in ß-adrenergic receptor gene regulation, including that of ß1AR (34). Experimental studies demonstrate a functional and therapeutic effect of IGF-I on cardiovascular function, further supporting a possible link between IGF-I action and ß1AR function (13). We extend the work from CHO cells in culture to studies with acutely prepared primary cardiac myocytes, observing that IGF-I stimulates functional antagonism of ß1AR signaling. Although speculation, such a role of IGF-I on ß1AR signaling might explain, in part, changes in heart rate and contractility that occur with aging, a time in which there is a general decline in IGF-I levels (35). The beneficial effects of IGF-I administration on cardiac function may well reflect the ability of IGF-I to functionally antagonize ß1AR (35, 36, 37, 38, 39).
| Acknowledgments |
|---|
| Footnotes |
|---|
Abbreviations: ß2AR, ß2-Adrenergic receptor; CHO, Chinese hamster ovary; [125I]CYP, iodocyanopindolol; DN-Akt, dominant-negative Akt; GFP, green fluorescent protein; GPCR, G protein-coupled receptor; Iso, isoproterenol; MEK, MAPK/ERK kinase; PI3-kinase, phosphatidylinositol 3-kinase; PP2, pyrazolopyrimidine-2.
This work was supported by United States Public Health Service Grant Award DK25410 from the National Institute of Diabetes, Kidney, and Digestive Diseases (NIDDK), National Institutes of Health (NIH) (to C.C.M.); Institutional National Research Service Award 5T32DK007521 from the NIDDK, NIH (to S.G.); and the Clinical Research Scholars Program, Center for Translational Research, School of Medicine, Health Sciences Center, State University of New York at Stony Brook (to S.G.).
Disclosure Statement: The authors have nothing to disclose.
Received November 27, 2006.
Accepted for publication March 6, 2007.
| References |
|---|
|
|
|---|
1b-adrenoceptors. Biochem J 350(Pt 2):413419
-opioid receptors. J Pharmacol Exp Ther 309:776785
1A-adrenoceptors and induces receptor desensitization. Eur J Pharmacol 525:1823[CrossRef][Medline]
1B-adrenergic receptor phosphorylation and desensitization. Life Sci 75:19371947[CrossRef][Medline]This article has been cited by other articles:
![]() |
R. T. Strachan, D. J. Sheffler, B. Willard, M. Kinter, J. G. Kiselar, and B. L. Roth Ribosomal S6 Kinase 2 Directly Phosphorylates the 5-Hydroxytryptamine 2A (5-HT2A) Serotonin Receptor, Thereby Modulating 5-HT2A Signaling J. Biol. Chem., February 27, 2009; 284(9): 5557 - 5573. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |