help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-1606
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sarkar, D. K.
Right arrow Articles by Boyadjieva, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sarkar, D. K.
Right arrow Articles by Boyadjieva, N.
Endocrinology Vol. 148, No. 6 2828-2834
Copyright © 2007 by The Endocrine Society

Alcohol Exposure during the Developmental Period Induces ß-Endorphin Neuronal Death and Causes Alteration in the Opioid Control of Stress Axis Function

Dipak K. Sarkar, Peter Kuhn, Jasson Marano, Cuiping Chen and Nadka Boyadjieva

Endocrinology Program, Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, New Jersey 08901

Address all correspondence and requests for reprints to: Dipak K. Sarkar, Endocrinology Program, Rutgers, The State University of New Jersey, 84 Lipman Drive, New Brunswick, New Jersey 08901. E-mail: sarkar{at}aesop.rutgers.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Proopiomelanocortin-producing neurons in the arcuate nucleus of the hypothalamus secrete ß-endorphin (ß-EP), which controls varieties of body functions including the feedback regulation of the CRH neuronal activity in the paraventricular nucleus of the hypothalamus. Whether ethanol exposure in developing rats induces ß-EP neuronal death and alters their influence on CRH neurons in vivo has not been determined. We report here that binge-like ethanol exposures in newborn rats increased the number of apoptotic ß-EP neurons in the arcuate nucleus of the hypothalamus. We also found that immediately after ethanol treatments there was a significant reduction in the expression of proopiomelanocortin and adenylyl cyclases mRNA and an increased expression of several TGF-ß1-linked apoptotic genes in ß-EP neurons isolated by laser-captured microdissection from arcuate nuclei of young rats. Several weeks after the ethanol treatment, we detected a reduction in the number of ß-EP neuronal perikarya in arcuate nuclei and in the number of ß-EP neuronal terminals in paraventricular nuclei of the hypothalamus in the treated rats. Additionally, these rats showed increased response of the hypothalamic CRH mRNA to the lipopolysaccharide challenge. The ethanol-treated animals also showed incompetent ability to respond to exogenous ß-EP to alter the lipopolysaccharide-induced CRH mRNA levels. These data suggest that ethanol exposure during the developmental period causes ß-EP neuronal death by cellular mechanisms involving the suppression of cyclic AMP production and activation of TGF-ß1-linked apoptotic signaling and produces long-term structural and functional deficiency of ß-EP neurons in the hypothalamus.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ALCOHOL CONSUMPTION DURING pregnancy is a significant public health problem and results in a wide range of adverse outcomes for the child. Many of these fetal alcohol-exposed children show deficit in cognitive and behavioral functions including hyperactivity and poor stress tolerance (for a review see Ref. 1). Using the rat as an animal model, behavioral and neurochemical studies indicated that the defect in the ability of these rats to respond appropriately to stress appears to be due to alterations in the function of the hypothalamic-pituitary-adrenal (HPA) axis (for a review see Ref. 2). Animals exposed to ethanol during the prenatal period are typically hyperresponsive to stressors and drugs during adulthood. For example, both ethanol-exposed males and female rats show increased corticosterone, ACTH hormone, and/or CRH responses to stressors such as repeated restraint, foot shock, and lipopolysaccharide (LPS) challenges or to ethanol and morphine administration (3, 4, 5, 6, 7, 8), although increased hormone response to acute restraint or acute ethanol or morphine occur primarily in ethanol-exposed females (1, 9). The mechanisms that underlie HPA axis hyperresponsiveness in ethanol-exposed offspring are not well understood. However, several reports suggest an abnormal production and/or release of CRH after a stress challenge may be one of the causes for the altered stress regulation process in the ethanol-exposed offspring.

Stress activation of the CRH neuronal function is complex and is controlled by extrahypothalamic and hypothalamic inputs involving several neurotransmitters and their receptors (10). However, a significant inhibitory role of hypothalamic ß-endorphin (ß-EP) neurons on CRH has been identified (11, 12). Our recent studies identified a neurotoxic action of ethanol on developing ß-EP neurons in cultures (13). We found that ethanol exposure of fetal hypothalamic cells in primary cultures increases ß-EP neuronal death during the developmental period by cellular mechanisms involving the suppression of cyclic AMP (cAMP) production and activation of TGF-ß1-linked apoptotic signaling. Hence, the possibility arises that ethanol may be causing ß-EP neuronal death, leading to a reduction or loss of ß-EP inhibitory control of CRH neuronal cell function that may be one of the contributing factors to the abnormal CRH response to a stress challenge. This hypothesis is tested in this study.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animal use
Previous studies have shown that the behavioral and neurodevelopmental effects of ethanol can be demonstrated in rats during the early postnatal period as neurodevelopment continues during the first few days after birth in rats (14). To study the effect of binge-like ethanol administration on developing hypothalamic ß-EP neurons, newborn rats were used between postnatal day (PD) 2 and 6. Pregnant Sprague Dawley female rats were obtained from Simonsen Laboratories (Gilroy, CA) on gestational age 11–13 and were allowed to give birth and used as donors for neonates. A day after the birth, two pups from each litter were fed daily by intubation with milk formula containing 11.34% (vol/vol) alcohol (alcohol-fed) or an isocaloric volume of maltose dextrin (pair-fed) as described previously (15). Feeding tubes consisted of SILASTIC brand silicon tubing (Dow Corning Corp., Midland, MI) attached to the top of an 18-gauge needle. Feeding consisted of gently injecting through a feeding tube (which consisted of SILASTIC brand silicon tubing attached to the top of a blunted 18-gauge needle) a solution (0.1–0.2 ml/animal; during a period of 1 min) containing ethanol and milk formula, yielding a total daily ethanol dose of 2.5 g/kg. The feeding was conducted at 1000 and 1200 h daily for 5 d between PD 2 and 6. The amount fed to the animals equaled 33% of the mean body weight (milliliters per gram). After feeding, pups were immediately returned to the litter. Some alcohol-treated animals were killed by decapitation on PD 6 at 1 and 2 h after the second feeding, and their trunk blood samples were collected and used for measurements of blood alcohol concentrations using an alcohol assay kit (Sigma, St. Louis, MO). Alcohol-fed, pair-fed, and undisturbed ad libitum-fed pups showed identical body growth during the treatment period, and mortality rate was very minimal (data not shown). Animal surgery and care were in accordance with institutional guidelines and complied with the National Institutes of Health policy. The animal protocol was approved by the Rutgers Animal Care and Facilities Committee.

Immunohistochemical determination of apoptotic ß-EP neurons
To identify the apoptotic ß-EP neurons, 2 h after the last feeding on PD 2 or PD 4 of feeding, rat brains were fixed by perfusion with 4% paraformaldehyde and cryoprotected in 30% sucrose. Frozen hypothalamic sections of alcohol or control-treated neonatal rats were double-stained with terminal deoxynucleotidyl transferase biotin-dUTP nick end labeling (TUNEL; Apoptosis Kit; Roche Diagnostic Corporation, Indianapolis, IN) and immunoreactive ß-EP using an ABC kit (Vector Laboratories Inc., Burlingame, CA) as described by us previously (13). Antibody for ß-EP (Peninsula Laboratories, San Carlos, CA) was used at a dilution of 1:1000. The immunoreactive property of this antibody is well characterized and found to be specific for ß-EP. Preincubation of the antiserum with an excess (100 µg/ml) of ß-EP antigens eliminated immunoreactive staining in hypothalamic sections. Routine counts of cells exhibiting ß-EP immunoreactivities or combined TUNEL and ß-EP immunoreactivities were completed by two independent investigators.

Laser capture microdissection of ß-EP neurons and measurements of apoptotic genes
To determine the cellular changes in ß-EP neurons during apoptotic death, we employed laser-captured microdissection (LCM) to isolate ß-EP neurons in the hypothalamic tissue. A rapid immunohistochemical staining protocol for ß-EP was developed to prevent the significant degradation of RNA due to prolonged incubation in aqueous media during the standard staining process. Briefly, 2 h after the last feeding on PD 6, rat brains were fixed by perfusion with 4% paraformaldehyde and cryoprotected in 30% sucrose. Frozen brain 20-µm serial sections were cut using cryostat and mounted on glass slides. Endogenous peroxidase activity was inhibited by 0.03% H2O2 in methanol for 10 min. In the presence of RNase inhibitor (1 U/µl), brain sections were incubated with 10% blocking serum in 0.1 M PBS for 15 min, and primary antibody (1:400; Peninsula Laboratories) for 90 min, followed by secondary antibody (1:200; biotinylated antirabbit) for 30 min. The slides were then incubated for 30 min with the ABC solution (Vector Laboratories Inc.) made in 0.1 M PBS and stained using 2,4-diaminobutyric acid. After staining for ß-EP immunoreactivity was developed, the slides were completely dehydrated by incubating them in graded ethanol solutions (75%, 30 sec; 95%, 30 sec; 100%, 30 sec, twice) and xylene (1 min, twice). From each brain, approximately 500 individual positive cells were captured using the PixCell LCM system (Arcturus, Mountain View, CA). Laser spot size was set to 7 µm. The power amplitude and pulse duration of the PixCell laser were adjusted for each slide (65–75 mW, 750–850 msec). The thermoplastic film-coated caps containing the captured cells were incubated in proteinase K (2 mg/ml) solution made in lysis buffer (20 mmol/liter Tris-HCl, pH 8.0, 20 mmol/liter EDTA, 2% sodium dodecyl sulfate) and examined under the microscope to ensure complete cell lysis. The total RNA from the LCM-captured cells was extracted using a Micro RNA Isolation Kit (Stratagene, La Jolla, CA) and following the manufacturer’s instructions. The genomic DNA from the RNA solution was removed by DNase I treatment, and the remaining RNA was amplified using a single round of linear amplification technique by the standard protocol with the RiboAmp RNA Amplification Kit (Arcturus). To assess the quality of RNA, the sections from which the ß-EP cells had been captured were scraped and were extracted for RNA. Obtained RNA was run on 1.2% agarose gel which displayed 18S and 28S bands slightly smeared, indicating that the prominent RNA remained intact (data not shown). An additional sample with 500 randomly captured cells, isolated using the identical procedure as the tested samples, was used to assess the quality of amplified antisense RNA (aRNA). After amplification, the aRNA from this sample was run on 1.2% agarose gel. The bulk of aRNA ranged from around 200-1700 bases, which is within the expected base length for amplified aRNA with a RiboAmp Kit (Arcturus). The mRNA levels of adenylate cyclases (AC), TGF-ß1, Bcl-2, Bcl-xs, and Bad in ß-EP neurons were measured using quantitative real-time RT-PCR as described by us previously (13). Gene-specific primers and fluorescent-labeled probes were designed using the application-based primer design software, Primer Express, version 1.5 (PerkinElmer Applied Biosystems, Wellesley, MA) and were based on published GenBank sequences. These primers and probes are gene-specific as confirmed by the BLAST search and are as follows: AC6, forward (F)-AGATCAAGACCATCGGTAGCACTT, reversed (R)-TGAAAGAGTGTTCGTTGATGTGTTT, probe (P)-CCTCCGGGCTAAATGCCAGCACCTAT, accession no. (AC)-M96160; AC8, F-ACCGGTGGCACCAAAGTCT, R-TGACCCCACGGTAGCTGTATC, P-ACCTTGACTGTGCCCCAAGTAACTCGGA, AC-L26986; TGF-ß1, F- GAATACAGGGCTTTCGCTTCA, R-CAGGAAGGGTCGGTTCATGT, P-TCAGTCCCAAACGTCGAGGTGACCTG, AC-X52498; Bcl-2, F-CATGTGTGTGGAGAGCGTCAA, R-TTCAGAGACTGCCAGGAGAAATC, P- AGTACCTGAACCGGCATCTGCACACC, AC-U34964; Bcl-xs, F-ATCAGAGCTTTGAACAGGACACTTT, R-AGAACTACACCAGCCACAGTCATG, P-ACAATGCAGCAGCCGAGAGCCG; AC-AF279286; Bad, F-GAGGGTTCCTTCAAGGGACTTC, R-CTGGATAATGCGCGTCCAA, P-CAAAGAGCGCAGGCACTGCAACAC, AC-AF003523. The expression of proopiomelanocortin (POMC) mRNA was detected using a POMC gene-specific primer pair and probe (TaqMan Gene Expression Assay, Rn00595020_m1; Applied Biosystems, Foster City, CA). Amplification was performed for one cycle of a sequential incubation at 50 C for 2 min and 95 C for 10 min, and subsequent 40 cycles of a consecutive incubation at 95 C for 15 sec and 60 C for 1 min, except for AC7, which was detected by running 40 cycles at 95 C for 15 sec and 52 C for 1 min, followed by 72 C for 1 min. The PCR products were run on a 1.5% agarose gel to verify the appropriate size of the amplicons. Relative quantity of mRNA was calculated by relating the PCR threshold cycle obtained from the tested samples to relative standard curves generated from a serial dilution of cDNA prepared from the total RNA. The mRNA level in each sample was normalized with the level of glyceraldehyde-3-phosphate dehydrogenase mRNA, which was measured by a control reagent (PerkinElmer Applied Biosystems). The glyceraldehyde-3-phosphate dehydrogenase mRNA levels did not vary between ethanol and control animals (data not shown). Data shown in figures and in the text are mean ± SEM percentage of control values. Five independent samples were used for each group.

Immunocytochemical determination of ß-EP neuronal soma and terminals
To determine the long-term changes in the development of ß-EP neurons in the hypothalamus of animals treated with binge alcohol during the neonatal period, the number of soma and terminals of ß-EP neurons were determined in the arcuate nuclei and the paraventricular nucleus (PVNs) of male and/or female rats during the juvenile period. At 30 d, these rats were deeply anesthetized with Sleepaway (100 mg/kg; Fort Dodge, Burns Veterinary Supply, Inc., Owings Mills, MD), and were perfused transcardially with 20 ml of PBS, and then with 100 ml of 4% paraformaldehyde. After cryoprotection in 20% sucrose for 1 d, 40-µm-thick serial sections were generated by a cryostat and stained for ß-EP using anti-ß-EP rabbit antisera (Peninsula Laboratories), the ABC kit (Vector Laboratories Inc.) and diaminobenzidine. The stained sections were dehydrated and coverslipped. Routine counts of neuronal soma and/or terminals were completed by two independent investigators.

Changes in the CRH response to LPS
The change in the CRH response to a stress challenge in prepubertal rats fed alcohol during the neonatal period were determined by measuring the hypothalamic CRH mRNA response to a single injection of LPS. A preliminary study was conducted to determine the dose-response effect of LPS on the level of plasma corticosterone (which is used as an indirect measure of CRH activity). Pubertal rats were treated with LPS (0, 10, 50, 100, and 500 µg/kg body weight; ip), and 3 h after, their trunk blood samples were collected and assayed for plasma corticosterone by ELISA (Diagnostic System Laboratories, Webster, TX). Plasma corticosterone levels (ng/ml; n = 5) after treatment with 0, 10, 50, 100 and 500 µg/kg of LPS (Sigma) were 50 ± 20, 153 ± 17, 306 ± 144, 394 ± 38, and 471 ± 72 ng/ml, respectively. This study revealed that the maximal corticosterone response, and thereby possibly CRH response, can be achieved by the LPS dose ranges between 100 and 500 µg/kg at 3 h. We used the 100 µg/kg dose of LPS to determine the changes in the hypothalamic CRH mRNA response. A group of female rats postnatally ad libitum-fed, pair-fed, and alcohol-fed were used between the age of 30–35 for the CRH response study. These rats were injected ip with 100 µg/kg/ml of LPS or with saline (0.1 ml) and killed 3 h later by decapitation. The brains of these animals were collected and PVN tissues were isolated by punching (16). The PVN tissue extracts were used for determination of CRH mRNA levels by real-time RT PCR methods.

A separate group of prepubertal female rats was anesthetized with 50 mg/kg (ip) of sodium pentobarbital (Henry Schein, Indianapolis, IN). They were implanted with bilateral cannula (23-gauge) set 1 mm apart from each other, so that each cannula was 0.5 mm from the midline. The coordinates for the surgery were 1.8 mm behind bregma, 0.5 mm lateral of bregma on each side, and 7.5 mm below the cortex. After implantation of the cannula, 1 µg of ß-EP in 5 µl of artificial cerebrospinal fluid (CSF) was injected into one lobe of the PVN and 5 µl of artificial CSF with 1 µg of BSA was injected into the other lobe of the PVN using a 5-µl Hamilton syringe. Each injection continued for more than 1 min. After the injection, the cannula was left in place for 8 min as to allow the absorption of the treatment. The cannula was then slowly removed in small intervals over a 5-min period. A surgical clip was used to close the skin over the skull, and the rats were injected ip with 100 µg/kg/ml of LPS and placed on a warm heating pad for 3 h, at which time they were then killed, and brains were collected and frozen in liquid nitrogen for CRH mRNA analysis by real-time RT-PCR. The percentage changes of the CRH mRNA levels of the CSF-treated control were presented in the figure and the text.

Statistical analysis
The data shown in the figures and text are mean ± SEM. Comparisons between two groups were made using t tests. Data comparisons between multiple groups were done using one-way ANOVA. Post hoc test involved the Student-Newmann-Keuls test. A value of P < 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ethanol induces apoptosis in developing hypothalamic ß-EP neurons in vivo
Feeding of ethanol-containing milk formula in neonatal rats increased the blood level of alcohol (alcohol content was 205.15 ± 22.5 and 242.75 ± 23.75 mg/dl 1 and 2 h after the last feeding and undetectable 4 h after the last feeding; n = 5) but maintained normal body growth after 5 d of feeding (alcohol-fed, 9.1 ± 0.6 g; pair-fed, 9.2 ± 0.6 g; ad libitum-fed, 9.3 ± 0.6 n = 5). To determine whether ethanol feeding causes apoptotic cell death, we determined using immunocytochemical method the TUNEL activity, which identifies apoptotic cells (17). We also colocalized staining for TUNEL and ß-EP in arcuate nuclei of the hypothalamus to determine whether the opioid peptide-containing neurons are the target of ethanol apoptotic action. The treatment of ethanol increased (P < 0.001) the number of ß-EP-immunostained cells double stained with TUNEL in arcuate nuclei of the hypothalamus (Fig. 1AGo). The ethanol effect was observed on both 2 and 4 d of treatments.


Figure 1
View larger version (36K):
[in this window]
[in a new window]

 
FIG. 1. The effect of ethanol administration on apoptosis of ß-EP neurons in the hypothalamus of neonatal rats. A, Mean ± SEM of the percentage of the ß-EP cells that were TUNEL-positive in alcohol-fed and pair-fed rats after 2 and 4 d of treatment are shown in the histogram. n = 4. a, P < 0.05, compared with the pair-fed group. B–H, Histograms showing changes in the levels of POMC (B), AC6 (C), AC8 (D), TGF-ß1 (E), Bcl-2 (F), Bcl-xs (G), and bad (H) after treatment with ethanol during the postnatal period. a, P < 0.05, compared with the control group. n = 5 per group.

 
Ethanol represses the intracellular level of cAMP and increases TGF-ß1 and TGF-ß1-regulated propapoptotic genes in ß-EP neuron during cellular apoptosis
Previously, we have shown that chronic elevation of ethanol increases death of ß-EP neurons in primary cultures of hypothalamic cells by suppressing the activity of neurotropic factors AC-cAMP and by increasing the TGF-ß1-related apoptotic signaling in these neurons (13). Using LCM, we were able to determine the mRNA levels of several key apoptotic regulatory genes in the captured ß-EP-positive neurons collected from the arcuate nuclei of the alcohol-fed, pair-fed, and ad libitum-fed rats. As expected, treatment with ethanol caused a significant decrease in POMC levels in the ß-EP neurons (Fig. 1BGo). We were able to determine detectable amounts of only AC6 and AC8 (Fig. 1Go, C and D) and not AC7; these are the major isoforms of AC in the hypothalamic cells that are ethanol sensitive in ß-EP neurons (13). In ethanol-exposed rats, ß-EP neurons expressed lesser amounts of AC6 and AC8 mRNA. On the other hand, ß-EP neurons of alcohol-exposed rats expressed more levels of TGF-ß1 transcripts (Fig. 1EGo). In ethanol-treated rat pups, ß-EP neurons expressed a lower amount of transcripts of antiapoptotic gene Bcl-2 (Fig. 1FGo) and increased mRNA levels of the proapoptotic genes Bcl-xs (Fig. 1GGo) and bad (Fig. 1HGo). These data suggest that ethanol exposure during the neonatal period alters the expression of neurotropic factors and apoptosis-regulatory genes and increases apoptotic death of a significant number of ß-EP neurons in the arcuate nucleus of the hypothalamus.

Ethanol exposure during the developmental period reduces the number of soma and terminal buttons of ß-EP neuron in the hypothalamus
Whether the loss of ß-EP neurons due to ethanol challenge permanently affects the number of these neurons was investigated. This is done first by counting the number of ß-EP neuronal soma in the hypothalamus. The number of ß-EP neuronal soma within the anterior rostral and posterior rostral, anterior caudal and posterior caudal regions of both arcuate nuclei of postnatally alcohol-fed, pair-fed, and ad libitum-fed male and female rats were counted and presented in Fig. 2Go. As can be seen in Fig. 2Go, A and B, a reduced staining for ß-EP neuronal soma is observed on d 15 in both and male and female animals fed with alcohol during early postnatal period. Determination of the number of ß-EP neuronal soma in the arcuate nuclei of these rats revealed that the postnatally alcohol-fed rats had significant lower number of ß-EP neurons compared with pair-fed and ad libitum-fed rats (Fig. 2Go, C and D). The postnatal ethanol effect on the number of ß-EP neuronal soma was similar in both sexes. These data suggest that the apoptotic action of ethanol on ß-EP neurons during the developmental period may have caused deficit in the number of these neurons in the arcuate nuclei of the hypothalamus. The number of ß-EP neuronal soma in arcuate nuclei was moderately, but significantly, reduced in pair-fed animals compared with those in ad libitum-fed rats in both sexes, suggesting that the feeding procedure itself moderately reduced the number of immunocytochemically labeled ß-EP neurons.


Figure 2
View larger version (89K):
[in this window]
[in a new window]

 
FIG. 2. Effects of postnatal ethanol exposure on the expression of ß-EP neurons during the juvenile period in the arcuate nuclei of male and female rats. Pups fed with ethanol (Alcohol-fed) or maltose (Pair-fed) or left in the litter (Ad libitum-fed) between PD 2–6 were examined for the number of ß-EP-positive neurons in the arcuate nucleus on d 15 after birth. A and B, Representative sections stained for ß-EP. Arrows identify some of the ß-EP immunopositive neurons. Magnification bar, 50 µm. C and D, Mean ± SEM number of ß-EP neurons obtained from five animals. a, P < 0.001, significantly different from the rest of the groups. b, P < 0.05, significantly different from the ad libitum-fed group.

 
Whether the reduction in the ß-EP cell number in alcohol-fed rats is reflected by the decreased ß-EP neuron terminals in paraventricular nuclei, a hypothalamic site where the opioid peptide is known to act to inhibit CRH to regulate HPA axis (11, 12) is determined. Because postnatal ethanol similarly affected ß-EP neuronal soma of both sexes, we only used female rats to count these neuronal terminals in paraventricular nuclei. The ß-EP neuronal terminals were identified as immunohistochemical buttons found at the end of immunopositive axons. Fig. 3Go, A–C, shows that immunohistochemically localized ß-EP terminal buttons were lower in the paraventricular nucleus of alcohol-fed rats compared with pair-fed and ad libitum-fed rats. The number of total ß-EP terminal buttons in both paraventricular nuclei were significantly lower in alcohol-fed rats than those in pair-fed and ad libitum-fed rats. The postnatal ethanol effect on the number of ß-EP neuronal terminal buttons was similar in both sexes. The number of ß-EP neuronal terminal buttons in the paraventricular nuclei of pair-fed and ad libitum-fed rats was similar in both sexes.


Figure 3
View larger version (104K):
[in this window]
[in a new window]

 
FIG. 3. Effects of postnatal ethanol exposure on the development of ß-EP neuron terminals during the juvenile period (d 15) in the paraventricular nuclei of female rats. A–C, Representative sections with ß-EP neuron terminals. Terminals were identified as immunohistochemical buttons found at the end of immunopositive axons. Arrows identify some of these terminal buttons. Magnification bar, 10 µm. D, Mean ± SEM number of total ß-EP neuron terminals obtained from five animals from each treatment group. a, P < 0.001, significantly different from the rest of the groups.

 
Ethanol exposure during the developmental period alters opioid-regulated CRH neuronal function in the hypothalamus
To assess the impact of the opioid deficiency on the HPA axis in ethanol-exposed rats, we compared the response of CRH neurons to exogenous ß-EP in postnatally alcohol-fed, pair-fed, and ad libitum-fed female rats during the prepubertal period (33–35 d). Because postnatal ethanol similarly affected ß-EP neuronal cell number in both sexes, we only used female rats to determine the impact of opioid deficiency on the HPA axis. We also used female rats before puberty to avoid any influence of the afternoon preovulatory rise of the steroid hormones on CRH neurons in these rats (18). The endotoxin LPS has been shown to be a potent stimulator of CRH neuronal activity including the expression of CRH mRNA (4). Using the LPS challenge paradigm of testing CRH neuronal function, we demonstrated in this study that pubertal rats fed ethanol during the neonatal period showed higher CRH response to LPS challenge than did the pair-fed and ad libitum-fed rats (Fig. 4AGo). These results suggest that the neonatal alcohol-treated rats had developed abnormality in the CRH response to LPS challenge. To assess the impact of the opioid deficiency on the CRH neuronal function in alcohol-exposed rats, we compared the response of CRH neurons to exogenous ß-EP among alcohol-fed and control-fed rats during the pubertal period. The CRH neuronal response to exogenous ß-EP was investigated by infusing the opioid peptide into one of the PVN and CSF into the other PVN of each animal and then measuring the changes in the CRH mRNA expression after systemic administration of LPS. The LPS-induced changes in CRH mRNA levels were compared between the ipsilateral and controlateral side of the PVN of each animal. As shown in Fig. 4BGo, ß-EP inhibited LPS-induced CRH mRNA levels compared with CSF treatment in ad libitum-fed and pair-fed animals. However, ß-EP failed to inhibit LPS-induced CRH mRNA levels in alcohol-fed animals. These results suggest that the postnatally alcohol-fed animals had significantly lower CRH response to the opioid peptide ß-EP during the prepubertal period.


Figure 4
View larger version (15K):
[in this window]
[in a new window]

 
FIG. 4. Effects of postnatal ethanol exposure on the development of functional ß-EP neurons to control stress axis function ß-EP-regulated CRH neuronal response to stress in prepubertal female rats that were alcohol-fed, pair-fed, or ad libitum-fed during early life. A, Basal and LPS (100 µg/kg; ip)-induced CRH mRNA levels in the PVN. Data are mean ± SEM values. a, P < 0.05, vs. the saline treatment. b, P < 0.001, vs. the LPS-treated ad libitum-fed and LPS-treated pair-fed groups. n = 5–6. B, The effects of ß-EP or CSF on LPS-induced CRH mRNA expression in the PVN. Data are mean ± SEM values. n = 6. a, P < 0.05, vs. the CSF.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The data presented here provide evidence that binge-like ethanol administration during the developmental period increases apoptosis in ß-EP neurons in the hypothalamus of neonatal rats. Furthermore, ethanol exposure reduces mRNA levels of AC6 and AC8 but increases mRNA levels of TGF-ß1 in ß-EP neurons of neonatal rats. We further show that ethanol exposure causes changes in apoptotic and survival proteins that are consistent with TGF-ß1 induction of apoptosis. The postnatally ethanol-exposed rats each showed a reduced number of ß-EP neuronal soma in the arcuate nuclei and terminals in the PVN during the juvenile period, and lower CRH reducing action of ß-EP. For the first time, these results demonstrate that ethanol exposure during the developmental period causes structural and functional opioid deficiency in the hypothalamus.

Ethanol-induced apoptosis of ß-EP neurons involves the reduction in the expression of ACs. Previously it has been shown that the ß-EP neuronal population in the hypothalamus is very sensitive to changes in cellular levels of cAMP, as this neuron population shows increased differentiation to exogenous cAMP analogs and shows elevated gene transcription and hormone release to cAMP-elevating agents (19, 20). Ethanol has been shown to acutely increase the effect of cAMP analogs on hormone release and gene transcription in differentiated ß-EP neurons, but chronically to prevent the effects of cAMP analogs and hormones and agonists that affect various AC-bound receptors and ß-EP neuronal functions (21, 22, 23). However, the present study provides the first evidence that in vivo administration of chronic ethanol during the developmental period reduces the intracellular levels of AC in ß-EP neurons. It is interesting to note that chronic ethanol has been shown to increase the CNS expression of inhibitory G-proteins and to reduce AC activity (24). Hence, chronic ethanol might reduce the activity of AC to influence cAMP production in ß-EP neurons.

In this study, like in cultured hypothalamic cells (13), we found that ethanol exposure reduced the levels of AC6 and AC8 while increasing the gene expression of TGF-ß1 and TGF-ß1-regulated apoptotic proteins in developing ß-EP neurons. In addition, Bcl-2, known to be down-regulated by TGF-ß1 (25), was reduced in ß-EP neurons. Using fetal hypothalamic cells in primary cultures, we have recently shown that ethanol increases TGF-ß1 release by reducing cellular levels of cAMP, and that the cAMP analog prevented ethanol-induced TGF-ß release (13). Hence, increased TGF-ß1 and the TGF-ß1-regulated apoptotic gene seen in developing ß-EP neurons after ethanol treatment may have been the result of decreased AC/cAMP activity. The finding that cAMP represses TGF-ß1 and the TGF-ß1-regulated apoptotic gene in developing ß-EP neuronal cells is interesting. Most of the gene targets of cAMP identified to date contain one or more cAMP responsive elements (26). We do not know whether the effects of cAMP on TGF-ß1 represent direct effects of cAMP mediated by the binding of a transcription factor(s) specifically recognizing cAMP responsive elements present on the negative elements of gene promoters. It should be noted that the TGF-ß1 promoter contains activator protein-2-like sequence elements (27), which could potentially mediate cAMP responses (28). Alternatively, the TGF-ß1 promoter includes at least three activator protein-1 binding sites that appear to mediate the induction of the gene expression by phorbol esters (29). However, further studies need to be conducted to determine the mechanism by which cAMP reduces TGF-ß1 gene expression.

In this study, we showed that immature ß-EP neurons react to ethanol by activating TGF-ß1-regulated apoptotic pathway. TGF-ß1 has been shown to stimulate apoptosis by changing the expression of various proapoptotic and antiapoptotic mitochondrial proteins in various cells (25, 30). Of the proteins we examined, the proapoptotic proteins bad and Bcl-xs have been shown to stimulate apoptosis, whereas the antiapoptotic peptide Bcl-2 inhibits apoptotic mechanisms. When the activity of the proapoptotic peptides predominates, cytochrome c is released to activate caspases. In our study, ethanol-treated ß-EP neurons showed reduced levels of Bcl-2 but increased levels of Bcl-xs and bad. These data suggest the possibility that chronic ethanol exposure induces apoptosis in ß-EP neurons, possibly by inhibiting production of cAMP and by increasing the action of TGF-ß1.

Loss of ß-EP neurons during the developmental period can have serious consequences for the developing fetus. We found the number of these neuronal soma in the arcuate nuclei was significantly decreased in juvenile animals exposed to ethanol during the postnatal period, suggesting that a long-term, possibly permanent loss of the of ß-EP neurons occurred in these animals. The ß-EP neuronal loss caused by ethanol exposure during early life occurred in both sexes, suggesting that the vulnerability of these neurons to ethanol during the early postnatal period has no sex differences. The reduction in the ß-EP neuronal soma in the arcuate nucleus was associated with the reduction in these neuronal terminal buttons in the PVNs of alcohol-fed rats. A significant number of ß-EP neurons originated in the arcuate nucleus is known to be terminated in the PVN to inhibit neurosecretion of CRH (11, 12). Hence, the reduction in ß-EP neuronal terminals in the PVN may indicate a reduced opioid inhibitory influence on CRH release in postnatally ethanol-fed rats. This concept is indeed supported by the observations that postnatally alcohol-fed rats had a significantly lower ß-EP-inhibitory action on CRH activity induced by LPS. Therefore, this report illustrates that alcohol intoxication during the developmental period may damage, through a loss of ß-EP cells in the hypothalamus, the neuroendocrine axis controlling the stress function.


    Acknowledgments
 
We thank Dr. Sudhir Jain for technical assistance with various protein ELISA and Lian Sheng Liu for immunocytochemistry.


    Footnotes
 
First Published Online March 8, 2007

Abbreviations: AC, Adenylate cyclase; aRNA, antisense RNA; cAMP, cyclic AMP; CSF, cerebrospinal fluid; ß-EP, ß-endorphin; F, forward; HPA, hypothalamic-pituitary-adrenal; LCM, laser-captured microdissection; LPS, lipopolysaccharide; P, probe; PD, postnatal day; POMC, proopiomelanocortin; PVN, paraventricular nucleus; R, reverse; TUNEL, terminal deoxynucleotidyl transferase biotin-dUTP nick end labeling.

This work was supported by National Institutes of Health Grant AA AA08757 to D.K.S.

Disclosure Statement: The authors have nothing to disclose.

Received November 30, 2006.

Accepted for publication February 27, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Abel E 2004 Paternal contribution to fetal alcohol syndrome. Addict Biol 9:127–133[CrossRef][Medline]
  2. Zhang X, Sliwowska JH, Weinberg J 2005 Prenatal alcohol exposure and fetal programming: effects on neuroendocrine and immune function. Exp Biol Med (Maywood) 230:376–388[Abstract/Free Full Text]
  3. Lee S, Imaki T, Vale W, Rivier C 1990 Effect of prenatal exposure to ethanol on the activity of the hypothalamic-pituitary-adrenal axis of the offspring: importance of the time of exposure to ethanol and possible modulating mechanisms. Mol Cell Neurosci 1:168–177
  4. Lee S, Schmidt D, Tilders F, Rivier C 2000 Increased activity of the hypothalamic-pituitary-adrenal axis of rats exposed to alcohol in utero: role of altered pituitary and hypothalamic function. Mol Cell Neurosci 16:515–528[CrossRef][Medline]
  5. Taylor AN, Branch BJ, van Zuylen JE, Redei E 1988 Maternal alcohol consumption and stress responsiveness in offspring. In: Chrousos GP, Loriaux DL, Gold PW, eds. Mechanisms of physical and emotional stress. Advances in experimental medicine and biology. Vol 245. New York: Plenum Press; 311–317
  6. Kim CK, Osborn JA, Weinberg J 1996 Stress reactivity in fetal alcohol syndrome. In: Abel E, ed. Fetal alcohol syndrome: from mechanism to behavior. Boca Raton: CRC Press; 215–236
  7. Lee S, Rivier C 1996 Gender differences in the effect of prenatal alcohol exposure on the hypothalamic pituitary-adrenal axis response to immune signals. Psychoneuroendocrinology 21:145–155[CrossRef][Medline]
  8. Weinberg J, Taylor AN, Gianoulakis C 1996 Fetal ethanol exposure: hypothalamic-pituitary-adrenal and ß-endorphin responses to repeated stress. Alcohol Clin Exp Res 20:122–131[CrossRef][Medline]
  9. Taylor AN, Branch BJ, Kokka N, Poland RE 1983 Neonatal and long-term neuroendocrine effects of fetal alcohol exposure. Monogr Neural Sci 9:140–152[Medline]
  10. Herman JP, Figueiredo H, Mueller NK, Ulrich-Lai Y, Ostrander MM, Choi DC, Cullinan WE 2003 Central mechanisms of stress integration: hierarchical circuitry controlling hypothalamo-pituitary-adrenocortical responsiveness. Front Neuroendocrinol 24:151–180[CrossRef][Medline]
  11. Plotsky PM 1991 Pathways to the secretion of adrenocorticotropin: a review from the portal. J Endocrinol 3:1–18[Medline]
  12. Buckingham JC 1986 Stimulation and inhibition of corticotrophin releasing factor secretion by ß endorphin. Neuroendocrinology 42:148–152[CrossRef][Medline]
  13. Chen CP, Kuhn P, Chaturvedi K, Boyadjieva NI, Sarkar DK 2006 Ethanol induces apoptotic death of developing ß-endorphin neurons via suppression of cyclic adenosin monophosphate production and activation of transforming growth actor-ß1-linked apoptotic signaling. Mol Pharmacol 69:706–717[Abstract/Free Full Text]
  14. Dobbing J 1981 The later development of the brain and its vulnerability. In: Davis JA and Dobbing J, eds. Scientific foundation of pediatrics. 2nd ed. London: William Heineman Medical Books; 841–847
  15. Goodlett CR, Pearlman AD, Lundahl KR 1998 Binge neonatal alcohol intubations induce dose-dependent loss of Purkinje cells. Neurotoxicol Teratol 20:285–292[CrossRef][Medline]
  16. Chen CP, Kuhn P, Advis JP, Sarkar DK 2004 Chronic ethanol consumption impairs the circadian rhythm of proopiomelanocortin and period genes mRNA expression in the hypothalamus of the male rat. J Neurochem 88:1547–1554[CrossRef][Medline]
  17. Allen RT, Hunter 3rd WJ, Agrawal DK 1997 Morphological and biological characterization and analysis of apoptosis. J Pharmacol Toxicol Methods 37:215–228[CrossRef][Medline]
  18. Carey MP, Deterd CH, de Koning J, Helmerhorst F, de Kloet ER 1995 The influence of ovarian steroids on hypothalamic-pituitary-adrenal regulation in the female rat. J Endocrinol 144:311–321[Abstract/Free Full Text]
  19. Yang, Z, Huang W, Lee D, Capolov DL, Lim AT 1993 The adenyl cyclase-cyclic AMP system modulates morphological and functional development of hypothalamic ß-endorphin neurons in culture. J Neuroendocrinol 5:371–380[CrossRef][Medline]
  20. De A, Boyadjieva N, Pastorcic M, Reddy BV, Sarkar DK 1994 Cyclic AMP and ethanol interact to control apoptosis and differentiation in hypothalamic ß-endorphin neurons. J Biol Chem 269:26697–26705[Abstract/Free Full Text]
  21. Boyadjieva N, Sarkar DK 1997 Effects of ethanol on basal and prostaglandin E1-induced increases in ß-endorphin release and intracellular cAMP levels in hypothalamic cells. Alcohol Clin Exp Res 21:1005–1009[Medline]
  22. Boyadjieva N, Sarkar DK 1999 Effects of ethanol on basal and adenosine-induced increases in ß-endorphin release and intracellular cAMP levels in hypothalamic cells. Brain Res 824:112–118[CrossRef][Medline]
  23. Boyadjieva N, Reddy B, Sarkar DK 1997 Forskolin delays the ethanol-induced desensitization of hypothalamic ß-endorphin neurons in primary cultures. Alcohol Clin Exp Res 21:477–482[CrossRef][Medline]
  24. Wand GS, Diehl AM, Levine MA, Wolfgang D, Samy S 1993 Chronic ethanol treatment increases expression of inhibitory G-proteins and reduces adenylylcyclase activity in the CNS of two lines of ethanol-sensitive mice. J Biol Chem 268:2595–2601[Abstract/Free Full Text]
  25. Francis JM, Heyworth CM, Spooncer E, Pierce A, Dexter TM, Whetton AD 2000 Transforming growth factor-ß1 induces apoptosis independently of p53 and selectively reduces expression of Bcl-2 in multipotent hematopoietic cells. J Biol Chem 275:39137–39145[Abstract/Free Full Text]
  26. Borrelli E, Montmayeur JP, Foulkes NS, Sassone-Corsi P 1992 Signal transduction and gene control: the cAMP pathway. Crit Rev Oncog 3:321–338[Medline]
  27. Geiser AG, Kim S-J, Roberts AB, Sporn MB 1991 Characterization of the mouse transforming growth factor-ß1 promoter and activation by the Ha-ras oncogene. Mol Cell Biol 11:84–92[Abstract/Free Full Text]
  28. Imagawa M, Chiu R, Karin M 1987 Transcription factor AP-2 mediates induction of two different signal transduction pathways: protein kinase C and cAMP. Cell 51:251–260[CrossRef][Medline]
  29. Kim S-G, Kim SN, Jong H-S, Kim NK, Hong SH, Kim S-J, Bang Y-J 2001 Caspase-mediated cdk2 activation is a critical step to execute transforming growth factor-ß1-induced apoptosis in human gastric cancer cells. Oncogene 20:1254–1265[CrossRef][Medline]
  30. Ahmed MM, Alcock RA, Chendil D, Dey S, Das A, Venkatasubbarao K, Mohiuddin M, Sun L, Strodel WE, Freeman JW 2002 Restoration of transforming growth factor-ß signaling enhances radiosensitivity by altering the Bcl-2/Bax ratio in the p53 mutant pancreatic cancer cell line MIA PaCa-2. J Biol Chem 277:2234–2246[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Alcohol AlcoholHome page
R. J. Ward, F. Lallemand, and P. de Witte
Biochemical and Neurotransmitter Changes Implicated in Alcohol-Induced Brain Damage in Chronic or 'Binge Drinking' Alcohol Abuse
Alcohol Alcohol., January 20, 2009; (2009) agn100v1.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sarkar, D. K.
Right arrow Articles by Boyadjieva, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sarkar, D. K.
Right arrow Articles by Boyadjieva, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals