| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Medicine (E.F., J.Q., C.G.) and Pediatrics (S.S.), Brown University, Providence, Rhode Island 02903; and Marine Science Institute (Y.P., J.D., P.T.), University of Texas at Austin, Port Aransas, Texas 78373
Address all correspondence and requests for reprints to: E. Filardo, Department of Medicine, Rhode Island Hospital, 593 Eddy Street, Aldrich Building, Room 718, Providence, Rhode Island 02903. E-mail: edward_filardo{at}brown.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-GTPase subunit protein and associated Gß
dimer (4). During engagement of their cognate ligands, 7TMRs are transformed into an active conformation, in which the 7TMR acts as a GDP/GTP exchange factor and promotes the release of GDP and the binding of GTP to the G subunit. Subsequent catalysis of the bound GTP by the G-GTPase results in the dissociation of the G subunit protein from the Gß components, with activated G-GTPase stimulating plasma membrane-associated enzymes or ion channels, which, in turn, promote second-messenger signaling (4). Free Gß subunit protein complexes released from activated 7TMRs also serve as a functional signaling unit that may stimulate matrix metalloproteinase (MMP)-dependent cleavage and release of plasma membrane-tethered epidermal growth factor (EGF)-like polypeptides from the cell surface (5). This ultimately results in the activation of EGF receptors (EGFRs) and subsequent downstream activation of EGFR-regulated lipid and protein kinases and is referred to as 7TMR-mediated EGFR transactivation (5, 6). 7TMR signaling is attenuated after ligand activation as a consequence of receptor sequestration and internalization into clathrin-coated vesicles, events consistent with the plasma membrane as a site of action for 7TMRs.
Recent evidence supports a role for the 7TMR G protein-coupled receptor 30 (GPR30) in rapid estrogen action (7) and in breast cancer metastasis (8). Both ectopic expression and RNA interference studies have shown specific estrogen binding (9, 10), activation of G proteins (9, 11) and adenylyl cyclase (9, 12, 13), and release of pro-heparin-bound (HB)-EGF (11). These results suggest that GPR30 acts similarly to other 7TMRs, as a cell surface receptor. However, analysis of GPR30-dependent ligand binding with Alexa dye 594-conjugated 17-[4-aminomethyl-phenyl-ethnyl]-estra-1,3,5(10)-triene 3,17ß-diol required detergent permeabilization, implying that GPR30 may function uniquely among 7TMRs as an intracellular receptor (10). This study further showed that expression of a fusion protein constructed of GPR30 and green fluorescent protein resulted in a diffuse intracellular staining pattern that exhibited colocalization with the KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum retention marker. In general, 7TMRs are well expressed within the endoplasmic reticulum and within submembranous vesicles, observations that have been associated with their trafficking to the plasma membrane during receptor biogenesis (14) and their reuptake after agonist stimulation (15). In this regard, intracellular staining of endogenous 7TMRs, as observed in cytochemical and histochemical analyses, is common (16, 17, 18) and may reflect slow egress during receptor biosynthesis and receptor downmodulation during reuptake.
GPR30 bears the structural characteristics that define 7TMRs, with an amino-terminal signal peptidase cleavage site and seven hydrophobic domains that serve to anchor GPR30 into the plasma membrane. Cleavage and release of signal peptides from nascent 7TMRs does not appear to be an absolute requirement for the trafficking of 7TMRs to the plasma membrane, because small epitope tags fused to the amino-terminal end of 7TMRs, e.g. hemagglutinin (HA)-tagged adrenoceptors (19) and Flag-tagged olfactory receptors (20), are retained at the plasma membrane. Thus, removal of a signal peptide sequence is not necessary for surface expression, and the structural determinants encoded by 7TMRs that define surface expression are unclear. However, an intracellular location appears to be incompatible with the mechanism by which 7TMRs associate with heterotrimeric G proteins and promote intracellular signaling. Previous work has shown that GPR30 is a Gs protein-coupled receptor (9) that also triggers proHB-EGF release via Gß subunit protein and Src-like kinases (for review, see Refs. 7 and 21). Thus, GPR30 regulates the activity of two plasma membrane-associated enzymes, adenylyl cyclase, which is an integral membrane protein (12), and MMPs, which are either integrated into the plasma membrane or associated with its exoplasmic surface (22).
In this study, we investigate more thoroughly the subcellular location of GPR30 and its site of action by using a variety of experimental approaches. As a rule, 7TMRs are poorly expressed in endogenous settings, and most of the information regarding their function and trafficking has been developed from their study in heterologous cell models. Therefore, experiments were conducted with HEK-293 cells transfected with HA-tagged GPR30 as well as with SKBR3 cells expressing endogenous GPR30. The experiments outlined here support the concept that GPR30 is a plasma membrane receptor that promotes rapid estrogen signaling.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Construction of HA-GPR30 protein and generation of stable HEK-293 transfectants expressing surface HA-GPR30
An HA-epitope tag was incorporated at the amino terminus of human GPR30 by PCR stitching using molecular clone GPR-BR (GenBank accession no. U63917) (23) as template. For this purpose, a PCR product encoding full-length GPR30 protein was synthesized using forward (5' CACCGAATTCAGAGACATGTACCCATACGACGTCCCAGACTACGCGGATGTGACTTCCCAAGCC 3') and reverse (5' CAAGGCTGTCTAGACGGCACTGCTGAACCT 3') oligonucleotide primers containing EcoRI and XbaI restriction sites, respectively (underlined). The nucleotide sequence encoding the HA epitope YPYDVPDYA nonamer is shown in bold. The amplified product was cleaved with EcoRI and XbaI, purified by agarose gel electrophoresis, and subcloned into pcDNA3.1Zeo (+) for expression (Invitrogen, La Jolla, CA). The resultant molecular clone, named HA-GPR30Zeo, was transfected into HEK-293 cells using Lipofectamine (Invitrogen). Three days after transfection, 500 µg/ml Zeocin (Invitrogen) was added to the growth media. Two weeks later, more than 100 drug-resistant colonies were counted, and all of the cells in these colonies were pooled together and propagated by cultivation in PRF-DMEM/F-12 with 5% fetal bovine serum in the absence of the drug. Immunofluorescence analysis with the HA antibody showed that a relatively small proportion of the cells displayed significant cell surface expression of HA-GPR30. Therefore, transfected cells expressing HA-GPR30 on the cell surface were enriched from the Zeocin-resistant population by fluorescence-activated cell sorting using rabbit HA-specific polyclonal antibody (see Immunofluorescent analysis). Transfectants were sorted based on their mean intensity fluorescence at which the highest staining (upper one percentile) cells were gated under sterile conditions, expanded in culture, and then subjected to a second round of sorting. The resultant cell line, HEK-293 (HA-GPR30), was passed for several months in cell culture and remained cell surface positive for GPR30. HEK-293 [HA-tagged ß adrenergic receptor 1 (HA-ß1AR)] cells were generated in a similar manner by transfection and drug selection using HA-ß1AR plasmid DNA kindly provided by Brian Kobilka (Stanford University, Stanford, CA). Flow cytometry-assisted selection was not necessary to establish detectable HA-ß1AR on the surface of HEK-293 cells.
Antibodies
Rabbit anti-HA epitope antibody and agarose beads conjugated with HA monoclonal antibody (mAB) H7 were purchased from Abcam (Cambridge, MA) and Sigma (St. Louis, MO), respectively. Goat Gs subunit-specific antibodies (sc-26766) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Affinity-purified rabbit GPR30 C-terminal peptide antibodies were described previously (11). Monospecific GPR30 antibody, 2F2, was generated in BALB/C mice that were immunized with synthetic peptide CAVIPDSTEQSDVRFSSAV from the C terminus of human GPR30 that was conjugated to keyhole limpet hemocyanin using the bifunctional cross-linker N-maleimidobenzoyl-N-hydroxysuccinimide ester. Mice were injected intraperitoneally at 3-wk intervals with GPR30 peptide-keyhole limpet hemocyanin conjugate mixed in Titer-max adjuvant (Sigma) and boostered intravenously with peptide 3 d before fusion. Spleens were then harvested, and lymphocytes were isolated and fused with mouse 8653 myeloma cells using polyethylene glycol and seeded into semi-solid containing selective media (hypoxanthine/aminopterin/thymidine) as described in the Clonal Cell-Hy Hybridoma Cloning kit (Stem Cell Technologies, Vancouver, British Columbia, Canada). Supernatants from 952 resultant hybridomas were screened by ELISA for the presence of antibodies reactive to immobilized GPR30 C-terminal peptide. Hybridoma supernatants that were peptide reactive were rescreened for their capacity to immunoprecipitate recombinant GPR30 protein. Hybridomas positive by immunoprecipitation were subcloned in semi-solid media. GPR30 mAB 2F2 was purified from recloned culture supernatants by affinity peptide chromatography.
Immunofluorescent analysis
Adherent cultures of HEK-293 cells stably transfected with GPR30 or vector were detached in PBS supplemented with 0.5 mM EDTA and collected by centrifugation. The cell pellet was resuspended in ice-cold PRF DMEM/F-12 media, recentrifuged, and washed in the same media for two additional cycles. Cells were then resuspended at 106/ml and incubated with rabbit HA antibody (Abcam) or control rabbit IgG at 0.5 µg/ml for 1 h at 4 C. Cells were then washed free of primary antibody by three successive washes in ice-cold PRF-DMEM/F-12 media and then exposed to Alexa 488-conjugated goat antirabbit IgG (Invitrogen) at 2.5 µg/ml for 1 h at 4 C. After this incubation period, cells were then washed three times in PRF-DMEM/F-12 media, and surface fluorescence was measured on 104 cells using a FACSort analyzer (BD Biosciences, Franklin Lakes, NJ) with an argon-ion 488 nm laser and CellQuest software.
To measure the surface expression of GPR30, HEK-293 cells stably transfected with HA-GPR30 or HA-ß1AR were plated in PRF-DMEM/F-12 media on fibronectin-coated glass coverslips and then fixed in 4% paraformaldehyde-PBS. Cells were then reacted with rabbit anti-HA antibodies (Abcam) or control rabbit IgG (0.5 µg/ml) for 30 min at 22 C. After incubation in primary antibody, cells were washed three times in PBS and stained with Alexa 594-derivatized concanavalin A (con A) (100 µg/ml) and Alexa 488-derivatized antirabbit antibodies diluted at 1:800 for 30 min (Invitrogen). Cells were then washed in PBS and mounted in Vectashield containing 4',6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, Burlingame, CA). To measure trafficking of GPR30 from the cell surface, quiescent, adherent HEK-293 (HA-GPR30) cells were labeled with rabbit anti-HA antibodies, as above, then stimulated with 17ß-E2 (1 nM) for various lengths of time, and fixed in 4% paraformaldehyde. Fixed cells were treated for 60 sec in 0.05% Triton X-100 in 50 mM Tris-HCl (pH 7.5) and 150 mM NaCl and blocked in 5% BSA for 15 min. Permeabilized cells were exposed to anticlathrin mouse mAB (ab2371; Abcam) (6 µg/ml) for 30 min, washed, and stained with Alexa 488 antimouse and Alexa 594 antirabbit antibodies for 30 min (each at 1:800). Excess antibody was removed by washing in PBS, and coverslips were mounted in Vectashield with DAPI. Cells were visualized using a Nikon (Melville, NY) E600 microscope equipped with epifluorescence.
Confocal images were acquired using a Nikon PCM 2000 microscope using argon (488 nm) and green helium-neon (543 nM) lasers. Serial optic sections were performed with Simple 32, C-imaging computer software (Compix, Cranberry Township, PA). z-Axis serial sections were collected at 0.5 µm with a 60x PlanApo objective and a scan zoom of 1x. Images were processed and reconstructed in NIH Image shareware.
Immunoprecipitation and deglycosylation
HEK-293 cells stably transfected with HA-GPR30 or HA-ß1AR were grown to confluence in 10-cm culture dishes, washed three times with ice-cold PBS, and lysed in radioimmunoprecipitation assay-buffered detergent [50 mM Tris (pH 7.6), 1% Triton X-100, 1% deoxycholate, 0.1% SDS, 150 mM NaCl, 50 mM NaF, 2 mM phenylmethylsulfonylfluoride plus protease inhibitors (Complete TM)]. Total cell protein was determined by bicinchoninic acid assay. Total protein (1 mg) was cleared with protein G-agarose beads to minimize the interaction of nonspecific proteins with immunoabsorbent beads. Precleared cellular protein was incubated with 3 µg GPR30 mAB 2F2 overnight, and antigen-antibody complexes were collected with protein G-agarose beads for 1 h at 4 C. Immunoabsorbed proteins were eluted with Laemmli sample buffer containing ß-mercaptoethanol at ambient temperature, size fractionated by SDS-PAGE, and electrotransferred to nitrocellulose. The filter was blocked with nonfat dried milk (5%) prepared in Tris-buffered saline containing 0.05% Tween 20 (TBS-T) overnight. Eluted proteins were visualized by blotting with rabbit GPR30 peptide antibodies diluted 1:500 in TBS-T for 2 h at room temperature. Rabbit GPR30 antibodies were detected using secondary goat antirabbit horseradish peroxidase (HRP) and ECL.
Deglycosylation of immunopurified HA-GPR30 protein was performed with N-glycosidase F (PNGase F) or endoglycosidase H (Endo H) according to the specifications of the manufacturer (New England Biolabs, Beverly, MA). Sample incubation in the absence of enzyme was performed as a control. Reactions were stopped in Laemmli sample buffer containing ß-mercaptoethanol.
Intracellular calcium mobilization and measurement of cAMP
Cells were seeded in fibronectin-coated eight-well cover glass chambers (Lab-Tek II; Nalge Nunc, Naperville, IL), serum starved in PRF-DMEM/F-12, and then loaded with fluo-4 (Invitrogen) (5 µg/ml for 15 min). Cover glass chambers were placed in a microscope stage incubator (20/20 Technologies, Eugene, OR) at 37 C and imaged using a inverted scope (Nikon TE2000E), with a 20x PlanApo objective and a cooled CCD camera (Roper CoolsnapHQ; Photometrics, Tucson, AZ). Images were collected every second for 10 min. Data were quantified and analyzed using Metavue Software (Molecular Devices, Sunnyvale, CA) and Microsoft (Seattle, WA) Excel. Background was subtracted, and fluorescence was expressed relative to starting values. To measure intracellular cAMP, HEK-293 transfectants were subcultured in six-well plates to near confluence. Cells were then incubated in serum-free PRF-DMEM/F-12 medium for 3–5 h and treated with charcoal-stripped E2-BSA or E2-HRP or water-soluble E2 for 10 min. Cells were then digested with 0.1 M HCl, and cAMP concentrations were measured in cytosolic fraction samples using an EIA kit following the instructions of the manufacturer (Cayman Chemical, Ann Arbor, MI).
Preparation of subcellular fractions
Cells were washed with PBS, scraped from the plates, suspended in HEPES buffer (9), and centrifuged at 5000 x g for 5 min. The cell fraction was resuspended in HEPES buffer and homogenized, followed by sonication for 10 sec. The nuclear fraction was obtained by centrifugation of the cell homogenate at 900 x g for 7 min. A crude plasma membrane fraction was obtained by centrifuging the supernatant at 20,000 x g for 30 min. A 3500 x g spin for 10 min was used initially before the 20,000 x g spin to remove the heavy mitochondrial fraction, but this step was eliminated in subsequent experiments because it had no effect on the binding results. The plasma membrane fraction was further purified using a sucrose pad (1.2 M sucrose in HEPES buffer, centrifuged at 6900 x g for 45 min) as described previously (24). Microsomal (pellet) and cytoplasmic (supernatant) fractions were obtained by centrifugation at 100,000 x g for 1 h of the remaining supernatant after the 20,000 x g spin. Subcellular fractions were stored at –80 C for up to 2 d before analysis. Cytochrome c reductase [reduced NAD phosphate (NADPH)] activity, an enzyme marker of the endoplasmic reticulum, was measured in subcellular fractions using a spectrophometric assay (kit CY0100; Sigma).
Western blot analysis of subcellular fractions
Western blot analysis for subcellular fractions was performed as described previously (9). Briefly, subcellular fractions were mixed with the 5x reducing lane marker sample buffers (ImmunoPure; Pierce, Rockford, IL) and incubated for 10 min at 22 C. Samples were electrophoresed and blotted according to standard procedures. Equal protein loading was confirmed by the Lowry technique before loading the samples onto the gel. In addition, the protein content of the samples was verified by gel electrophoresis followed by Coomassie blue staining of the gel. Rabbit GPR30 peptide antibody was used at a dilution of 1:500 in an overnight incubation at 4 C after blocking with 5% nonfat milk in TBS-T buffer for 1 h. The membrane was subsequently washed three times, then incubated for 1 h at room temperature with HRP-conjugated goat antirabbit IgG (Pierce), and then treated with enhanced chemiluminescence substrate (SuperSignal; Pierce) and exposed on film (GE Healthcare, Little Chalfont, Buckinghamshire, UK).
Estrogen receptor binding assay
Specific [3H]17ß-E2 binding assays for the plasma membrane, microsomal and nuclear subcellular fractions were performed according to general procedures described previously (9). Specific [3H]17ß-E2 binding of each subcellular fraction was obtained by subtraction of nonspecific binding [mixture of 4 nM [3H]17ß-E2, 1 µM 17ß-E2, and subcellular sample (
250 µg protein)] from total binding (same mixture but without 17ß-E2) after removing unbound (free) ligand. Bound [3H]17ß-E2 from membranous fractions was captured on GF/B glass filters (Whatman, Haverhill, MA). The percentage recovery of protein samples after filtration ranged from 61.0% (microsomes) to 91.7% (plasma membrane) (data not shown). Dextran-coated charcoal was used to separate bound from unbound [3H]17ß-E2 in a soluble receptor assay in cytosolic fractions (25).
[35S]GTPS binding assay
[35S]GTPS binding to the subcellular fractions were assayed as described previously (9) with a few modifications. Briefly, the subcellular samples (150–200 µg protein) were incubated with 10 µM GDP and 0.5 nm [35S]GTPS (12,000 cpm, 1.0 Ci/mol) in 300 µl Tris buffer [100 nM NaCl, 5 mM MgCl2, 1 mM CaCl2, 0.6 mM EDTA, 0.1% BSA, and 50 mM Tris-HCl (pH 7.4)] at 25 C for 15 min in the presence of 100 nM 17ß-E2 (dissolved in ethanol, final ethanol concentration or 0.1%) or buffer containing 0.1% ethanol as a control. Nonspecific binding was determined by addition of 500 nM GTPS to the mixture. At the end of the incubation period, 300 µl of stop solution (10 mM GDP/GTPS in Tris buffer) was added to the reaction tube, and 200 µl aliquots were filtered through GF/B glass fiber filters, followed by several washes with the same buffer and subsequent scintillation counting.
Coimmunoprecipitation of Gs subunit protein with GPR30
SKBR3 cells were incubated with 100 nM 17ß-E2 or no treatment (controls) for 20 min, followed by two washes with buffer. Plasma membrane and microsomal fractions were prepared as described above and incubated overnight at 4 C with 1:200 of goat anti-Gs subunit protein antibody (Santa Cruz Biotechnology) following procedures described previously (26). The fractions were subsequently incubated for 2 h at 4 C with protein-A agarose beads (Santa Cruz Biotechnology). The beads were washed several times, and the immunoprecipitates were eluted by boiling for 10 min in SDS sample buffer. The solubilized immunoprecipitates were run on a 10% Tris-glycine SDS-polyacrylamide gel, the proteins were transferred to nitrocellulose membranes, and the membranes were blocked, incubated overnight with GPR30 antibody (1:500), and visualized as described above for the Western blot analyses.
Statistical analysis
Association between categorical groups was evaluated using the Student’s t test. Two-tailed P values of 0.05 or less were considered to be statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
).
|
), albeit the surface expression of HA-ß1AR was slightly higher than that of HA-GPR30. Specific HA immunostaining of submembranous vesicles was observed during permeabilization of either cell type with Triton X-100. No immunoreactivity was observed in either HEK-293 transfectant (intact or permeabilized) that was stained with rabbit control IgG. Localization of HA-GPR30 within the plasma membrane was confirmed by confocal microscopy using Alexa 594-labeled con A, a lectin that specifically binds to -mannosyl saccharides expressed in the core structures of plasma membrane glycoproteins, as a plasma membrane marker (Fig. 2B). A circumferential staining pattern was observed in serial Z-section stacks prepared from paraformaldehyde-fixed HA-GPR30 cells that were stained with Alexa 594-conjugated con A (Fig. 2B, red). HA rabbit antibodies, which were detected with Alexa 488-conjugated secondary antibodies, showed a similar cell surface staining pattern compiled from these optical sections (green). Coexpression of HA-GPR30 and con A is clearly observed when the HA- and con A-stained sections are registered (Fig. 2B, yellow). In contrast, control rabbit IgG showed no appreciable reactivity, and reactivity was not detected in cells that were costained with control antibodies and con A. These immunofluorescent data strongly suggest that the HA epitope of the HA-GPR30 protein is expressed on the cell surface.
|
). GPR30 immunoprecipitates were prepared from HEK-293 (HA-GPR30) and control HEK-293 (ß1AR) cells using GPR30 peptide mAB 2F2. Immunoprecipitated proteins were eluted and analyzed by immunoblotting with rabbit GPR30 antibodies. The predominant protein species specifically detected by the GPR30 antibody possessed an apparent molecular mass of 44 kDa, although other species with larger apparent molecular masses were also detected. Removal of N-glycan chains by treatment with PNGase F or Endo H resulted in the appearance of major bands with molecular masses of 40 and 39 kDa, respectively, which closely approximates the predicted molecular mass of the unmodified GPR30 core protein fused to the HA-epitope tag.
|
). Vector-transfected HEK-293 cells did not activate calcium fluorochrome in response to 17ß-E2 but remained sensitive to calcium ionophore (trace A). In contrast, GPR30-expressing cells generated a rapid increase in intracellular calcium after treatment with 10 nM 17ß-E2 (trace B) but not with 17-E2 (trace C). This response was rapid with peak levels (3-fold increase) measured within 60 sec, indicating that HA-GPR30 functions in HEK-293 cells to trigger E2-mediated intracellular signaling. Second, we have shown previously that ectopic expression of GPR30 in HEK-293 cells results in activation of Gs protein and accumulation of intracellular cAMP in response to E2 stimulation (9). To determine whether GPR30 acts at the cell surface to promote estrogen-dependent intracellular signaling, intracellular cAMP concentrations were measured in HA-GPR30-expressing HEK-293 cells after stimulation with cell-impermeable E2 conjugates (Fig. 4B). Mean basal intracellular cAMP concentrations of 18.5 pmol were measured in quiescent cells. Exposure to 20 nM 17ß-E2 for 10 min resulted in a significant increase in intracellular cAMP (22.0 pmol). Similar increases in intracellular cAMP were observed after short-term exposure to the same concentrations of charcoal-stripped E2-BSA or E2-HRP (22.0 and 24.0 pmol, respectively). Together, these results suggest that functional HA-GPR30 is expressed on the cell surface and promotes rapid E2 signaling as measured by stimulation of adenylyl cyclase and release of intracellular calcium.
|
). Antibody-labeled, adherent cells expressing either receptor were left untreated or exposed to 17ß-E2 for 5 or 15 min, fixed, permeabilized with Triton X-100, and immunostained with clathrin-specific antibodies (Fig. 5). Before stimulation with 17ß-E2, HA-ß1AR was localized to the cell perimeter, as expected, and 17ß-E2 treatment did not induce HA-ß1AR internalization from the cell surface or result in its association with clathrin (Fig. 5A). By comparison, in untreated cells, HA-GPR30 was localized in patches at the cell surface (Fig. 5B), in part attributable to the fact that these cells express significantly less receptor than is present in HA-ß1AR cells (data not shown). Surprisingly, to a small extent, HA-GPR30 colocalized with clathrin in untreated cells (Fig. 5B). However, codistribution of GPR30 with clathrin was more readily observed within 5 min of hormone treatment. By 15 min, the majority of the prelabeled GPR30 was coexpressed with clathrin in a punctate staining pattern, with little GPR30 associated with the cell periphery, suggesting that 17ß-E2 stimulation resulted in its redistribution to clathrin-coated vesicles. Clathrin codistribution with GPR30 was not observed in cells stimulated with the control hormone 17-E2 (data not shown), indicating the specificity of this response. Collectively, these data imply that GPR30 traffics from the plasma membrane and likely enters clathrin-coated pits after 17ß-E2 stimulation.
|
, NADPH oxidase was greatly enriched in microsomal fractions relative to all other subcellular fractions, which had similar low residual levels of enzyme activity in the spectrophotometric assay, indicating that the endoplasmic reticulum was essentially absent from the nonmicrosomal fractions. Both crude and partially purified plasma membrane fractions displayed high specific [3H]17ß-E2 binding activity (Fig. 6B), 6- to 8-fold higher than that in any other subcellular fractions on a milligram per protein basis. Treatment with 100 nM 17ß-E2 caused G protein activation in the plasma membrane fractions as shown by an approximately 50% increase in specific [35S]GTPS binding activity, whereas no activation of this signal transduction pathway was detected in microsomes or other subcellular fractions (Fig. 6C). Significant G protein activation was also observed after treatment with a lower concentration of 17ß-E2 (20 nM) (see the supplemental figure published on The Endocrine Society’s Journals Online web site at http://endo.endojournals.org). These binding activities were positively associated with the expression of GPR30 protein (Fig. 6D), indicating that functional estrogen receptors (ERs) were associated with enriched plasma membrane fractions that had the highest concentrations of GPR30 protein.
|
). As noted previously (10), Western blotting analysis demonstrated that, although GPR30 protein is detectable within plasma membrane fractions, a significant portion of GPR30 protein is retained within the microsomal fractions (Fig. 7A). However, 17ß-E2 binding activity (Fig. 7B) and estrogen-enhanced GTP binding (Fig. 7C) is not readily measurable within the microsomal fractions or other intracellular fractions but instead is concentrated within the plasma membrane fraction. This finding is consistent with the classical model of 7TMR activation supporting the coupling of GTP with the G subunit dissociated from ligand-occupied receptors. To directly test this concept, the association of Gs protein with GPR30 in various cellular fractions was measured (Fig. 7D). Significantly more GPR30 was found coupled to Gs in plasma membrane fractions than in microsomal fractions, a finding consistent with the concentration of Gs protein within the plasma membrane. 17ß-E2 treatment triggered Gs uncoupling from GPR30, indicating G protein activation (Fig. 7D). These results are consistent with general models that have been proposed for 7TMRs describing their relative activity states (3, 4). These models indicate that high-affinity 7TMRs coupled to G subunit proteins accumulate in the plasma membrane. Subsequent to ligand binding and G protein release, they assume a conformation associated with low affinity for ligand and are transported to intracellular vesicles for 7TMR recycling or receptor degradation in late endosomes.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Here, evidence is provided that GPR30, like all other members of the 7TMR superfamily, is a plasma membrane receptor. We show that estrogen binding and G protein activation is strongly associated with plasma membrane fractions (Figs. 6
and 7). Moreover, the fact that GPR30 is detectable in the plasma membrane (Figs. 1, 2, and 5), becomes sequestered from the cell surface, and codistributes into clathrin-coated vesicles (Fig. 5) is consistent with the current modeling of 7TMRs as plasma membrane receptors. Evidence has been provided previously suggesting that the known estrogen receptors ER and ERß (47, 48, 49) or variants of them (50) may associate with the plasma membrane and be linked to nongenomic signaling. These studies have suggested that ERs may function as membrane ERs (48, 49, 50). In light of the data presented here that GPR30, a structurally distinct ER belonging to the 7TMR family, may also promote rapid 17ß-E2 actions from the plasma membrane, we propose that this receptor be distinguished from the known ERs by applying the name 7TM-ER.
Expression of recombinant GPR30 protein and subsequent selection with antibodies directed against an N terminally located epitope tag allowed for facile detection of GPR30 on the cell surface by a cytofluorescent technique. The abundant expression of GPR30 within the intracellular compartment (Figs. 2A and 7C) may be a product of receptor trafficking patterns observed for other 7TMRs. Retention of 7TMRs within the endoplasmic reticulum is a common feature of 7TMR biogenesis (14) as a consequence of multiple regulatory events, including carbohydrate processing (51), disulfide bond exchange (52), and proteolytic editing (53). Additional complexity is provided by the fact that specific chaperone proteins have been identified, e.g. DrIP (D receptor-interacting protein) (14) and RAMPs (receptor activity-modifying proteins) (54, 55), that allow for 7TMR export. Intracellular retention as a consequence of receptor endocytosis is a common fate for 7TMRs (15, 56) and provides yet another explanation as to why 7TMRs may concentrate intracellularly. Perhaps for these reasons, concentrated plasma membrane expression of 7TMRs is not observed in nature, and perturbations in 7TMR function linked with human disease appear to be the consequence of dysregulated receptor trafficking and activity (57). Localization of endogenous GPR30 in the plasma membrane of SKBR3 cells (Fig. 7) suggests that this location cannot be easily dismissed as anomalous receptor distribution as a result of epitope tagging and overexpression of recombinant GPR30. Surface expression of endogenous GPR30 is further supported by the recently published immunoelectron microscopy data demonstrating that GPR30 concentrates within the plasma membrane of pyramidal neuronal cells of the rat hippocampus (58).
Our study does not exclude the possibility that GPR30 may signal from the endoplasmic reticulum, or other intracellular locations, by a currently undefined molecular mechanism. However, using a classic radioreceptor assay and isotopically labeled [3H]17ß-E2, we did not obtain any evidence for the presence of a functional ER in the intracellular compartment. The reasons for the apparent discrepancies between these results and those obtained by Revankar et al. (10), who detected binding in the intracellular compartment but not on the plasma membrane using E2-Alexa dyes, are unclear at present. The binding affinity of GPR30 for its natural ligand, 17ß-E2, like that of other 7TMRs, is dramatically decreased when the receptor is not coupled with its G protein (9), presumably attributable to a conformational change in the ligand binding pocket (3, 4, 59). The present study shows that much more GPR30 is coupled to its Gs protein in the plasma membrane than in the endoplasmic reticulum (Fig. 7D). Likely differences in the conformational state of the ligand binding pockets of GPR30 proteins in the two compartments could partly explain their apparent different binding affinities for [3H]17ß-E2 and Alexa dye 594 conjugated estrogen. Additional studies directed at identifying the biological and physiological roles of GPR30 in estrogen action are warranted.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Disclosure Statement: The authors have nothing to disclose.
First Published Online March 22, 2007
Abbreviations: ß1AR, ß Adrenergic receptor 1; con A, concanavalin A; DAPI, 4',6-diamidino-2-phenylindole; E2, 17ß-estradiol; EGF, epidermal growth factor; EGFR, EGF receptor; Endo H, endoglycosidase H; ER, estrogen receptor; GPR30, G protein-coupled receptor 30; HA, hemagglutinin; HB-EGF, heparan-bound EGF; HRP, horseradish peroxidase; mAB, monoclonal antibody; MMP, matrix metalloproteinase; NADPH, reduced NAD phosphate; PNGase F, N-glycosidase F; PRF, phenol red-free; TBS-T, Tris-buffered saline containing 0.05% Tween 20; 7TMR, seven-transmembrane receptor.
Received November 30, 2006.
Accepted for publication March 15, 2007.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
subtypes and their evolutionary origins. Endocrinology 148:705–718
opioid receptor. Role of the C terminus in agonist-mediated internalization. J Biol Chem 271:29279–29285(1B)- adrenergic receptor. Mol Pharmacol 57:687–694 and endothelial nitric oxide synthase are organized into a functional signaling module in calveolae. Circ Res 87:E44–E52 (q/11) and Gß proteins and membrane signaling of calcitrol and estradiol. J Cell Biochem 75:138–146[CrossRef][Medline](i). J Biol Chem 276:27071–27076 at the plasma membrane. Mol Cell Biol 23:1633–1646-mediated rapid stimulation of Ca2+ levels and prolactin release in a pituitary cell line. Am J Physiol Endocrinol Metab 288:E388–E397This article has been cited by other articles:
 |
|
 |
|
  Q. Ding, R. Gros, L. E. Limbird, J. Chorazyczewski, and R. D. Feldman Estradiol-mediated ERK phosphorylation and apoptosis in vascular smooth muscle cells requires GPR 30 Am J Physiol Cell Physiol, November 1, 2009; 297(5): C1178 - C1187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Liu, C. Le May, W. P.S. Wong, R. D. Ward, D. J. Clegg, M. Marcelli, K. S. Korach, and F. Mauvais-Jarvis Importance of Extranuclear Estrogen Receptor-{alpha} and Membrane G Protein-Coupled Estrogen Receptor in Pancreatic Islet Survival Diabetes, October 1, 2009; 58(10): 2292 - 2302. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Chen, K. Breen, and M. E Pepling Estrogen can signal through multiple pathways to regulate oocyte cyst breakdown and primordial follicle assembly in the neonatal mouse ovary J. Endocrinol., September 1, 2009; 202(3): 407 - 417. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. G J Hazell, S. T Yao, J. A Roper, E. R Prossnitz, A.-M. O'Carroll, and S. J Lolait Localisation of GPR30, a novel G protein-coupled oestrogen receptor, suggests multiple functions in rodent brain and peripheral tissues J. Endocrinol., August 1, 2009; 202(2): 223 - 236. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. C. Lin, M. Suzawa, R. D. Blind, S. C. Tobias, S. E. Bulun, T. S. Scanlan, and H. A. Ingraham Stimulating the GPR30 Estrogen Receptor with a Novel Tamoxifen Analogue Activates SF-1 and Promotes Endometrial Cell Proliferation Cancer Res., July 1, 2009; 69(13): 5415 - 5423. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Dominguez, E. Hu, M. Zhou, and M. Baudry 17{beta}-Estradiol-Mediated Neuroprotection and ERK Activation Require a Pertussis Toxin-Sensitive Mechanism Involving GRK2 and {beta}-Arrestin-1 J. Neurosci., April 1, 2009; 29(13): 4228 - 4238. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. D. Noel, K. L. Keen, D. I. Baumann, E. J. Filardo, and E. Terasawa Involvement of G Protein-Coupled Receptor 30 (GPR30) in Rapid Action of Estrogen in Primate LHRH Neurons Mol. Endocrinol., March 1, 2009; 23(3): 349 - 359. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Otto, I. Fuchs, G. Kauselmann, H. Kern, B. Zevnik, P. Andreasen, G. Schwarz, H. Altmann, M. Klewer, M. Schoor, et al. GPR30 Does Not Mediate Estrogenic Responses in Reproductive Organs in Mice Biol Reprod, January 1, 2009; 80(1): 34 - 41. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Kleuser, D. Malek, R. Gust, H. H. Pertz, and H. Potteck 17-{beta}-Estradiol Inhibits Transforming Growth Factor-{beta} Signaling and Function in Breast Cancer Cells via Activation of Extracellular Signal-Regulated Kinase through the G Protein-Coupled Receptor 30 Mol. Pharmacol., December 1, 2008; 74(6): 1533 - 1543. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Otto, B. Rohde-Schulz, G. Schwarz, I. Fuchs, M. Klewer, D. Brittain, G. Langer, B. Bader, K. Prelle, R. Nubbemeyer, et al. G Protein-Coupled Receptor 30 Localizes to the Endoplasmic Reticulum and Is Not Activated by Estradiol Endocrinology, October 1, 2008; 149(10): 4846 - 4856. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Wang, E. R. Prossnitz, and S. K. Roy G Protein-Coupled Receptor 30 Expression Is Required for Estrogen Stimulation of Primordial Follicle Formation in the Hamster Ovary Endocrinology, September 1, 2008; 149(9): 4452 - 4461. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Albanito, D. Sisci, S. Aquila, E. Brunelli, A. Vivacqua, A. Madeo, R. Lappano, D. P. Pandey, D. Picard, L. Mauro, et al. Epidermal Growth Factor Induces G Protein-Coupled Receptor 30 Expression in Estrogen Receptor-Negative Breast Cancer Cells Endocrinology, August 1, 2008; 149(8): 3799 - 3808. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Pang, J. Dong, and P. Thomas Estrogen Signaling Characteristics of Atlantic Croaker G Protein-Coupled Receptor 30 (GPR30) and Evidence It Is Involved in Maintenance of Oocyte Meiotic Arrest Endocrinology, July 1, 2008; 149(7): 3410 - 3426. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. M. Klinge, N. S. Wickramasinghe, M. M. Ivanova, and S. M. Dougherty Resveratrol stimulates nitric oxide production by increasing estrogen receptor {alpha}-Src-caveolin-1 interaction and phosphorylation in human umbilical vein endothelial cells FASEB J, July 1, 2008; 22(7): 2185 - 2197. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Abe, K. L. Keen, and E. Terasawa Rapid Action of Estrogens on Intracellular Calcium Oscillations in Primate Luteinizing Hormone-Releasing Hormone-1 Neurons Endocrinology, March 1, 2008; 149(3): 1155 - 1162. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Stormshak and C. V. Bishop BOARD-INVITED REVIEW: Estrogen and progesterone signaling: Genomic and nongenomic actions in domestic ruminants J Anim Sci, February 1, 2008; 86(2): 299 - 315. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Iqbal, O. Latchoumanin, and I. J. Clarke Rapid in Vivo Effects of Estradiol-17{beta} in Ovine Pituitary Gonadotropes Are Displayed by Phosphorylation of Extracellularly Regulated Kinase, Serine/Threonine Kinase, and 3',5'-Cyclic Adenosine 5'-Monophosphate-Responsive Element-Binding Protein Endocrinology, December 1, 2007; 148(12): 5794 - 5802. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P.-A. Scott, A. Tremblay, M. Brochu, and J. St-Louis Vasorelaxant action of 17 -estradiol in rat uterine arteries: role of nitric oxide synthases and estrogen receptors Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3713 - H3719. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Wang, E. R. Prossnitz, and S. K. Roy Expression of G Protein-Coupled Receptor 30 in the Hamster Ovary: Differential Regulation by Gonadotropins and Steroid Hormones Endocrinology, October 1, 2007; 148(10): 4853 - 4864. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
