| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Molecular Biology (H.-Q.W.) and Departments of Endocrinology and Metabolism (Z.-X.D.) and Geriatrics (H.-Y.Z.), the First Affiliated Hospital, China Medical University, Shenyang 110001, China; and Department of Orthopedics (D.-X.G.), the First Municipal Hospital of Qinhuangdao, Qinhuangdao 066000, China
Address all correspondence and requests for reprints to: Zhen-Xian Du, M.D., Ph.D., Department of Endocrinology and Metabolism, the First Affiliated Hospital, China Medical University, Shenyang 110001, China. E-mail: dzx_doctor{at}hotmail.com.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The mechanism underlying proteasome inhibitors-induced anticancer action is partly mediated through nuclear factor-
B (NF-
B) inhibition of apoptosis and c-Jun N-terminal kinase (JNK) activation as well as effects on growth factors (3, 4, 5). Accumulating lines of evidence showed that proteasome inhibitors also induce endoplasmic reticulum (ER) stress-mediated apoptosis in tumor cells (6, 7, 8, 9, 10, 11). An important means of removing misfolded proteins from the ER is their degradation by proteasomes; it is therefore conceivable that treatment of cells with proteasome inhibitors results in the accumulation of misfolded proteins within the ER and causes the unfolded protein response (UPR) or ER stress, the term given to an imbalance between the cellular demand for ER function and ER capacity (12, 13). The UPR pathway comprises four functionally distinct components: 1) general inhibition of translation to attenuate the load of proteins to the ER, 2) transcriptional activation of ER chaperones to increase protein folding and processing capacity, 3) activation of ER-associated degradation to promote degradation of terminally misfolded proteins through proteasomes, and 4) in case of severe or prolonged ER stress, the eventual activation of apoptotic signal, leading to cell death (14, 15). Thus, under conditions associated with ER stress, the genetic program activated involves both genes like GRP78 (also known as BiP) that protect cells from lethal conditions and genes like CHOP (also known as GADD153) that play major roles in ER stress-induced apoptosis (12, 13, 15, 16). Under conditions associated with ER dysfunction, Glucose-regulated protein 78 kDa (GRP78) is recruited to misfolded proteins to facilitate their proper folding, thus serving as a major player in the survival program. On the other hand, CCAAT/enhancer-binding protein homologous protein (CHOP) is one of the molecules observed to mediate ER stress-induced apoptosis. Given that CHOP-deficient cells are resistant to ER stress-induced apoptosis, and in light of the fact that overexpression of CHOP causes apoptosis and the deleterious effects of CHOP are suppressed by GRP78 overexpression, CHOP is believed to play an important role in promoting ER stress-induced apoptosis (12, 13, 15, 16).
Upon treatment with proteasome inhibitors, both GRP78 and CHOP have been shown to be induced (7), underscoring a need to examine balances in the downstream ER stress pathways upon treatment with proteasome inhibitors in tumor cells. Interestingly, at least in cultured cells, activation of the UPR can either synergize with or impede the efficacy of various anticancer drugs, depending on the class and mode of action of the drugs (17, 18, 19, 20, 21, 22). The implication of ER stress in the effects of chemotherapeutic agents prompted us to investigate the potential effect of ER stress on the responsiveness to proteasome inhibition.
In this study, we evaluated the in vitro effect of different proteasome inhibitors on seven undifferentiated thyroid carcinoma cell lines. Using the resistant properties of ARO and 8305C cell lines to proteasome inhibitors, we demonstrate that GRP78 expression level, as well as different induction of CHOP, is an important regulator of proteasome inhibition-induced apoptosis, as evidenced by the fact that suppression of GRP78 enhances the sensitivity, whereas overexpression of GRP78 or suppression of CHOP induction significantly confers resistance to proteasome inhibition. Our study suggests that different induction of GRP78 and CHOP upon proteasome inhibition might be implicated in the responsiveness in thyroid cancer cell lines.
| Materials and Methods |
|---|
|
|
|---|
Reagents
MG132, epoxomicin (EPOX), proteasome inhibitor I (PSI), and BAY 11-7082 were purchased from Calbiochem (La Jolla, CA). Drug-treated and vehicle-treated control media contained less than 0.05% dimethylsulfoxide.
Cell viability assays
For cell viability assays, cells were plated in 96-well dishes (1 x 104 cells per well) and the next day were treated with or without apoptosis-inducing agents in 2% FBS-containing media and grown over a 24-h period. Cell viability was assessed using the 3-(4,5-dimethylthiazol-2-thiazolyl)-2,5-diphenyl tetrazolium bromide (MTT) assay (Chemicon, Bedford, MA) as previously described (25).
Lactate dehydrogenase (LDH) release assay
Cells were plated in 96-well dishes (1 x 104 cells per well) and the next day were stimulated with or without apoptosis-inducing agents in the presence of 2% FBS and grown over a 24-h period. Cell death was assessed by measuring the activity of LDH released from the cytosol of damaged cells into the culture supernatant, using a non-radioisotope cytotoxicity detection kit (Roche Diagnostics Corp., Mannheim, Germany), according to the manufacturers protocol.
Detection of cell death
For cell death assays, cells were washed twice in PBS and then stained with Annexin V-fluorescein isothiocyanate (FITC) (Biovision, Mountain View, CA) and propidium iodide (PI) (Sigma-Aldrich) according to the manufacturers instructions. After staining with annexin V-FITC and PI, samples were analyzed by fluorescence-activated cell scanner (FACScan) flow cytometer (Becton Dickinson, Franklin Lakes, NJ).
Caspase-3 activity assay
For caspases-3 enzymatic assays, 50 µg whole-cell extract was added to reaction buffer containing 25 mM HEPES (pH 7.5), 4 mM CHAPS, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 2 µg/ml aprotinin, 1 µg/ml leupeptin, and 2 µg/ml pepstatin, to achieve a total reaction volume of 500 µl. Ac-DEVD-AMC (Ac-Asp-Glu-Val-Asp-7-amino-4-methylcoumarin; Alexis Biochemicals, San Diego, CA) was added to the mixture at a concentration of 100 µM and incubated for 1 h at 37 C. Cleavage of the substrate was measured by fluorescence spectrometer (HTS 7000;PerkinElmer, Boston, MA) using an excitation and emission wavelength of 360 and 465 nm, respectively. The activities were expressed as fluorescence increase per microgram of protein.
NF-
B DNA-binding activity
The DNA-binding activity of NF-
B was quantified by an ELISA using the trans-AM NF-
B p65 transcription factor assay kit (Active Motif, Carlsbad, CA), according to the instructions of the manufacturer. Briefly, nuclear extracts were prepared by using the NE-PER nuclear and cytoplasmic extraction reagents (Pierce Biotechnology, Rockford, IL). The protein content in the two fractions was quantified using a BSA protein assay kit (Pierce). Nuclear extracts were incubated in 96-well plates coated with immobilized oligonucleotide (5'-AGTTGAGGGGACTTTCCCAGGC-3') containing a consensus (5'-GGGACTTTCC-3') binding site for the p65 subunit of NF-
B. NF-
B binding to the target oligonucleotide was detected by incubation with primary antisera specific for the activated form of p65. The ELISA was developed by employing an anti-IgG horseradish peroxidase conjugate and a developing solution provided by the kit. The OD was determined at 450 nm with a reference wavelength of 655 nm. Background binding was subtracted from the value obtained for binding to the consensus DNA sequence.
Small interfering RNA (siRNA)
The siRNA sequences used here were as follows: siCHOP, AAGAACCAGCAGAGGUCACAA and siGRP78, CGGCAAGAACUUGAUGUC. The scramble nonsense siRNA (scramble; CCGUAUCGUAAGCAGUACU) that has no homology to any known genes was used as control. In addition, position-mismatched (sequence underlined) siCHOP (simutCHOP; AAGAACCAGCAGACCUCACAA) and position-mismatched (sequence underlined) siGRP78 (simutGRP78; CCCCAAGAACUUGAUGUC) was also used to confirm the specificity of siCHOP and siGRP78, respectively. Transfection of siRNA oligonucleotide was performed with Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturers recommendations. Briefly, 16 µl Lipofectamine 2000 reagent was mixed with 400 µl Opti-MEM (Invitrogen) at room temperature for 5 min and then incubated with a mixture of 12 µl 20 µM siRNA duplex and 400 µl Opti-MEM for an additional 20 min at room temperature. The complexes were then applied to cultured cells at approximately 80% confluence on a 60-mm plate containing 4 ml Opti-MEM. After 12 h incubation, the medium was replaced with fresh culture medium.
Construction of GRP78 plasmid and generation of FRO cells stably overexpressing GRP78
A cDNA encoding human GRP78 was generated by PCR from a human brain cDNA library (Invitrogen) and subcloned into the BamHI/XhoI sites of the eukaryotic expression plasmid pcDNA3 (pcDNA3-GRP78). FRO cells were transfected with pcDNA3-GRP78 or an empty vector (pcDNA3-Flag) using Lipofectamine 2000 according to the protocol of the manufacturer, and 48 h later, the cells were incubated in growth medium containing G418 (500 µg/ml; Life Technologies) to select stable clones. Five stable clones were selected based on the overexpression of GRP78, which was confirmed by Western blotting.
RNA isolation and real-time RT-PCR
Total RNA was isolated from cells using TRIzol reagent (Invitrogen). RT was done as previously described (26). Real-time PCR analysis was performed in triplicate on the ABI prism 7000 sequence detection system (Applied Biosystems, Foster City, CA) using the SYBR Green PCR Master mix (Applied Biosystems, Warrington, UK). The PCR conditions were as follows: one cycle at 95 C for 10 min followed by 40 cycles at 95 C for 15 sec and at 60 C for 1 min. After amplification, dissociation curves were performed to ensure that a single PCR product had been amplified. Products were also analyzed by gel electrophoresis and sequencing on first primer pair usage to ensure that the correct gene fragment was amplified. For CHOP, the forward primer was 5'-ATGAGGACCTGCAAGAGGTCC-3' and the reverse was 5'-TCCTCCTCAGTCAGCCAAGC-3'; the amplicon size is 136 bp. For GRP78, the forward primer was 5'-GTTCTTGCCGTTCAAGGTGG-3' and reverse was 5'-TGGTACAGTAACAACTGCATG-3'; the amplicon size is 181 bp. For ß-actin, the forward primer was 5'-GAGACCTTCAACACCCCAGCC-3' and the reverse was 5'-GGATCTTCATGAGGTAGTCAG-3'; the amplicon size is 205 bp. All the reactions were performed in triplicate, and the standard method was used for the quantification of the expression for each segment, by use of actin as a normalization control gene. Standard curves were obtained using PCR fragments that were excised from a 1.5% agarose gel, purified using an agarose gel DNA extraction kit (QIAGEN, Hilden, Germany), resuspended in Tris-EDTA, and quantified with both a NanoDrop ND-1000 spectrophotometer (NanoDrop, Wilmington, DE) and a PicoGreen LightCycler (Invitrogen). Standards consisted of a 10-fold dilution series containing 10 to 105 copies/µl. All the reactions were done with a negative control to ensure that we had no contamination.
Western blot analysis
Cells were lysed in lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, and protease inhibitor cocktail from Sigma-Aldrich). Cell extract protein amounts were quantified using the BSA protein assay kit. Equivalent amounts of protein (25 µg) were separated using 12% SDS-PAGE and transferred to polyvinylidene difluoride membrane (Millipore Corp., Billerica, MA). Western immunoblotting was performed using primary antibodies against CHOP (Santa Cruz Biotechnology, Santa Cruz, CA), activating transcription factor 4 (ATF4) (Santa Cruz Biotechnology), X-box-binding protein 1 (XBP-1) (Santa Cruz Biotechnology), GRP78 (BD Bioscience, San Diego, CA), GRP94 (Sigma-Aldrich), B-cell lymphoma 2 (Bcl-2) (Santa Cruz Biotechnology), Bax (Cell Signaling Technology, Danvers, MA), or actin (Chemicon, Bedford, MA); horseradish peroxidase-conjugated antirabbit or antimouse secondary antibodies (Amersham Biosciences, Little Chalfont, Buckinghamshire, UK); and enhanced chemiluminescence solutions (Amersham). For densitometric analysis, images were scanned and densitometry was performed using the NIH IMAGE 1.4 software.
Data analysis
Statistical difference were evaluated using ANOVA with Dunnetts post hoc test and considered significant at P < 0.05.
| Results |
|---|
|
|
|---|
|
B activity has been reported to be implicated in the pathogenesis of thyroid cancer cells (27, 28, 29). Additionally, the antitumor effects of bortezomib have been proposed to largely correlate with its ability to block the degradation of the NF-
B inhibitor-
B
(I
B
) (30, 31, 32). To investigate whether this was the case in our cell lines, we investigated the effect of PSI, EPOX, and MG132 on the DNA-binding activity of NF-
B. Each thyroid cancer cell line showed different basal levels of NF-
B DNA binding activity, and there was no consistent effect of treatment with proteasome inhibitors on the DNA-binding activity of NF-
B (Fig. 1D
B DNA-binding activity after PSI treatment was observed in all the cell lines. Upon treatment with EPOX, NF-
B DNA-binding activities were reduced in FRO, KTC2, KTC3, and 8505 cell lines but remained unaltered in ARO, KTC1, and 8305C cells. On the other hand, no obvious alteration of NF-
B DNA-binding activity was detected after MG132 treatment in any cell lines. These results suggested that proteasome inhibitors-mediated thyroid cancer cell death was not always concomitant with reduction of NF-
B activity, and vice versa.
We further investigated the responses of these thyroid cancer cell lines to the irreversible inhibitor of I
B
phosphorylation, BAY 11-7082. After 24 h of treatment, NF-
B DNA binding was inhibited in all thyroid cancer cell lines treated with 5 µM BAY 11-7082 (Fig. 1E
). Profound reductions in cell viability were seen in FRO, KTC2, KTC3, and 8305C cell lines at 5 µM BAY 11-7082 (Fig. 1F
). Although to some lesser extent, there was also a significant decrease in the viability of the ARO, KTC1, and 8505 cell lines at this concentration, and these three cell lines progressively underwent apoptosis as the concentration was increased up to 10 µM (Fig. 1F
). Taken together, these studies indicate that although the inhibition of NF-
B has effects on thyroid cancer cell viability, other pathways are also involved in the antitumor actions of proteasome inhibitors.
Different regulation of GRP78 and CHOP upon treatment with proteasome inhibitors in different thyroid cancer cell lines
Accumulating lines of evidence indicate that proteasome inhibitors are potent inducers of ER stress, which is implicated in proteasome inhibitors-induced apoptosis. In general, when a cell experiences ER stress, intracellular signaling pathways collectively termed the UPR are activated to withstand such potentially lethal conditions. In case of severe or prolonged ER stress, however, apoptotic cellular signals are activated. Induction of GRP78 and CHOP was examined by real-time RT-PCR and Western blot in each of the thyroid cancer cell lines treated with the three different proteasome inhibitors. All seven thyroid cancer cell lines were observed to express GRP78 constitutively, with ARO, 8305C, and 8505C cell lines having a higher expression level compared with the other four cell lines. ARO cells also expressed high levels of CHOP, whereas the other six cell lines expressed only trivial levels of CHOP under basal conditions (Fig. 2
, A and B). The levels of GRP78 were increased in response to treatment with proteasome inhibitors in all seven thyroid cancer cell lines as early as 4 h after proteasome inhibition and reached the plateau at 816 h (Fig. 2A
). The levels of GRP78 stayed high with a similar degree of increases (about 2- to 3-fold) in all cell lines after treatment with proteasome inhibitors for 24 h. However, because the absolute value of GRP78 in ARO, 8305C, and 8505C cells was higher, upon proteasome inhibition, the ARO, 8305C, and 8505C cell lines showed dramatically higher GRP78 levels compared with the other four cell lines (Fig. 2A
). Interestingly, upon treatment with proteasome inhibitors, the levels of CHOP were significantly induced in sensitive cell lines FRO, KTC1, KTC2, and KTC3 as early as 4 h, and the high levels remained after 24 h, whereas in the less sensitive or resistant cell lines ARO, 8305C, and 8505C, only a slight increase was detected after exposure for 4 h, and its levels decreased to basal levels after 8 h (Fig. 2B
). Consistent with the observation of altered GRP78 and CHOP mRNAs, GRP78 protein levels were increased upon treatment with 10 nM PSI in all cell lines. On the other hand, CHOP protein levels were significantly induced in sensitive cell lines, whereas little or no alteration was observed in less sensitive or resistant cell lines (Fig. 2C
). Similar results were observed upon treatment with EPOX or MG132 (data not shown).
|
Knockdown of GRP78 by siRNA increases proteasome inhibition-induced apoptosis in thyroid cancer cells
GRP78 has strong antiapoptotic activities. Moreover, emerging lines of evidence have shown that GRP78 might serve as a multidrug-resistant molecule, conferring resistance against several chemotherapeutic drugs (22, 33, 34, 35). To determine the potential role of GRP78 in resistance to proteasome inhibitor-induced apoptosis, we knocked down the GRP78 protein levels using a siRNA-mediated approach. The mRNA and protein levels of GRP78 from cells transfected with siRNA against the human GRP78 were analyzed by real-time RT-PCR and Western blot analysis. siGRP78 resulted in a loss of over 80% of total cellular GRP78 mRNA after 24 h and over 75% of total GRP78 protein content after 48 h in culture. siGRP78 had no effect on CHOP; in addition, neither a scrambled siRNA nor simutGRP78 (which harbored two mismatched bases) had an effect on GRP78, indicating the specific effect of siGRP78 against GRP78 expression (Fig. 3A
). The previously described MG132-dependent induction of GRP78 expression was also observed in cells silenced for GRP78 but to a much lesser extent than in cells transfected with a scrambled siRNA or simutGRP78 (Fig. 3B
, a representative image from studies carried out on ARO cells). Interestingly, CHOP was marginally increased in ARO, 8305C, and 8505C cells but remained unaltered in the other four cell lines transfected with siGRP78 upon MG132 treatment (Fig. 3B
and data not shown). To evaluate the effect of GRP78 silencing on sensitivity to proteasome inhibitor-induced apoptosis, the parental cells and cells transfected with scramble, simutGRP78, or siGRP78 were exposed to 1 µM MG132 for 24 h. Knockdown of GRP78 resulted in a statistically significant increase in cell death as measured by annexin V-FITC and PI staining (Fig. 3C
). Cell death after proteasome inhibitor treatment, however, was unaffected by the scrambled siRNA or simutGRP78. A relative increase in basal cell death was also seen in ARO cells transfected with siGRP78, but the absolute value of this increase was very small and failed to reach statistical significance.
|
|
|
| Discussion |
|---|
|
|
|---|
B transcription factor, which seems to play an important role in drug and radiation resistance, as well as tumor angiogenesis. A large body of experimental and preclinical data suggests that the disruption of NF-
B activity is an important anticancer effect of proteasome inhibitors including bortezomib (37). The antiproliferative and proapoptotic actions of bortezomib largely correlate with its ability to block the degradation of the NF-
B inhibitor I
B
(30, 31, 38). However, specific NF-
B inhibitors fail to completely reproduce all bortezomib activities (39). Moreover, bortezomib and other proteasome inhibitors can induce apoptosis at the same time without affecting or even activating NF-
B (40, 41, 42, 43). In our series of cells, no consistent change was seen in the relative amounts of active NF-
B after treatment with PSI, EPOX, and MG132. We found that despite that seven human thyroid cancer cell lines responded similarly to low concentrations of three different proteasome inhibitors, this proteasome inhibitors-mediated cell death did not always correlate with reduction in NF-
B activity, and vice versa. Coupled with previous studies, our study thus indicated that NF-
B cannot completely explain the antitumor effect of proteasome inhibitors. In this study, we investigated the potential role of ER stress in the responsiveness to proteasome inhibitors in undifferentiated thyroid cancer cell lines. To this end, we first compared the sensitivity of a panel of thyroid cancer cells to three different proteasome inhibitors and investigated the induction of GRP78 and CHOP after proteasome inhibition. These seven thyroid cancer cell lines respond differently to proteasome inhibition, with ARO and 8305C almost completely unresponsive. The resistance to proteasome inhibition appears to correlate with basal GRP78 expression level as well as different induction of CHOP upon treatment with proteasome inhibitors. The cell death upon treatment with proteasome inhibitors is at least partly mediated by up-regulation of CHOP, evidenced by suppression of CHOP dramatically suppressing proteasome inhibition-mediated cell death. The mRNA levels of GRP78 and CHOP are induced as early as 4 h after addition of proteasome inhibitors, as well as increased GRP94, XBP-1, and ATF4, indicating that proteasome inhibitors actually induced ER stress in thyroid cancer cells. The CHOP level is dramatically induced in sensitive cell lines as early as 4 h and remained high until 24 h after exposure to proteasome inhibitors. Interestingly, insensitive cell lines have higher constitutive GRP78 levels compared with sensitive cell lines; GRP78 is further increased, whereas the CHOP level is slightly increased at an early stage and decreases to basal levels 8 h after treatment with proteasome inhibitors. ARO cells also express a higher basal level of CHOP compared with other cell lines. Given that overexpression of CHOP induces cell cycle arrest and apoptosis (44), how ARO cells survive through a high constitutive level of CHOP remained elusive. As a transcription factor, CHOP itself is unlikely to be intrinsically apoptotic; it more likely alters the expression of one or more downstream genes that facilitate cell death. Concomitantly expressing a high level of GRP78 under basal conditions might counteract the proapoptotic effect of CHOP. Although not statistically significant, decreased basal viability observed in ARO cells transfected with siGRP78 provides some support to this idea. High basal levels of other potent antiapoptotic molecules, such as survivin and X-linked inhibitor of apoptosis protein (XIAP) (data not shown) may also suppress the apoptotic effect of CHOP. Alternatively, in some circumstances, CHOP may even have an antiapoptotic effect, an obviously strange phenotype for a proapoptotic signal (45).
A paradox of the UPR is that the response leads to the simultaneous activation of both survival and apoptotic pathways. Several inducers of the UPR, such as transcriptional factors ATF6 and XBP-1, have DNA-binding sites for both CHOP and GRP78 gene promoter and thus induce transcription of both (13). It remains unclear how ARO, 8305C, and 8505C cells are able to selectively keep inducing GRP78 transcription but leave CHOP transcription less affected or unaffected. Consistent with a previous report that GRP78-overexpressing cells demonstrated decreased inducibility of CHOP in response to ER stressors (36), we found that compared with the parental FRO counterpart, GRP78-stable cells exhibited attenuated induction of CHOP upon proteasome inhibition. Taken together, the basal GRP78 level might be a possible mechanism underlying preferential induction of GRP78 or CHOP in our panel of thyroid cancer cells upon proteasome inhibition. Although to a lesser extent, CHOP was induced at an early stage in response to proteasome inhibitors, suggesting that induced CHOP is unstable in insensitive cell lines. A similar phenomenon was also observed in ER stress-adapted cells, in which ER stress-mediated cell death was averted by differential stabilities of GRP78 and CHOP (46).
Induction of GRP78 has been widely used as a marker for ER stress and the onset of UPR. Due to its antiapoptotic property, stress induction of GRP78 represents an important prosurvival component of the evolutionarily conserved UPR. Recent evidence shows that the microenvironment of tumors represents physiological ER stress, and GRP78 is up-regulated in many types of cancer cell lines and tumor biopsies (47). A large number of studies have established that the activation of the UPR, especially up-regulation of GRP78, alters the cells sensitivity to chemotherapeutic agents, at least in part, through inhibition of BAX and caspase-7 activation (22, 33, 34, 35). A recent retrospective study further supports the in vitro findings and provides new insight into the relationship between GRP78 induction and chemoresponsiveness (35).
The resistance of cancer cells to chemotherapeutic drugs remains a major obstacle for effective cancer treatment. The mechanisms underlying resistance to proteasome inhibition remain unclear. Our results demonstrate for the first time that unbalanced regulation of GRP78 and CHOP might be involved in resistance to proteasome inhibition. Upon proteasome inhibition, except for induction of ER stress, which is thought to occur because the accumulation of ubiquitinated proteins that cannot be degraded in the cytosol prevents the retrograde translocation of additional unfolded proteins from the ER (48, 49), heat-shock proteins (HSPs) including HSP27, HSP70, and HSP90 also have been shown to be induced (50, 51, 52), underlying the critical role of functional proteasomes for the degradation of misfolded ER proteins as well as destabilized cytosolic proteins. Interestingly, a previous report has shown that proteasome inhibition resistance was associated with overexpression of HSP27 in one lymphoid line (53), and inhibiting induction of the HSP was demonstrated to sensitize myeloma and prostate carcinoma to proteasome inhibitors (54). Coupled with our results, prosurvival chaperones might be general contributors to proteasome inhibition in resistant cancers.
In summary, we have demonstrated that the levels of GRP78 as well as different induction of GRP78 and CHOP upon treatment with proteasome inhibitors correlate with the cells sensitivity to this novel drug, consistent with the idea that alteration in the ratio of proapoptotic to antiapoptotic proteins culminating in apoptosis is critical for the cell fate, survival or death. Our study provides the first evidence that the difference in GRP78 levels in tumors may be exploited to predict the response to proteasome inhibitors among thyroid cancer patients. From a therapeutic standpoint, further development of small-molecular-weight inhibitors of GRP78 might represent a novel approach to sensitize cells toward proteasome inhibitors, although extensive animal studies and preclinical trials using this regimen will be required.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online April 12, 2007
1 H.-Q.W. and Z.-X.D. contributed equally to this work. ![]()
Abbreviations: ATF4, Activating transcription factor 4; Bcl-2, B-cell lymphoma 2; CHOP, CCAAT/enhancer-binding protein homologous protein; EPOX, epoxomicin; ER, endoplasmic reticulum; FBS, fetal bovine serum; FITC, fluorescein isothiocyanate; GRP78, glucose-regulated protein 78 kDa; HSP, heat-shock protein; I
B
, inhibitor-
B
; LDH, lactate dehydrogenase; MTT, 3-(4,5-dimethylthiazol-2-thiazolyl)-2,5-diphenyl tetrazolium bromide; NF-
B, nuclear factor-
B; PI, propidium iodide; PSI, proteasome inhibitor I; simutCHOP, position-mismatched siCHOP; siRNA, small interfering RNA; UPR, unfolded protein response; XBP-1, X-box-binding protein 1.
Received November 22, 2006.
Accepted for publication March 30, 2007.
| References |
|---|
|
|
|---|
is caused by up-regulation of GRP78. Biochem Biophys Res Commun 300:327332[CrossRef][Medline]
. Mol Cell Biol 22:85068513
B in human thyroid carcinomas. J Biol Chem 279:5461054619
B is constitutively active in C-cell carcinoma and required for RET-induced transformation. Cancer Res 61:45264535
B cascade potentiates the effect of a combination treatment of anaplastic thyroid cancer cells. J Clin Endocrinol Metab 89:410418
B, cell survival, tumor growth, and angiogenesis in squamous cell carcinoma. Clin Cancer Res 7:14191428
B-dependent process. Oncogene 22:71087122[CrossRef][Medline]
2-macroglobulin to its cell surface receptor GRP78 in 1-LN prostate cancer cells regulates PAK-2-dependent activation of LIMK. J Biol Chem 280:2627826286
B as a therapeutic target in multiple myeloma. J Biol Chem 277:1663916647
B
degradation mediated by caspase-8. Mol Cell Biochem 287:1319[CrossRef][Medline]
B (I
B) kinase activation, I
B
degradation, and nuclear factor
B activation in HT-29 cells. Mol Pharmacol 65:342349
B on endometrial carcinoma cell lines and primary culture explants. J Biol Chem 281:2211822130This article has been cited by other articles:
![]() |
J. A. Schardt, D. Weber, M. Eyholzer, B. U. Mueller, and T. Pabst Activation of the Unfolded Protein Response Is Associated with Favorable Prognosis in Acute Myeloid Leukemia Clin. Cancer Res., June 1, 2009; 15(11): 3834 - 3841. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |