help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-1710
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
148/7/3338    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pagliassotti, M. J.
Right arrow Articles by Wang, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pagliassotti, M. J.
Right arrow Articles by Wang, D.
Endocrinology Vol. 148, No. 7 3338-3345
Copyright © 2007 by The Endocrine Society

Insulin Protects Liver Cells from Saturated Fatty Acid-Induced Apoptosis via Inhibition of c-Jun NH2 Terminal Kinase Activity

M. J. Pagliassotti, Y. Wei and D. Wang

Department of Food Science and Human Nutrition, Colorado State University, Fort Collins, Colorado 80526

Address all correspondence and requests for reprints to: Michael J. Pagliassotti, Department of Food Science and Human Nutrition, Colorado State University, Campus Deliver 1571, Fort Collins, Colorado 80523. E-mail: pagliasm{at}cahs.colostate.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Hepatocyte apoptosis is increased in patients with nonalcoholic steatohepatitis and correlates with disease severity. Long-chain saturated fatty acids, such as palmitate and stearate, induce apoptosis in liver cells. The present study examined insulin-mediated protection against saturated fatty acid-induced apoptosis in the rat hepatoma cell line, H4IIE, and primary rat hepatocytes. Cells were provided a control media (no fatty acids) or the same media containing 250 µmol/liter of albumin-bound oleate or palmitate for 16 h. Insulin concentrations were 0, 1, 10, or 100 nmol/liter (n = 4–6/treatment). Palmitate, but not oleate, activated caspase-3 and induced DNA fragmentation in the absence of insulin. Insulin reduced palmitate-mediated activation of caspase-3 and DNA fragmentation in a dose-dependent manner. Phosphatidylinositol 3-kinase inhibitors abolished these effects of insulin. Insulin-mediated inhibition of palmitate-induced apoptosis was not due to an augmentation in the unfolded protein response or increased expression of genes encoding the inhibitor of apoptosis proteins, inhibitor of apoptosis protein-2 and X-linked mammalian inhibitor of apoptosis protein. Palmitate, but not oleate, increased c-Jun NH2 terminal kinase activity in the absence of insulin. Insulin or SP600125, a chemical inhibitor of c-Jun NH2 terminal kinase, blocked palmitate-mediated activation of c-Jun NH2 terminal kinase and reduced apoptosis. These data suggest that insulin is an important determinant of saturated fatty acid-induced apoptosis in liver cells and may have implications for fatty acid-mediated liver cell injury in insulin-deficient and/or -resistant states.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
NONALCOHOLIC FATTY LIVER disease (NAFLD) is a chronic disease syndrome that is initially characterized by steatosis with progression, in some, to nonalcoholic steatohepatitis (NASH) and end-stage liver disease (1, 2). NAFLD is a common cause of chronic liver enzyme elevations and cryptogenic cirrhosis; however, its pathogenesis remains uncertain (1). It has been proposed that the trigger for progression into more advanced stages of NAFLD involves an insult, or second hit, superimposed on hepatic steatosis (3).

Hepatocyte apoptosis is present in patients with NASH and correlates with disease severity (4, 5). Excess circulating and nonadipose tissue lipids, in particular long-chain saturated fatty acids, induce apoptosis in a number of cell types, including hepatocytes (6, 7, 8, 9, 10, 11). Obesity and insulin resistance, conditions associated with and, in part, determined by excess lipids, play significant roles in the development and progression of NAFLD (12, 13). Notably, insulin and several growth factors inhibit apoptosis and promote cell survival through phosphatidylinositol (PI)-3-kinase- and Akt-dependent mechanisms (14, 15, 16, 17). Therefore, the combination of excess lipid delivery and reduced insulin action may be an environment that promotes apoptosis and the development and/or severity of NASH. The present study sought to determine whether insulin restricts lipid-mediated apoptosis in hepatocytes and, if so, whether this involved: 1) augmentation of the unfolded protein response (UPR), 2) up-regulation of members of the inhibitor of apoptosis protein (IAP) family, and/or 3) inhibition of c-Jun NH2 terminal kinase (JNK) activity (8, 11, 17).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Cell culture
The rat hepatoma liver cell line, H4IIE (American Type Culture Collection, Manassas, VA), was cultured in DMEM containing 8 mM glucose and supplemented with 10% fetal bovine serum, penicillin, and streptomycin sulfate. Experiments were performed at 80–100% cell confluence. In preparation for primary cell culture, hepatocytes were isolated from male, Wistar rats (Charles River Laboratories, Wilmington, MA) by collagenase perfusion (18, 19). All procedures involving rats were reviewed and approved by the Colorado State University Institutional Animal Care Committee. Cells were first incubated in RPMI 1640 (HyClone, Logan, UT) containing 11 mM glucose, 10–7 M dexamethasone, and 10–7 M insulin on Matrigel-coated plates (for RNA) or collagen-coated plates containing 5% fetal bovine serum (for protein) for 4 h (attachment period). The medium was then changed to one containing RPMI 1640, 8 mM glucose, 10–7 M dexamethasone, and 10–8 M insulin. The following morning experimental treatments were performed using RPMI 1640 that contained 8 mM glucose and 10–7 M dexamethasone. Each independent experiment was performed in triplicate.

Experimental agents
Fatty acids (Sigma Chemical Co., St. Louis, MO) were complexed to BSA at a 2:1 molar ratio (11). Thapsigargin, a tumor-promoting sesquiterpene lactone used to chemically induce the unfolded protein response and apoptosis, and wortmannin, a PI3-kinase inhibitor, were purchased from Sigma. The broad-spectrum caspase inhibitor benzyloxycarbonyl-VAD-fluoromethyl ketone, the PI3-kinase inhibitor LY294002, and the cell-permeable JNK inhibitor SP600125 were purchased from Calbiochem (San Diego, CA).

RNA isolation and analysis
Total RNA was extracted with TRIzol reagent using the manufacturer’s protocol (Invitrogen, Carlsbad, CA). For analysis of X-box binding protein (XBP)-1 splicing, a two-step protocol was used for RT-PCR using Superscript II reverse transcriptase and Taqpolymerase (19). For real-time PCR, reverse transcription was performed using 0.5 µg of DNase-treated RNA and Superscript II RNaseH and random hexamers. PCRs were performed in 96-well plates using transcribed cDNA and IQ-SYBR green master mix (Bio-Rad Laboratories, Hercules, CA). PCR efficiency was between 90 and 105% for all primer and probe sets and linear over 5 orders of magnitude. The specificity of products generated for each set of primers was examined for each fragment using a melting curve and gel electrophoresis. Reactions were run in triplicate and data calculated as the change in cycle threshold for the target gene relative to the change in cycle threshold for ß2-microglobulin and cyclophilin (control genes) according to the procedures of Muller et al. (20). Results were similar, regardless of the control gene; therefore, data in Results and Discussion are reported using ß2-microglobulin. Primer sets for target genes were: CCAAT/enhancer-binding protein homologous protein (CHOP), forward, CCAGCAGAGGTCACAAGCAC, reverse, CGCACTGACCACTCTGTTTC; growth arrest and DNA damage-inducible protein 34 (GADD34), forward, CTTCCTCTGTCGTCCTCGTCTC, reverse, CCCGCCTTCCTCCCAAGTC; glucose-regulated protein 78 (GRP78), forward, AACCCAGATGAGGCTGTAGCA, reverse, ACATCAAGCAGAACCAGGTCAC; ER-degradation enhancing {alpha}-mannosidase-like protein (EDEM), forward, GCAATGAAGGAGAAGGAGAC, reverse, CCATATGGCATAGTAGAAGGC; B-cell lymphonas protein-2, forward, AGAGGGGCTACGAGTGGGATAC, reverse, GTTCGGTTGCTCTCAGGCTG; inhibitor of apoptosis protein-2 (cIAP2), forward, TGGCTACTTCAGTGGCTCCTAC, reverse, CTGGCCTTCTCCGTGTTCATTG; X-linked mammalian inhibitor of apoptosis protein (XIAP), forward, GGCAGAATATGACGCACGGATC, reverse, AGCCCTCCTCCACAGTGAAAG. Primer sets for control genes were: ß2-microglobulin, forward, GGTGACCGTGATCTTTCTGGTG, reverse, GGATGGCGAGA- GTACACTTGAATT; cyclophilin, forward, GTCAACCCCACCGTGTTCTTC, reverse, ACTTTGTCTGCAAACAGCTCGAA.

Immunoblot analysis
Cells were washed with PBS and harvested using a lysis buffer containing 20 mM HEPES (pH 7.4), 1% Triton X-100, 10% glycerol, 2 mM EGTA, 1 mM sodium vanadate, 2 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 50 mM ß-glycerophosphate, 3 mM benzamidine, 10 µM leupeptin, 5 µM pepstatin, and 10 µg/ml aprotinin. Equivalent amounts of protein (50–100 µg) were subjected to SDS-PAGE, transferred to Hybond-P membranes (Amersham Pharmacia Biotech, Piscataway, NJ), and the membranes incubated with antibodies against phosphorylated c-Jun (Cell Signaling Technology, Beverly, MA), JNK (Cell Signaling), GRP78 (Stressgen, Ann Arbor, MI), Bcl-2 (Cell Signaling), and actin (Sigma). Proteins were detected using horseradish peroxidase-conjugated secondary antibodies and an enhanced chemiluminescence reagent (Pierce, Rockford, IL). Density was quantified using a UVP Bioimaging system (Upland, CA).

JNK activity
JNK activity was determined using the N-terminal c-Jun fusion protein bound to glutathione Sepharose beads (Cell Signaling).

Determination of caspase activity and apoptosis
Activity of the caspase-3 class of cysteine proteases was determined with the Colorimetric caspase-3 activation assay, which uses a caspase-specific peptide that is conjugated to the color reporter molecule p-nitroanaline (R&D Systems, Minneapolis, MN). Caspase activity was normalized to cell lysate protein concentration. DNA fragmentation was evaluated using a modification of the protocol of Bialik et al. (21). In some experiments, apoptosis was also determined using the cell death detection ELISA kit (Roche Diagnostics, Penzberg, Germany). The assay is based on the quantitative sandwich enzyme immunoassay principle using mouse monoclonal antibodies directed against DNA and histones. This allows specific determination of mono- and oligonucleosomes in the cytoplasmic fraction of cell lysates.

Metabolite analysis
Glucose (Sigma), free fatty acids (Wako; NEFA-C test kit) and albumin (Sigma) concentrations were determined by standard techniques. The pH of the medium was not significantly affected by any of the experimental conditions.

Data analysis and statistics
Statistical comparisons were calculated using ANOVA and post hoc comparisons among means using the Scheffé’s or Tukey’s test. Statistical significance was set at P < 0.05. All data are reported as the means ± SD.


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Insulin reduces thapsigargin- and palmitate-mediated apoptosis
In the absence of insulin, increased caspase-3 activity (Fig. 1AGo), DNA fragmentation (Fig. 1BGo), and ELISA-based cell death (Fig. 1CGo) were observed in H4IIE liver cells incubated with either thapsigargin or palmitate. The presence of the broad-spectrum caspase inhibitor benzyloxycarbonyl-VAD-fluoromethyl ketone prevented thapsigargin- and palmitate-induced DNA fragmentation and ELISA-based cell death [data not shown (11)]. Insulin reduced thapsigargin- and palmitate-induced caspase-3 activity (Fig. 1AGo), DNA fragmentation (Fig. 1BGo), and ELISA-based cell death (Fig. 1CGo) in a dose-dependent manner.


Figure 1
View larger version (30K):
[in this window]
[in a new window]

 
FIG. 1. Apoptosis in control, thapsigargin-, oleate-, and palmitate-treated H4IIE liver cells in the absence or presence of insulin. A, Caspase-3 activity presented as the mean ± SD for n = 6. B, Representative DNA gel, showing fragmentation, from a total of four independent experiments. C, ELISA-based cell death presented as the mean ± SD for n = 6. Incubations were 16 h in duration. LG, Control cells incubated with 8 mM glucose; Thap, cells incubated in control medium supplemented with thapsigargin at 450 nM; O250, cells incubated with control medium supplemented with oleate at 250 µM; P250, cells incubated with control medium supplemented with palmitate at 250 µM. *, Significantly different from LG and O250; +, significantly different from similar treatment in the absence of insulin.

 
Inhibitors of PI3-kinase prevent insulin-mediated inhibition of apoptosis
In the absence of insulin, wortmannin or LY294002 increased caspase-3 activity and DNA fragmentation in H4IIE liver cells incubated with thapsigargin or palmitate (Fig. 2Go). Wortmannin or LY294002 blocked the protective effects of insulin on thapsigargin- and palmitate-mediated activation of caspase-3 and DNA fragmentation (Fig. 2Go).


Figure 2
View larger version (54K):
[in this window]
[in a new window]

 
FIG. 2. DNA fragmentation and caspase-3 activity in control, thapsigargin-, oleate-, and palmitate-treated H4IIE liver cells in the absence or presence of insulin and PI3-kinase inhibitors. A, Effects of insulin (100 nM), wortmannin (Wort; 1 µM), or both on DNA fragmentation and caspase-3 activity. B, Effects of insulin (100 nM), LY294002 (50 µM), or both on DNA fragmentation and caspase-3 activity. Incubations were 16 h in duration and data are presented as a representative DNA gel from a total of four independent experiments or as the mean ± SD for n = 5. LG, Control cells incubated with 8 mM glucose; Thap, cells incubated in control medium supplemented with thapsigargin at 450 nM; O250, cells incubated with control medium supplemented with oleate at 250 µM; P250, cells incubated with control medium supplemented with palmitate at 250 µM. *, Significantly different from LG and O250; +, significantly different from similar treatment in the absence of insulin.

 
Insulin does not augment the UPR
We and others (10, 11, 22) demonstrated that saturated fatty acids induce the UPR. The UPR is a signaling pathway that serves to reduce the protein load and expand the protein folding and degradative capacity of the endoplasmic reticulum (ER) in response to the accumulation of unfolded proteins (23). Failure of this response to reestablish ER homeostasis results in apoptosis (17, 23). We hypothesized that insulin might reduce palmitate-mediated apoptosis via augmentation of the UPR. In the absence of insulin, thapsigargin and palmitate increased the expression of several genes involved in the UPR in H4IIE liver cells (Fig. 3AGo). In the presence of thapsigargin or palmitate, insulin did not augment the expression of any of these genes (Fig. 3AGo). However, insulin increased the expression of CHOP, GADD34, and GRP78 mRNA in control H4IIE liver cells and CHOP and GADD34 mRNA in cells exposed to oleate (Fig. 3AGo). Thapsigargin and palmitate increased the expression of GRP78 protein (Fig. 3BGo); however, insulin did not augment the expression of this protein in any of the treatments (Fig. 3BGo).


Figure 3
View larger version (33K):
[in this window]
[in a new window]

 
FIG. 3. Biochemical markers of UPR activation in control-, thapsigargin-, oleate-, and palmitate-treated H4IIE liver cells in the absence or presence of insulin. A, Effects of insulin on CHOP, GADD34, GRP78, and EDEM mRNA. B, Effects of insulin on GRP78 and actin protein. Incubations were 16 h in duration and data are presented as the mean ± SD for n = 5. LG, Control cells incubated with 8 mM glucose; Thap, cells incubated in control medium supplemented with thapsigargin at 450 nM; O250, cells incubated with control medium supplemented with oleate at 250 µM; P250, cells incubated with control medium supplemented with palmitate at 250 µM. LG in the absence of insulin was set to 1. *, Significantly different from LG and O250; +, significantly different from similar treatment in the absence of insulin.

 
Effects of fatty acids and insulin in primary rat hepatocytes
In the absence of insulin, increased caspase-3 activity, ELISA-based cell death, and increased expression of CHOP and GADD34 mRNA were observed in primary rat hepatocytes incubated with either thapsigargin or palmitate (Fig. 4AGo). Similar to H4IIE liver cells, insulin reduced thapsigargin- and palmitate-induced caspase-3 activity and ELISA-based cell death and did not augment the expression of CHOP or GADD34 mRNA in primary rat hepatocytes (Fig. 4AGo). LY294002 blocked the protective effects of insulin on thapsigargin- and palmitate-mediated activation of caspase-3 and ELISA-based cell death (Fig. 4BGo).


Figure 4
View larger version (41K):
[in this window]
[in a new window]

 
FIG. 4. Caspase-3 activity, ELISA-based cell death, and biochemical markers of UPR activation in primary rat hepatocytes in the absence or presence of insulin and PI3-kinase inhibitors. A, Effects of insulin on caspase-3 activity, ELISA-based cell death, and UPR genes. B, Effects of insulin and LY294002 on caspase-3 activity and ELISA-based cell death. Incubations were 16 h in duration and data are presented as the mean ± SD for n = 4. LG, Control cells incubated with 8 mM glucose; Thap, cells incubated in control medium supplemented with thapsigargin at 450 nM; O250, cells incubated with control medium supplemented with oleate at 250 µM; P250, cells incubated with control medium supplemented with palmitate at 250 µM. LG in the absence of insulin was set to 1. *, Significantly different from LG and O250; +, significantly different from similar treatment in the absence of insulin.

 
Insulin does not increase expression of Bcl-2 or IAP family members
Bcl-2 proteins play important roles in regulation of caspase-dependent cell death, and the IAP family members, cIAP2 and XIAP, play a critical, protective role in ER stress-induced cell death in human breast cancer cells (17, 24). Therefore, we examined the expression pattern of Bcl-2, cIAP2, and XIAP in H4IIE liver cells in the absence and presence of insulin. In the absence of insulin, thapsigargin increased the expression of cIAP2 mRNA only, whereas palmitate had no effect on Bcl-2, cIAP2, or XIAP (Fig. 5Go). Insulin, at 100 nM, reduced the thapsigargin-mediated increase in cIAP2 mRNA (Fig. 5AGo). Similar data were observed in primary rat hepatocytes (data not shown). In addition, no differences were observed in Bcl-2 protein among treatments in the absence or presence of insulin in H4IIE liver cells or primary rat hepatocytes (Fig. 5BGo). Please note that attempts to measure cIAP2 and XIAP using commercial antibodies were not successful in these cell lines.


Figure 5
View larger version (43K):
[in this window]
[in a new window]

 
FIG. 5. Bcl-2 and inhibitor of apoptosis family members in control-, thapsigargin-, oleate-, and palmitate-treated H4IIE liver cells and primary rat hepatocytes in the absence or presence of insulin. A, Bcl-2, cIAP2, and XIAP mRNA levels in H4IIE liver cells after 16-h incubations. B, Bcl-2 protein expression in H4IIE liver cells and primary rat hepatocytes after 16-h incubations. Data are presented as the mean ± SD for n = 4. A representative Western blot is shown for Bcl-2 protein in the absence or presence of 100 nM insulin. LG, Control cells incubated with 8 mM glucose; Thap, cells incubated in control medium supplemented with thapsigargin at 450 nM; O250, cells incubated with control medium supplemented with oleate at 250 µM; P250, cells incubated with control medium supplemented with palmitate at 250 µM. LG in the absence of insulin was set to 1. *, Significantly different from LG and O250; +, significantly different from similar treatment in the absence of insulin.

 
Insulin reduces thapsigargin- and palmitate-induced JNK activity
Free fatty acids, in particular long-chain saturated fatty acids, induced JNK-dependent hepatocyte apoptosis (8). Therefore, we examined the effects of thapsigargin, palmitate, and insulin on JNK activation in H4IIE liver cells. Thapsigargin and palmitate increased JNK activity (Fig. 6AGo), and insulin (100 nM) blocked this activation (Fig. 6BGo). Inhibition of JNK activity with SP600125 (Fig. 7AGo) reduced but did not prevent thapsigargin- or palmitate-mediated cell death (Fig. 7BGo). Total free fatty acid disappearance from the medium was not significantly different in the absence vs. presence of either insulin or SP600125 (data not shown).


Figure 6
View larger version (40K):
[in this window]
[in a new window]

 
FIG. 6. JNK activity in control-, thapsigargin-, oleate-, and palmitate-treated H4IIE liver cells in the absence or presence of insulin (100 nM). A, JNK activity after 6- and 16-h incubations in the absence of insulin. B, JNK activity after 16-h incubations in the absence and presence of insulin. Data are presented as the mean ± SD for n = 4. Gels shown are representative of four independent experiments. LG, Control cells incubated with 8 mM glucose; Thap, cells incubated in control medium supplemented with thapsigargin at 450 nM; O250, cells incubated with control medium supplemented with oleate at 250 µM; P250, cells incubated with control medium supplemented with palmitate at 250 µM. LG at 6 h (Fig. 7AGo) and LG in the absence of insulin (Fig. 7BGo) were set to 1. *, Significantly different from LG and O250.

 

Figure 7
View larger version (31K):
[in this window]
[in a new window]

 
FIG. 7. JNK activity and apoptosis in control-, thapsigargin-, oleate-, and palmitate-treated H4IIE liver cells in the absence or presence of the JNK inhibitor, SP600125 (10 µM). A, JNK activity in the absence or presence of SP600125. LG in the absence of SP600125 (LG–) is set to 1. B, DNA fragmentation and ELISA-based cell death. DNA gel is representative of four independent experiments. Incubations were 16 h in duration, and data in graphs are presented as the mean ± SD for n = 5. LG, Control cells incubated with 8 mM glucose; Thap, cells incubated in control medium supplemented with thapsigargin at 450 nM; BSA, cells incubated with control medium and 125 µM BSA; O250, cells incubated with control medium supplemented with oleate at 250 µM; P250, cells incubated with control medium supplemented with palmitate at 250 µM. *, Significantly different from LG and O250; +, significantly different from similar treatment in the absence of insulin.

 
Fat accumulation in the liver is associated with and causally linked to hepatic insulin resistance (25, 26, 27). Nonselective and persistent apoptosis has been observed in viral hepatitis, alcohol-induced liver disease, ischemia/reperfusion injury, and NAFLD and correlates with disease severity and hepatic fibrosis (4, 28, 29). Notably, insulin and other growth factors promote cell survival, in part, through inhibition of cellular apoptosis (17, 30). Thus, adequate insulin signaling in the liver may be an important determinant of the magnitude of apoptosis, and possibly, the development and/or amplification of inflammation and fibrosis in NAFLD. In the present study, the ability of insulin to restrain lipoapoptosis in hepatocytes, both H4IIE liver cells and primary rat hepatocytes, was examined. The results demonstrate that insulin restrains both thapsigargin- and palmitate-induced apoptosis, in part, via inhibition of JNK activity.

In the present study, insulin caused a dose-dependent reduction in thapsigargin- and palmitate-mediated caspase-3 activation, DNA fragmentation, and ELISA-based cell death that appeared to be mediated via PI3-kinase. Thus, similar to previous data in other cell types (17, 30), insulin activation of PI3-kinase plays an important, protective role in ER stress- and palmitate-induced cell death signaling. Notably, addition of either wortmannin or LY294002 in the absence of insulin increased thapsigargin- and palmitate-induction of caspase-3 activity and DNA fragmentation. These results suggest that the basal activity of PI3-kinase may functionally restrain cell death signaling.

Disruption of ER homeostasis, collectively termed ER stress, activates the UPR. The UPR is initiated by at least three ER transmembrane proteins, RNA-dependent protein kinase-like ER eIF2{alpha} kinase (PERK), inositol-requiring ER-to-nucleus signaling protein-1 (IRE1), and activating transcription factor 6. PERK activation leads to phosphorylation of eIF2{alpha} and subsequent attenuation of translation initiation. Increased expression of GADD34, a member of the growth arrest and DNA damage-inducible family of proteins, is involved in reversal of translational attenuation. In addition, activation of PERK, IRE1, and activating transcription factor 6 increases the expression of genes whose protein products enhance the folding (e.g. GRP78), degradation (e.g. EDEM), and proapoptotic (e.g. CHOP) signaling capacity of the ER. In contrast to the chemical induction of the UPR using thapsigargin or tunicamycin, palmitate does not increase the expression of several genes related to the IRE1 branch of the UPR in liver cells, including IRE1 itself, X-box binding protein-1, and EDEM as well as molecular chaperones such as GRP75 and calreticulin (this study and Ref. 11). In a previous study, we postulated that the lack of induction of some or all of these genes may limit the ability of the ER to mitigate palmitate-induced stress and thus contribute to palmitate-induced apoptosis (11). In the present study, insulin reduced palmitate-mediated apoptosis but did not augment the UPR, based on multiple biochemical markers. We interpret this to suggest that insulin-mediated protection either involves distal components of the UPR (e.g. protein phosphorylation and/or translocation) that were not measured in the present study or operates independently of the UPR. It is notable that in control cells insulin increased the expression of CHOP, GRP78, and GADD34 mRNA suggesting that the expression of these genes is regulated by insulin and/or insulin, via its ability to stimulate protein synthesis and reduce protein degradation, alters ER homeostasis and provokes the activation of selected components of the UPR in liver cells. However, it should be emphasized that insulin induction of UPR-related genes was less pronounced in primary rat hepatocytes, compared with H4IIE liver cells. In macrophages, insulin triggered not only activation of the UPR but also antiapoptotic signaling (31).

Bcl-2 and IAP family proteins play critical roles in the regulation of caspase-dependent cell death, and high levels of transcription of cIAP2 and XIAP have been observed in thapsigargin-treated MCF-7 cells (17). Importantly, up-regulation of these two IAP family members was dependent on the PI3-kinase/Akt pathway and their ablation sensitized cells to ER stress-induced cell death (17). In addition, insulin increased the expression of XIAP and Bcl-2 proteins in murine peritoneal macrophages (31). In total, these data suggest that insulin-mediated PI3-kinase signaling elicits a prosurvival response that involves up-regulation of Bcl-2 and IAP family mRNA and proteins. However, in the present study, insulin did not elicit increases in the expression of Bcl-2, cIAP2, or XIAP mRNA or Bcl-2 protein. These data suggest that in these liver cell models, insulin-mediated protection from thapsigargin- and palmitate-induced apoptosis occurs independently of changes in the level of expression of inhibitor of apoptosis family members and Bcl-2. It must be acknowledged that because protein expression of IAP family members and phosphorylation/translocation of Bcl-2 were not examined in the present study, it is possible that these proteins may contribute to insulin-mediated survival via posttranscriptional mechanisms.

The MAPK family of proteins is critical for the cellular response to a variety of stresses (32). In particular, JNK has emerged not only as a central metabolic regulator in obesity-related insulin resistance but also to lipoapoptosis in a number of cell types, including hepatocytes (8, 33, 34). In the present study, palmitate, but not oleate, induced activation of JNK. Insulin, at concentrations that prevented both caspase-3 activation and DNA fragmentation, also prevented palmitate-mediated activation of JNK. SP600125 also prevented palmitate-mediated JNK activation but only partially reduced the resulting apoptosis. These data are in general agreement with a recent report performed in mouse primary hepatocytes and HepG2 cells in which it was concluded that free fatty acid-mediated lipoapoptosis was, in part, JNK dependent. The results from the present study suggest that insulin-mediated protection from lipoapoptosis involves both JNK-dependent and -independent mechanisms. It is also possible that the role of JNK inhibition may be more or less important at lower doses of insulin.

In hepatocytes, elevated free fatty acids activate JNK and recruit components of the core mitochondrial proapoptotic machinery, namely the Bcl-2 proteins Bcl-2-interacting mediator of cell death and Bcl-2-associated X protein (8). It is presently unclear whether lipid-mediated ER stress and UPR activation contributes directly to lipoapoptosis in hepatocytes. There are at least three ER-based mechanisms that could contribute to lipoapoptosis; these include up-regulation and activation of the proapoptotic factor CHOP, activation of the ER-associated caspase-12, and efflux of calcium from the ER lumen. The contribution of each of these mechanisms to lipoapoptosis in hepatocyte is currently under investigation.

Cellular models that investigate the effects of individual fatty acid species are distinct from in vivo conditions, in which a mixture of fatty acids is always present, and thus must be interpreted accordingly (11, 35, 36). It has been estimated that palmitate represents 25–30% of the total circulating free fatty acid concentration; thus, the concentration of palmitate used in the present study likely falls within the physiological range for this fatty acid in the circulation of obese, hyperlipidemic, and/or diabetic individuals (37).

In both humans and animals, strong relationships have been demonstrated among visceral adiposity, insulin resistance, and hepatic steatosis (26, 27, 38, 39, 40). Loss of insulin signaling in hepatocytes, via liver specific insulin receptor knockout in mice, leads to insulin resistance and progressive hepatic dysfunction, including increased aspartate aminotransferase and alkaline phosphatase (41). It is therefore important to examine whether and how insulin signaling contributes to the progression of pure steatosis to NASH (42). Results from the present study demonstrate that noninsulin- and insulin-mediated PI3-kinase signaling are important determinants of saturated fatty acid-induced apoptosis in liver cells. Because NASH is characterized by increased hepatocyte apoptosis (4, 5), these data have implications for the development and/or exacerbation of lipid-mediated liver injury in insulin deficient and/or resistant states.


    Footnotes
 
This work was supported by National Institute of Diabetes and Digestive and Kidney Disease Grants DK-072017 and DK-47416.

Disclosure Statement: The authors have nothing to declare.

First Published Online April 12, 2007

Abbreviations: CHOP, CCAAT/enhancer-binding protein homologous protein; cIAP2, inhibitor of apoptosis protein-2; EDEM; ER-degradation enhancing {alpha}-mannosidase-like protein; ER, endoplasmic reticulum; GADD34, growth arrest and DNA damage-inducible protein 34; GRP78, glucose-regulated protein 78; IAP, inhibitor of apoptosis protein; IRE1, inositol-requiring ER-to-nucleus signaling protein-1; JNK, c-Jun NH2 terminal kinase; NAFLD, nonalcoholic fatty liver disease; NASH, nonalcoholic steatohepatitis; PERK, protein kinase-like ER eIF2{alpha} kinase; PI, phosphatidylinositol; UPR, unfolded protein response; XIAP, X-linked mammalian inhibitor of apoptosis protein.

Received December 19, 2006.

Accepted for publication April 4, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Clark JM, Diehl A 2003 Nonalcoholic fatty liver disease: an underrecognized cause of cryptogenic cirrhosis. JAMA 289:3000–3004[Abstract/Free Full Text]
  2. Festi D, Colecchia A, Sacco T, Bondi M, Roda E, Marchesini G 2004 Hepatic steatosis in obese patients: clinical aspects and prognostic significance. Obes Rev 5:27–42[CrossRef][Medline]
  3. Day CP, James O 1998 Steatohepatitis: a tale of two "hits"? Gastroenterology 114:842–845[CrossRef][Medline]
  4. Feldstein AE, Canbay A, Angulo P, Taniai M, Burgart LJ, Lindor KD, Gores GJ 2003 Hepatocyte apoptosis and fas expression are prominent features of human nonalcoholic steatohepatitis. Gastroenterology 125:437–443[CrossRef][Medline]
  5. Wieckowska A, Zein NN, Yerian LM, Lopez AR, McCullough AJ, Feldstein AE 2006 In vivo assessment of liver cell apoptosis as a novel biomarker of disease severity in nonalcoholic fatty liver disease. Hepatology 44:27–33[CrossRef][Medline]
  6. de Vries JE, Vork MM, Roemen TH, de Jong YF, Cleutjens JP, van der Vusse GJ, van Bilsen M 1997 Saturated but not mono-unsaturated fatty acids induce apoptotic cell death in neonatal rat ventricular myocytes. J Lipid Res 38:1384–1394[Abstract]
  7. Listenberger LL, Ory DS, Schaffer JE 2001 Palmitate-induced apoptosis can occur through a ceramide-independent pathway. J Biol Chem 276:14890–14895[Abstract/Free Full Text]
  8. Malhi H, Bronk SF, Werneburg NW, Gores GJ 2006 Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis. J Biol Chem 281:12093–12101[Abstract/Free Full Text]
  9. Shimabukuro M, Zhou Y-T, Levi M, Unger RH 1998 Fatty acid-induced B cell apoptosis: a link between obesity and diabetes. Proc Natl Acad Sci USA 95:2498–2502[Abstract/Free Full Text]
  10. Wang D, Wei Y, Pagliassotti MJ 2006 Saturated fatty acids promote endoplasmic reticulum stress and liver injury in rats with hepatic steatosis. Endocrinology 147:943–951[Abstract/Free Full Text]
  11. Wei Y, Wang D, Topczewski F, Pagliassotti MJ 2006 Saturated fatty acids induce endoplasmic reticulum stress and apoptosis independently of ceramide in liver cells. Am J Physiol Endocrinol Metab 291:E275–E281
  12. Clark J, Diehl A 2002 Hepatic steatosis and type 2 diabetes mellitus. Curr Diab Rep 2:210–215[Medline]
  13. Machado M, Marques-Vidal P, Cortez-Pinto H 2006 Hepatic histology in obese patients undergoing bariatric surgery. J Hepatol 45:600–606[CrossRef][Medline]
  14. Colon E, Zaman F, Axelsson M, Larsson O, Carlsson-Skwirut C, Svechnikov KV, Soder O 2007 Insulin-like growth factor-I is an important anti-apoptotic factor for rat Leydig cells during postnatal development. Endocrinology 148:128–139[Abstract/Free Full Text]
  15. Dudek H, Datta SR, Franke TF, Birnbaum MJ, Yao R, Cooper GM, Segal RA, Hemmings BA 1997 Regulation of neuronal survival by the serine-threonine protein kinase Akt. Science 275:661–665[Abstract/Free Full Text]
  16. Gu X, Feng Y, Shi C, Li M, Fu Z, Zhang X 2005 Antiapoptotic mechanism of insulin in reoxygenation-induced injury in cultured cardiomyocytes of neonatal rats. J Huazhong Univ Sci Technolog Med Sci 25:632–635[Medline]
  17. Hu P, Han Z, Couvillon AD, Exton JH 2004 Critical role of endogenous Akt/IAPs and MEK1/ERK pathways in counteracting endoplasmic reticulum stress-induced cell death. J Biol Chem 279:49420–49429[Abstract/Free Full Text]
  18. Berry M, Friend D 1969 High-yield preparation of isolated rat liver parenchymal cells. A biochemical and fine structural study. J Cell Biol 43:506–519[Abstract/Free Full Text]
  19. Wang D, Wei Y, Schmoll D, Maclean KN, Pagliassotti MJ 2006 Endoplasmic reticulum stress increases glucose-6-phosphatase and glucose cycling in liver cells. Endocrinology 147:350–358[Abstract/Free Full Text]
  20. Muller PY, Janovjak H, Miserez AR, Dobbie Z 2002 Processing of gene expression data generated by quantitative real-time RT-PCR. Biotechniques 32:1372–1379[Medline]
  21. Bialik S, Geenen DL, Sasson IE, Cheng R, Horner JW, Evans SM, Lord EM, Koch CJ, Kitsis RN 1997 Myocyte apoptosis during acute myocardial infarction in the mouse localizes to hypoxic regions but occurs independently of p53. J Clin Invest 100:1363–1372[Medline]
  22. Kharroubi I, Ladriere L, Cardozo AK, Dogusan Z, Cnop M, Eizirik DL 2004 Free fatty acids and cytokines induce pancreatic B-cell apoptosis by different mechanisms: role of nuclear factor-KB and endoplasmic reticulum stress. Endocrinology 145:5087–5096[Abstract/Free Full Text]
  23. Kaufman RJ 1999 Stress signaling from the lumen of the endoplasmic reticulum: coordination of gene transcriptional and translational controls. Genes Dev 13:1211–1233[Free Full Text]
  24. Srivastava RK, Sollott SJ, Khan L, Hansford R, Lakatta EG, Longo DL 1999 Bcl-2 and Bcl-X(L) block thapsigargin-induced nitric oxide generation, c-Jun NH(2)-terminal kinase activity, and apoptosis. Mol Cell Biol 19:5659–5674[Abstract/Free Full Text]
  25. Marchesini G, Brizi M, Morselli-Labate AM, Bianci G, Bugianesi E, McCullough AJ, Forlani G, Melchionda N 1999 Association of nonalcoholic fatty liver disease with insulin resistance. Am J Med 107:450–455[CrossRef][Medline]
  26. Samuel VT, Liu Z-X, Qu X, Elder BD, Bilz S, Befroy D, Romanelli AJ, Shulman GI 2004 Mechanism of hepatic insulin resistance in non-alcoholic fatty liver disease. J Biol Chem 279:32345–32353[Abstract/Free Full Text]
  27. Seppala-Lindroos A, Vehkavaara S, Hakkinen A-M, Goto T, Westerbacka J, Sovijarvi A, Halavaara J, Yki-Jarvinen H 2002 Fat accumulation in the liver is associated with defects in insulin suppression of glucose production and serum free fatty acids independent of obesity in normal men. J Clin Endocrinol Metab 87:3023–3028[Abstract/Free Full Text]
  28. Canbay A, Friedman S, Gores GJ 2004 Apoptosis: the nexus of liver injury and fibrosis. Hepatology 39:273–278[CrossRef][Medline]
  29. Natori S, Rust C, Stadheim LM, Burgart LJ, Gores GJ 2001 Hepatocyte apoptosis is a pathologic feature of human alcoholic hepatitis. J Hepatol 34:248–253[CrossRef][Medline]
  30. Hyoda K, Hosoi T, Horie N, Okuma Y, Ozawa K, Nomura Y 2006 PI3K-Akt inactivation induced CHOP expression in endoplasmic reticulum-stressed cells. Biochem Biophys Res Commun 340:286–290[Medline]
  31. Misra UK, Pizzo SV 2005 Up-regulation of GRP78 and antiapoptotic signaling in murine peritoneal macrophages exposed to insulin. J Leukoc Biol 78:187–194[Abstract/Free Full Text]
  32. Czaja MJ 2002 The future of GI and liver research: editorial perspectives III. JNK/AP-1 regulation of hepatocyte death. Am J Physiol Gastrointest Liver Physiol 284:G875–G879
  33. Lin A 2002 Activation of the JNK signaling pathway: breaking the brake on apoptosis. Bioessays 25:17–24
  34. Wellen KE, Hotamisligil GS 2005 Inflammation, stress, and diabetes. J Clin Invest 115:1111–1119[CrossRef][Medline]
  35. Listenberger LJ, Han X, Lewis SE, Cases S, Farese RV, Ory DS, Schaffer JE 2003 Triglyceride accumulation protects against fatty acid-induced lipotoxicity. Proc Natl Acad Sci USA 100:3077–3082[Abstract/Free Full Text]
  36. Moffitt JH, Fielding BA, Evershed R, Berstan R, Currie JM, Clark A 2005 Adverse physicochemical properties of tripalmitin in ß cells lead to morphological changes and lipotoxicity in vitro. Diabetologia 48:1819–1829[CrossRef][Medline]
  37. Bakan E, Yildirim A, Kurtul N, Polat MF, Dursun H, Cayir K 2006 Effects of type 2 diabetes mellitus on plasma fatty acid composition and cholesterol content of erythrocyte and leukocyte membranes. Acta Diabetol 8:109–113
  38. Angulo P 2002 Nonalcoholic fatty liver disease. N Engl J Med 346:1221–1231[Free Full Text]
  39. Bergman RN 1997 New concepts in extracellular signaling for insulin action: the single gateway hypothesis. Recent Prog Horm Res 52:359–385; discussion 385–387[Medline]
  40. Kelley DE, McKolanis TM, Hegazi RA, Kuller LH, Kalhan SC 2003 Fatty liver in type 2 diabetes mellitus: relation to regional adiposity, fatty acids, and insulin resistance. Am J Physiol Endocrinol Metab 285:E906–E916
  41. Michael MD, Kulkarni RN, Postic C, Previs SF, Shulman GI, Magnuson MA, Kahn CR 2000 Loss of insulin signaling in hepatocytes leads to severe insulin resistance and progressive hepatic dysfunction. Mol Cell 6:87–97[CrossRef][Medline]
  42. Farrell GC, Larter CZ 2006 Nonalcoholic fatty liver disease: from steatosis to cirrhosis. Hepatology 43:S99–S112




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
148/7/3338    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pagliassotti, M. J.
Right arrow Articles by Wang, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pagliassotti, M. J.
Right arrow Articles by Wang, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals