help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-1740
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shafiee-Kermani, F.
Right arrow Articles by Miller, W. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shafiee-Kermani, F.
Right arrow Articles by Miller, W. L.
Endocrinology Vol. 148, No. 7 3346-3355
Copyright © 2007 by The Endocrine Society

Chronic Gonadotropin-Releasing Hormone Inhibits Activin Induction of the Ovine Follicle-Stimulating Hormone ß-Subunit: Involvement of 3',5'-Cyclic Adenosine Monophosphate Response Element Binding Protein and Nitric Oxide Synthase Type I

Farideh Shafiee-Kermani, Sang-oh Han and William L. Miller

Department of Molecular and Structural Biochemistry, North Carolina State University, Raleigh, North Carolina 27695-7622

Address all correspondence and requests for reprints to: Dr. William L. Miller, Department of Molecular and Structural Biochemistry, Box 7622, North Carolina State University, Raleigh, North Carolina 27695-7622. E-mail: wlmiller{at}ncsu.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
FSH is induced by activin, and this expression is modulated by GnRH through FSHB expression. This report focuses on the inhibitory effect of GnRH on activin-induced FSHB expression. Activin-treated primary murine pituitary cultures robustly express mutant ovine FSHBLuc-{Delta}AP1, a luciferase transgene driven by 4.7 kb of ovine FSHB promoter. This promoter lacks two GnRH-inducible activator protein-1 sites, making it easier to observe GnRH-mediated inhibition. Luciferase expression from this transgene was decreased 94% by 100 nM GnRH with a half-time of approximately 4 h in pituitary cultures, and this inhibition was independent of follistatin. Activators of cAMP and protein kinase C like forskolin and phorbol 12-myristate 3-acetate (PMA), respectively, mimicked GnRH action. Kinetic studies of wild-type ovine FSHBLuc in LßT2 cells showed continuous induction by activin (4-fold) over 20 h. Most of this induction (78%) was blocked, beginning at 6 h. cAMP response element binding protein (CREB) was implicated in this inhibition because overexpression of its constitutively active mutant mimicked GnRH, and its inhibitor (inducible cAMP early repressor isoform II) reversed the inhibition caused by GnRH, forskolin, or PMA. In addition, GnRH, forskolin, or PMA increased the expression of a CREB-responsive reporter gene, 6xCRE-37PRL-Luc. Inhibition of nitric oxide type I (NOSI) by 7-nitroindazole also reversed GnRH-mediated inhibition by 60%. It is known that GnRH and CREB induce production of NOSI in gonadotropes and neuronal cells, respectively. These data support the concept that chronic GnRH inhibits activin-induced ovine FSHB expression by sequential activation of CREB and NOSI through the cAMP and/or protein kinase C pathways.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
FSH IS REQUIRED FOR NORMAL gonadal function in mammals (1, 2, 3). It is produced only in pituitary gonadotropes as an {alpha}/ß-heterodimer. The ß-subunit is in limiting amounts and thus controls the overall synthesis of FSH (4). Studies with rats and LßT2 cells suggest that activins are the primary inducers of FSHB gene expression (5, 6) and are produced in pituitaries (7).

Hypothalamic GnRH is another important inducer of FSH synthesis and release. Withdrawal of GnRH in rats causes serum FSH to fall 50% within 12 h (8). GnRH regulation is complex, however, because relatively slow pulses of GnRH (≤1 per hour) favor FSHB expression (9, 10, 11), whereas chronic treatment with GnRH decreases FSHB below control levels in vivo and in vitro (12, 13, 14, 15). In a physiological context, studies with ewes show that mRNA from FSHB expression declines 80%, whereas LHB and CGA expression are at their highest levels during the preovulatory LH surge (16) when GnRH levels are increased dramatically for a prolonged time period (17). This GnRH surge, which is not strictly episodic and is sustained chronically for 12–20 h (18), may be responsible for the decline in FSHB expression during this time.

With the exception of the preovulatory surge, GnRH normally pulses at approximately 1 pulse/h (19) and has been studied primarily as an inducer of all the gonadotropin subunit genes (CGA, LHB, and FSHB) or as a secretogogue. The positive effects of GnRH on secretion and transcription of gonadotropins are thought to involve activation of the G{alpha}q pathway (20, 21, 22, 23, 24). Our laboratory used in vitro and transgenic studies to identify two GnRH-responsive Jun/Fos binding sites (AP-1 enhancers at –120 and –83 bp) on the ovine promoter for FSHB. In pituitary cultures of transgenic mice carrying wild-type ovine FSHBLuc (wt-oFSHßLuc) (4.7 kb of ovine promoter for FSHB driving luciferase expression), GnRH (1 nM) increases activin-induced wt-oFSHßLuc expression by 2.5-fold within 4 h. When the AP-1 sites are destroyed to create the mutant ovine FSHBLuc-{Delta}AP1 (mut-oFSHßLuc-{Delta}AP1) transgene, and pituitary cultures from these mice were studied, we did not observe induction by GnRH under the same experimental conditions. Instead, we observed negative regulation of activin-induced mut-oFSHßLuc expression by GnRH (24).

This apparent inhibition of mut-oFSHßLuc-{Delta}AP1 by GnRH occurs within 4 h and might be dismissed as a simple down-regulation of the GnRH receptor or desensitization of the G{alpha}q pathway that normally leads to induction of FSHB. However, inhibition occurs in the same time frame as induction of the wild-type transgene (wt-oFSHßLuc) and therefore cannot reflect down-regulation or desensitization. This inhibition of activin-dependent expression of mut-oFSHßLuc-{Delta}AP1 by GnRH might also be dismissed as inhibition by follistatin that can be induced by GnRH (13, 25). However, the experiments are done in the presence of 300 ng/ml activin, which cannot possibly be inactivated by endogenous mouse follistatin made during the short (4 h) period of testing. Furthermore, if a rise in follistatin can cause this inhibition, it should also reduce wild-type expression as well, which does not happen. The question then is what undiscovered mechanism is responsible for the GnRH mediated inhibition of activin-induced FSHB expression? Here we examined the cellular pathways that mediated the negative control of activin-induced expression of ovine FSHB by the chronic presence of GnRH.

In addition to activating the G{alpha}q signaling pathway, GnRH can also couple to G{alpha}s and increase intracellular cAMP (26, 27, 28, 29). GnRH is known to activate cAMP response element binding protein (CREB) in the {alpha}T3 gonadotrope lineage (29). Whereas CREB is mainly phosphorylated by protein kinase A (PKA), studies show that protein kinase C (PKC) (30) can also phosphorylate CREB. Because GnRH can activate both pathways (G{alpha}s and G{alpha}q), it is not clear which pathway is responsible for CREB phosphorylation in {alpha}T3 cells (29). In fact, the effect of CREB activation on regulation of FSHB expression has not been studied to date.

Nitric oxide synthase type I (NOSI) is an enzyme that catalyses nitric oxide (NO) production from L-arginine. Studies show that GnRH can induce expression of NOSI exclusively in rat gonadotropes, which is correlated with a dramatic decrease in FSH secretion in rat pituitaries (31). Furthermore, studies using in situ hybridization and immunohistochemistry of rat pituitaries show that NOSI is present in gonadotropes (32, 33) and that changes in NOSI coincide with the pattern of GnRH release during proestrus in the rat (34). Finally, GnRH increases NO production in LßT2 cells (35), but the effect of NO on FSHB expression has not yet been studied.

This study was undertaken to confirm the original data that suggests GnRH can inhibit activin-induced expression of ovine FSHB (24) and discover the molecular mechanism(s) involved. Here we focused on CREB and NOSI as intermediates in the GnRH-activated cellular pathway leading to this inhibition. We also investigated the possible involvement of cAMP and/or PKC pathways in this process.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents and kits
Recombinant human activin A was obtained from R&D Systems (Minneapolis, MN) and was dissolved in PBS (pH 7.4) containing 0.1% serum albumin. Penicillin, streptomycin, collagenase, and [D-LYS (6)]GnRH (referred to as GnRH in this report and dissolved in 0.01 M acetic acid) were purchased from Sigma Chemical Co. (St. Louis, MO). Cholera toxin (CTX) was dissolved in water; 3-isobutyl-1-methylxanthine (IBMX) was reconstituted in dimethylsulfoxide (DMSO); forskolin was dissolved in DMSO; 7-nitroindazole (7-NI) was dissolved in DMSO, and all these reagents were purchased from Biomol International L.P. (Plymouth Meeting, PA). Pituitary adenylyl cyclases activating polypeptide (PACAP)-38 (dissolved in 1 M acetic acid) was purchased from Calbiochem Biosciences Inc. (La Jolla, CA). 8-Bromoadenosine-3',5'-cyclic monophosphorothioate, SP isomer (Sp-8-Br-cAMPS; dissolved in water) was purchased from Biolog-Life Science Institute (Bremen, Germany). Pancreatin and medium 199 were obtained from Life Technologies Inc. (Grand Island, NY). DMEM was obtained from Invitrogen (Carlsbad, CA). Fetal bovine serum was purchased from Hyclone Laboratories Inc. (Logan, UT). Fugene6 was obtained from Roche Molecular Biochemicals (Basal, Switzerland). QuikChange site-directed mutagenesis kit was obtained from Stratagene (La Jolla, CA). Tri-reagent was purchased from Molecular Research Center, Inc. (Cincinnati, OH). Passive lysis buffer and luciferase assay system were obtained from Promega (Madison, WI). The iScript DNA synthesis kit was obtained from Bio-Rad Laboratories (Hercules, CA).

Reporter plasmids and expression vectors
The wild-type ovine FSHB promoter/reporter plasmid (wt-oFSHßLuc), which was transiently expressed in LßT2 cells in this study, was described previously (36). Briefly, it contained 4.7 kb of the ovine FSHB promoter plus intron 1 driving expression of a luciferase gene in the GL3 basic vector. The mutant ovine FSHBLuc-{Delta}AP1 (mut-oFSHß-{Delta}AP1) transgene expressed in transgenic mice in this study was derived from wt-oFSHßLuc by mutating two AP-1 sites at –120 and –83 bp. This construct was also described previously (24).

The construct used as a wild-type gene to make transgenic mice in this study (Ljwt-oFSHßLuc) was derived from the original wt-oFSHßLuc construct that was used to produce wild-type transgenic mice reported previously (36). The original wild-type mice were replaced by the Ljwt-oFSHßLuc transgenic mice that also expressed high levels of luciferase specifically in pituitaries, and luciferase expression was regulated by activin, follistatin, and GnRH in a similar manner. These new lines contained two distal 5' deletions (from –4736 to –3980 bp and –3398 to –2817 bp). Except for the description in this section, Ljwt-oFSHßLuc is referred to as wt-oFSHßLuc throughout this study because its expression and regulation were indistinguishable from the wild-type constructs already reported in transgenic mice (36).

The expression vector, 6xCRE-37PRL-Luc (6xCRE-Luc), was provided by Dr. Richard N. Day (Department of Medicine and Cell Biology, University of Virginia, Charlottesville, VA). The expression construct pCFY/F CREB was provided by Dr. Marc Montminy (The Salk Institute for Biological Studies, La Jolla, CA), and the expression vector ICERII was provided by Dr. Kelly E. Mayo (Center for Reproductive Science, Northwestern University, Evanston, IL).

Transgenic mice
All transgenic mice were maintained and studied with the approval and oversight of the Institutional Animal Care and Use Committee at the University of North Carolina, Chapel Hill, NC, or North Carolina State University. Mice containing Ljwt-oFSHßLuc were produced as described earlier (36) at the transgenic mouse facility at the University of North Carolina. All transgenic mice were bred and cared for at the Biological Resource Facility of North Carolina State University. Testing mice for the presence of a transgene was performed as previously reported (36).

Pituitary cell cultures
Transgenic mice between 7 and 40 wk old were killed, and their pituitaries were dissected and dispersed into single cell suspensions as described elsewhere (36). Briefly, the pituitaries were cut into small pieces and digested with collagenase and Pancreatin. The yield was approximately 0.5 x 106 cells/pituitary, and cells were plated in 96-well Primaria tissue culture plates (Becton Dickinson & Co., Franklin Lakes, NJ) at a density of 30,000 cells/well and allowed to attach for 2 d at 37 C under 5% CO2 in a humidified chamber before treatments. The cells were treated with drugs at the indicated doses and times described in the figure legends. Cells were terminated by lysis in 30 µl of 1x passive lysis buffer, and 15 µl of each cell lysate was assayed for luciferase activity. All of the experiments were performed at least three times and each assayed in triplicate. Although activins are produced in pituitary cell cultures as autocrine/paracrine factors, all the experiments in pituitary cell cultures or LßT2 cells were done in the presence of 50 ng/ml activin to ensure the maximal induction of FSHB-associated genes to maintain consistency from preparation to preparation. The only exception was for basal expression of wt-oFSHßLuc in LßT2 cells. The concentration of activin used in this report is in the range reported by us and others (25–300 ng/ml) (6, 15, 24). The maximum concentration of GnRH used in our experiments was 100 nM, which is also in the range used by us and others in static cultures (0.01–100 nM) (13, 15, 24). The 20-h period of our experiments was chosen for optimal results and approximates the length of the GnRH surge in ewes (17, 18). The concentration of 7-nitroindazole was also in the normal range of its usage (37).

LßT2 cell cultures
Immortalized murine LßT2 gonadotropes were provided by Dr. Pamela L. Mellon (University of California, San Diego, San Diego, CA). They were grown to 80% confluency in 75-cm2 flasks containing DMEM supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin under 5% CO2 in a humidified incubator at 37 C. Cells were then cultured in 96-well Primaria cell culture plates at a density of approximately 25,000 cells/well. Cells were allowed to attach overnight before transfection according to the manufacturer’s instruction, using 0.15 µl Fugene6 for 50 ng of plasmids/well. After 24 h of transfection, the media were replaced with fresh DMEM containing different treatments for the indicated times as described in each figure legend. Cells were then lysed using 30 µl of passive lysis buffer, and 15 µl of cell lysates were assayed for luciferase activity. Experiments were repeated at least three times and each experiment was assayed in triplicate.

Luciferase assay
Luciferase activity was measured by combining 50 µl of the luciferase assay system with 15 µl of each cell lysate. Activity was measured for 20 sec using an automated Victor-Light microplate luminometer no. 1420 (PerkinElmer, Boston, MA). The luciferase activity is reported as relative light units.

Real-time rt-PCR (RT-rtPCR)
Total RNA was isolated from mouse primary pituitary cells using Tri-reagent and converted to cDNA using an iScript cDNA synthesis kit as reported previously (38). Oligonucleotides for Taqman RT-rtPCR were designed for murine cDNA using software from Integrated DNA Technologies, Inc. (Coralville, IA). Murine 18s rRNA served as an internal control. The probes were 5'-labeled with FAM. The PCR primers and probes for RNA for mouse FSHB and 18s rRNA were reported previously (38). The primers and probes for mouse follistatin were 5'-CCTCCTGCTGCTGCTACTCT (forward), CTCTTCCTTGCTCAGTTCTGTCTT (reverse), and CAGTTCATGGAGGACCGCAGCGCC (probe). RT-rtPCR was performed in duplicate on triplicate cDNA samples using an iCycler from Bio-Rad Laboratories. Samples were incubated at 95 C for 3 min and then for 40 complete cycles (95 C for 30 sec, 55 C for 30 sec, and 72 C for 3 min). There was a final extension step of 72 C for 3 min. Threshold cycle values were determined with Bio-Rad software and used for relative quantitation with the 2-{Delta}{Delta}Ct method (38).

Statistical analysis
Statistical calculations were performed using Prism version 4 (GraphPad Software, Inc., San Diego, CA). The data shown are the averages of at least three independent experiments, each assayed in triplicate. The mean ± SEM are reported in all figures. Significant differences between two means were calculated using the unpaired t test and comparisons of more than 2 means used one-way ANOVA, followed by Tukey’s post hoc test. P < 0.05 was considered a significant difference.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GnRH inhibited activin induction of wt-oFSHßLuc, mut-oFSHßLuc-{Delta}AP1, and endogenous FSHß in mouse pituitary cultures
To investigate the effect of sustained GnRH administration on activin-induced FSHB expression, we cultured pituitary cells from mice carrying transgenes for either wt-oFSHßLuc or mut-oFSHßLuc-{Delta}AP1 and treated them for 20 h with activin alone or activin with increasing amounts of GnRH. Promoter activity of wt-oFSHßLuc was inhibited as much as 60% in a dose-dependent manner (Fig. 1AGo). Expression of mut-oFSHßLuc-{Delta}AP1 was also inhibited in a dose-dependent manner to an even greater extent (94%) with an EC50 of 0.1 nM (Fig. 1AGo). mRNA from the endogenous mouse FSHB gene was measured by RT-rtPCR and also found inhibited by 50% (Fig. 1BGo). Kinetic studies showed that GnRH-mediated inhibition of mut-oFSHßLuc-{Delta}AP1 was significant at 2 h and reached 85% at 20 h with a half-time of approximately 4 h (Fig. 1CGo).


Figure 1
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 1. GnRH inhibited activin-induced wt-oFSHßLuc, mut-oFSHßLuc-{Delta}AP1, and endogenous mouse FSHß. A, Pituitary cells from transgenic mice carrying wt-oFSHßLuc ({blacksquare}) or mut-oFSHßLuc-{Delta}AP1 ({blacktriangleup}) were dispersed and plated at a density of 30,000/well. After 2 d, the cells were treated with 50 ng/ml of activin or activin (50 ng/ml) plus increasing concentrations of GnRH (0.01–100 nM) for 20 h. Cell lysates were assayed for luciferase activity. The activity is reported as percent inhibition of activin-induced control. B, Primary mouse pituitary cells were treated with activin (50 ng/ml) or activin (50 ng/ml) plus 100 nM GnRH for 20 h. Mouse FSHB mRNA was measured using RT-rtPCR as described in Materials and Methods. C, Pituitary cells from mouse harboring mut-oFSHßLuc-{Delta}AP1 were cultured as above and then activin (50 ng/ml) and GnRH (100 nM) were added at the indicated time intervals. Cell lysates were assayed for luciferase. Luciferase activity and mRNA levels are reported as the mean ± SEM of three independent experiments, each performed in triplicate. RLU, Relative light units. Means that do not share letters are significantly different from each other (P < 0.05).

 
Forskolin or phorbol 12-myristate 13-acetate (PMA) mimicked GnRH in mouse pituitary cultures
It is known that GnRH can activate both G{alpha}q/PKC and G{alpha}s/PKA signaling pathways in gonadotropes. We initially studied the PKA pathway to determine whether it could inhibit activin-dependent FSHB expression because the G{alpha}q/PKC pathway has always been associated with induction of FSHB expression. We compared the effect of forskolin, a potent stimulator of cAMP synthesis and CREB activation (39), with the effect of GnRH. Cells were treated for 20 h with activin alone or activin plus increasing concentrations of forskolin for 20 h (Fig. 2AGo). Forskolin inhibited the induction of mut-oFSHßLuc-{Delta}AP1 in a dose-dependent manner and to the same extent as GnRH (94%).


Figure 2
View larger version (6K):
[in this window]
[in a new window]

 
FIG. 2. Forskolin or PMA inhibited activin-induced expression of mut-oFSHßLuc-{Delta}AP1. Mouse pituitary cells were processed as in Fig. 1Go and then treated with 50 ng/ml activin or 950 ng/ml activin plus increasing concentrations of either forskolin (A) or PMA (B) for 20 h. Because culture media containing forskolin and PMA also contained 0.01% DMSO, the same amount of DMSO was added to control media as well. Luciferase activity is reported as the mean ± SEM of three independent experiments, each performed in triplicate. RLU, Relative light units.

 
Because we were curious about the effect of long-term induction of PKC on ovine FSHB expression, we also used PMA, a potent PKC activator (40). Cells were treated for 20 h with activin alone or activin plus increasing concentrations of PMA (Fig. 2BGo). PMA also inhibited activin-induced mut-oFSHßLuc-{Delta}AP1, although to a lesser degree (55%) than GnRH or forskolin. It is of note that because we were interested in studying inhibition caused by cAMP and PKC activators, we chose mouse pituitary cultures harboring mut-oFSHßLuc-{Delta}AP1 that do not respond to positive regulation through activator protein (AP-1) sites to study the effect of these reagents in this and the next section. This enabled us to generate data that reflected only negative regulation by GnRH.

Sp-8-Br-cAMP, IBMX, CTX, and PACAP also mimicked GnRH in mouse pituitary cultures
To further test the ability of G{alpha}s and G{alpha}q signaling pathways to inhibit expression of mut-oFSHßLuc-{Delta}AP1, primary cell cultures were treated with: 1) a cell-permeable analog of cAMP (Sp-8-Br-cAMP) (Fig. 3AGo); 2) a phosphodiesterase inhibitor (IBMX), which increases steady-state levels of cAMP by decreasing its hydrolysis (Fig. 3BGo); 3) CTX, which acts as a constitutive activator of G{alpha}s to stimulate adenylyl cyclase (Fig. 3CGo); and 4) PACAP, which increases intracellular cAMP and also activates PKC (Fig. 3DGo) (41, 42, 43, 44, 45). All treatments were done for 20 h in the presence of activin. All these reagents inhibited mut-oFSHßLuc-{Delta}AP1 in a dose-dependent manner similar to that of GnRH.


Figure 3
View larger version (12K):
[in this window]
[in a new window]

 
FIG. 3. Inhibition of mut-oFSHßLuc-{Delta}AP1 by Sp-8-Br-cAMP and other reagents that increase intracellular cAMP (IBMX, CTX) or cAMP and PKC (PACAP). A–D, Transgenic mouse pituitary cultures were processed as in Fig. 1Go and treated with 50 ng/ml of activin or activin plus 10–1000 µM of Sp-8-Br-cAMP, 33–1000 µM of IBMX, 0.0005–5 µg/ml of CTX, or 0.01–33 nM of PACAP for 20 h. Luciferase activity is reported as the mean ± SEM of three independent experiments, each performed in triplicate. RLU, Relative light units.

 
GnRH did not increase endogenous follistatin mRNA in mouse pituitary cultures
Some reports show that GnRH delivered in rapid pulses or continuously in rat pituitary cultures can induce follistatin gene expression that, in turn, inhibits FSHB expression through bioneutralization of activin (13, 25). To assess the increase of endogenous follistatin expression by GnRH in mouse pituitary cultures, we treated cells for 10 or 20 h with 100 nM GnRH in the presence of activin. We performed RT-rtPCR to quantitate mouse follistatin mRNA. Follistatin mRNA was detected but at a low level, and no significant increase was observed during treatments (Fig. 4Go).


Figure 4
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 4. GnRH did not increase follistatin expression in mouse pituitary cultures. Transgenic mouse pituitaries were processed as in Fig. 1Go. The cells were then treated with activin (50 ng/ml) for 20 h. and GnRH was added at time intervals shown in the figure. Mouse follistatin mRNA levels were measured using RT-rtPCR as described in Materials and Methods. The mRNA levels are reported as the mean ± SEM of three independent experiments, each performed in triplicate. Means that do not share letters are significantly different from each other (P < 0.05).

 
GnRH inhibited activin induction of wt-oFSHßLuc in LßT2 cells
To further analyze inhibition of activin-induced wild-type ovine FSHB expression by GnRH and elucidate the pathway(s) and intermediate molecules involved in this inhibition, LßT2 transformed gonadotropes were used because they provided a pure gonadotrope cell population that could be used for transfection studies in this and the following sections. To show that LßT2 cells mimicked primary gonadotropes, they were transiently transfected with wt-oFSHßLuc and treated with increasing concentrations of GnRH for 20 h in the presence or absence of activin. Basal expression of wt-oFSHßLuc (no activin treatment) neither increased nor decreased significantly after GnRH treatment, but activin-induced expression of wt-oFSHßLuc decreased by 60% in a dose-dependent manner (Fig. 5AGo).


Figure 5
View larger version (12K):
[in this window]
[in a new window]

 
FIG. 5. GnRH inhibits activin-induced expression of wt-oFSHßLuc in LßT2 cells but not the basal expression. LßT2 cells were cultured at a density of 25,000 cells/well overnight. Cells were then transfected with 50 ng of wt-oFSHßLuc/well. A, Cells were then treated with 50 ng/ml activin plus increasing concentrations of GnRH ({blacksquare}) or increasing concentrations of GnRH alone for 20 h ({blacktriangleup}). B, After 24 h of transfection, the cells were treated with 50 ng/ml activin ({blacksquare}) or activin plus 100 nM GnRH ({square}) at the indicated time intervals. Luciferase activity is reported as the mean ± SEM of three independent experiments, each performed in triplicate. RLU, Relative light units.

 
For time-course studies, we treated transfected LßT2 cells with activin alone or activin with 100 nM GnRH for the indicated time intervals. Activin induced wt-oFSHßLuc continuously over a 20-h period, and induction eventually reached 400% above basal expression at 20 h. GnRH had no effect for the first 6 h (induction during this time increased expression by 90% over basal expression), but thereafter GnRH completely inhibited further induction (Fig. 5BGo). It is of note that expression of pSV40Luc, TK109Luc, or 6xCRE-Luc in LßT2 cells were always induced by GnRH in the presence or absence of activin (data not shown).

GnRH, forskolin, and PMA induced 6xCRE-Luc expression in LßT2 cells
Phosphorylation of CREB on its serine 133 is generally accomplished by PKA after an increase in cAMP. Activated CREB can then bind cAMP response elements (CRE) to induce gene expression (46). Because CREB can also be phosphorylated by PKC in some cells (30) and GnRH in gonadotrope {alpha}T3 cells (29), we used a cAMP-responsive plasmid in LßT2 cells to determine whether GnRH, forskolin, or PMA could activate gene expression through CREs.

Cells were transiently transfected with a plasmid containing six tandem CREs linked to a prolactin minimal promoter fused to a luciferase gene (6xCRE-Luc). Cells were then treated for 20 h with activin alone or activin with increasing concentrations of GnRH, forskolin, or PMA. Activin alone had no significant effect on 6xCRE-Luc expression (data not shown). Forskolin up to 1 µM induced 6xCRELuc in a dose-dependent manner but at higher concentrations (10 µM) decreased the induction dramatically. GnRH (Fig. 6AGo), forskolin (Fig. 6BGo), and PMA (Fig. 6CGo) induced the expression of the reporter gene 25-, 14-, and 6-fold, respectively. Time-course studies showed that the induction of 6xCRELuc by 100 nM GnRH at 1.5 h was equal to that of 20 h, but the peak induction was at 8 h, which was 8.5-fold above that of 20 h (data not shown).


Figure 6
View larger version (7K):
[in this window]
[in a new window]

 
FIG. 6. GnRH, forskolin and PMA-induced transcription of 6xCRE-37PRL-Luc in LßT2 cells. A–C, LßT2 cells were processed as in Fig. 5Go and were transfected with 50 ng of 6xCRE-Luc/well. After 24 h of transfection, the cells were treated with 50 ng/ml of activin alone or activin plus the increasing concentrations of GnRH (0.01–100 nM), forskolin (0.01–10 µM), or PMA (0.1–100 nM) for 20 h. Because culture media containing forskolin and PMA also contained 0.01% DMSO, the same amount of DMSO was added to control media as well. Luciferase activity is reported as the mean ± SEM of three independent experiments, each performed in triplicate.

 
Constitutively active CREB inhibited activin induction of wt-oFSHßLuc in LßT2 cells
Once phosphorylated on Ser 133, CREB is activated and promotes the transcription of target genes (46). A constitutively active CREB (pCF Y/F CREB) has a Tyr134->Phe mutation that enables it to maintain high levels of constitutive Ser 133 phosphorylation in vivo (47). We used an expression plasmid containing this CREB mutant to probe the possible involvement of CREB in the signaling pathway used by GnRH to inhibit induction of wt-oFSHßLuc. LßT2 cells were cotransfected with wt-oFSHßLuc plus increasing amounts of pCF Y/F CREB and then treated with activin for 20 h. Overexpression of pCF Y/F CREB dose-dependently reduced activin induction of wt-oFSHßLuc activity that reached 78%, which mimicked the effect of GnRH (Fig. 7Go). Overexpression of constitutively active CREB did not inhibit basal expression. In fact, it stimulated it, although marginally (~70%) (data not shown). These data are consistent with the concept that CREB is in the signaling pathway used by GnRH to inhibit activin-induced wt-oFSHßLuc.


Figure 7
View larger version (16K):
[in this window]
[in a new window]

 
FIG. 7. Overexpression of pCF Y/F CREB inhibited activin-induced expression of wt-oFSHßLuc, and overexpression of ICERII reversed inhibition caused by GnRH, forskolin, or PMA in LßT2 cells. Cells were processed as in Fig. 5Go. A, Cells were transfected with 50 ng of wt-oFSHßLuc/well plus increasing amounts of pCF Y/F CREB (10–100 ng). The DNA amount was kept constant in all wells by using the empty vector. After 24 h, the cells were treated with 50 ng/ml of activin for 20 h. B–D, LßT2 cells were cotransfected with 50 ng of wt-oFSHßLuc/well plus increasing amounts of ICERII (40–160 ng). The DNA amount was kept constant in all the wells by using the empty vector. After 24 h of transfection, the cells were treated with 50 ng/ml activin alone or activin plus 100 nM GnRH, 1 µM forskolin, or 100 nM PMA for 20 h. Because forskolin and PMA treatments contained 0.01% DMSO, the same amount of DMSO was also added to control wells. Luciferase activity is shown as fold induction, which is reported as the mean ± SEM of three independent experiments, each performed in triplicate. RLU, Relative light units. Means that do not share letters are significantly different from each other (P < 0.05).

 
Inducible cAMP early repressor (ICER) II reversed the inhibition of wt-oFSHßLuc caused by GnRH, forskolin, and PMA in LßT2 cells
One of the well-characterized inhibitors of CREB is ICER (46), which produces four isoforms by alternative splicing (ICERI, -I{gamma}, -II, -II{gamma}). These isoforms can bind to CRE or CRE-like elements and may differ in their modes of action as repressors (48).

To determine whether inhibiting CREB could prevent the inhibitory effect of GnRH, we cotransfected LßT2 cells with wt-oFSHßLuc and increasing amounts of ICERII. Cells were then treated for 20 h with activin alone or activin and 100 nM GnRH. ICERII partially, but significantly (49%), reversed the inhibition caused by GnRH (Fig. 7BGo) without affecting activin-induced expression of wt-oFSHßLuc (data not shown). Next, we examined the effect of ICERII on inhibition caused by forskolin and PMA. We cotransfected LßT2 cells with wt-oFSHßLuc and increasing amounts of ICERII expression plasmid and treated them for 20 h with activin alone, activin plus forskolin (1 µM), or activin plus PMA (100 nM). Whereas the effect of forskolin was significantly reversed, compared with the reversal observed for the effect of GnRH (Fig 7CGo), the inhibition by PMA was completely reversed and expression of wt-oFSHßLuc even exceeded control levels (Fig. 7DGo).

7-NI reversed the inhibitory effect of GnRH in LßT2 cells
GnRH increases expression of the NOSI gene in rat gonadotropes, and this increase is accompanied by a dramatic decrease in FSH release. GnRH also increases NO in LßT2 cells (31, 32, 33, 34, 35). We used a NOSI-specific inhibitor (7NI) along with activin and GnRH in transient transfections of LßT2 cells to determine whether NOSI might participate in GnRH-mediated inhibition of wt-oFSHßLuc. We transfected LßT2 cells with wt-oFSHßLuc and then treated them for 20 h with activin alone, activin with 100 nM GnRH, or activin with GnRH and increasing amounts of 7-NI up to 250 µM. The inhibition of wt-oFSHßLuc caused by GnRH was significantly (60%) reversed by 7-NI (Fig. 8Go). At 250 µM, 7-NI did not significantly affect basal or activin-induced expression of wt-oFSHßLuc, but at 1 mM, it significantly inhibited both basal and activin-induced expression (data not shown).


Figure 8
View larger version (11K):
[in this window]
[in a new window]

 
FIG. 8. 7-NI reversed the inhibition caused by GnRH. LßT2 cells were processed as in Fig. 5Go and were transfected with wt-oFSHßLuc (50 ng/well). Cells were then treated with activin (50 ng/ml) or activin plus GnRH (100 nM) and increasing concentrations of 7-NI (10–250 µM). Because 7-NI was dissolved in DMSO, the experiment was designed in such a way that all the wells contained the same amount of DMSO (0.01%). Luciferase activity is reported as the mean ± SEM of three independent experiments, each performed in triplicate. RLU, Relative light units. Means that do not share letters are significantly different from each other (P < 0.05).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activins or activin-like family members are strong inducers of FSHB expression and are ever present in pituitary tissue to act as paracrine and/or autocrine factors to induce expression of FSHB (7). The role of GnRH is more complex because infrequent pulses induce FSHB, whereas chronic administration inhibits it in vivo and in vitro (9, 10, 11, 13, 16, 25, 49). Here we examined the mechanism by which GnRH inhibits activin-induced expression of FSHB and provided evidence that implicates activation of CREB and/or NOSI via cAMP and/or PKC signaling pathways.

We showed that chronic treatment with 100 nM GnRH can inhibit activin-induced expression of FSHB in mouse pituitary cultures and LßT2 cells. In fact, there is no evidence of inhibition without activin induction because GnRH did not affect basal expression of wt-oFSHßLuc in LßT2 cells. The data in Fig. 1AGo show that GnRH inhibited wt-oFSHßLuc and mut-oFSHßLuc-{Delta}AP1 in a dose-dependent manner in primary pituitary cultures obtained from transgenic mice. The two inhibition curves are different, however. The data from mut-oFSHßLuc-{Delta}AP1 show a typical semilogarithmic response with a well-defined IC50 of 0.1 nM and inhibition that reached 90% at 1 nM GnRH. The response curve for wt-oFSHßLuc was linear and inhibition was only 60% at 100 nM GnRH with no calculable EC50, suggesting that at least two underlying events were occurring. The only difference between the two transgenes was the presence or absence of two AP-1 enhancers associated with positive regulation by GnRH (23, 24). It is likely, therefore, that the inhibition curve for wild-type promoter reflects both induction and inhibition by GnRH, whereas the inhibition curve for the mutant promoter shows only inhibition. This composite situation might account for the 50% inhibition of endogenous mouse FSHB we observed (Fig. 1BGo), which might be regulated like wt-oFSHßLuc. In fact, this agrees with reports showing that chronic GnRH inhibits rat FSHß expression in vivo and pituitary cell cultures (12, 13, 14, 15). Hence, our data suggest that GnRH may regulate activin-induced expression of FSHB in the sheep, rat, and mouse using the same general mechanisms.

The results of dose-response studies using wt-oFSHßLuc in transient transfections of LßT2 cells were comparable with those using wt-oFSHßLuc as a transgene in primary pituitary cells, validating the suitability of LßT2 cells for studying the effects of GnRH on wt-oFSHßLuc. Our kinetic studies showed that 100 nM GnRH rapidly reversed activin-induced expression of the mut-oFSHßLuc-{Delta}AP1 in mouse pituitary cultures, had a significant impact as early as 2 h, and caused 60% inhibition by 4 h. This relatively rapid inhibition was similar to inhibition of the wt-oFSHßLuc that we reported previously. That earlier study shows that 100 nM GnRH inhibits activin induction of wt-oFSHßLuc 70% within 4 h (24). However, the kinetics of inhibition for wt-oFSHLuc in LßT2 cells was slower showing an inhibitory response after only 6 h. This might be explained by the fact that activin induction of the wt-oFSHßLuc is also slower in LßT2 cells because in this study activin slowly and progressively induced the wt-oFSHßLuc within 20 h in LßT2 cells, and the induction was only 50% within 4 h, whereas activin robustly induces the wt-oFSHßLuc (7-fold) in primary cultures within 4 h that was shown previously (24). The slower response in LßT2 cells might also be due to differences between the structure and conformation of transgene DNA that is integrated into chromosomes vs. plasmids that are extrachromosomal DNA.

Quantitation of endogenous follistatin mRNA in mouse pituitary cultures failed to show a significant change in follistatin gene expression during the time frame and culture conditions used in our studies. This is in contrast to other reports showing induction of follistatin expression by pulsatile (25) or continuous (13) GnRH in rat pituitary cultures. This difference might be caused by different experimental procedures and time frames used in those and this reports or might be caused by species specific differences between mice and rats.

Because the G{alpha}q/PKC pathway is reported to be involved in FSHB induction, we originally expected the G{alpha}s/PKA/CREB pathway to be responsible for the GnRH inhibitory effect. This expectation was corroborated by inhibition of activin-induced mut-oFSHßLuc-{Delta}AP1 caused by CTX, forskolin, IBMX, PACAP, and Sp-8-cAMP in mouse pituitary cultures. Furthermore, a constitutively active CREB also inhibited wt-oFSHßLuc induction in LßT2 cells the same as GnRH. In addition, the inhibitory effects of GnRH and forskolin on wt-oFSHßLuc in LßT2 cells were significantly and equally well reversed by ICERII (a naturally occurring CREB inhibitor). The possible involvement of the cAMP/PKA CREB pathway was strengthened by our observation that GnRH and forskolin could induce expression of 6xCRE-Luc by 25- and 14-fold, respectively, in transient transfections of LßT2 cells. Thus, all components we examined that are associated with activation of the G{alpha}s signaling pathway mimicked GnRH by inhibiting activin-induced expression of ovine FSHB in primary or transformed gonadotrope cultures.

Surprisingly, however, PMA (a potent activator of PKC) also mimicked the inhibitory effect of GnRH in pituitary cultures of transgenic mice and activated 6xCRE-Luc in LßT2 cells, although to a lesser degree. Additionally, the inhibition of wt-oFSHßLuc by PMA was reversed by ICERII in transient transfections of LßT2 cells. The inhibition of CREB by ICERII not only reversed the inhibitory effect of PMA but also increased wt-oFSHßLuc induction above control levels. These observations could be explained by the fact that PKC should have a dual effect on wt-oFSHßLuc expression: 1) an induction through activation of AP-1 transcription factors that increases expression of wt-oFSHßLuc (23) and 2) an inhibitory effect through induction of CREB. Because the inhibitory effect of PMA was not as dramatic as that of GnRH, it could be fully reversed by ICERII, allowing PMA-mediated induction to become dominant. In contrast, the inhibitory effect of GnRH was only partially reversed by ICERII. A possible explanation for this difference could be that PMA induces CREB only through PKC activation, whereas GnRH can activate CREB through both cAMP and PKC pathways. Indeed, the activators of cAMP and PKC pathways showed the same effect that mimicked the action of GnRH and inhibition of CREB reversed the inhibitory effect of these cAMP or PKC activators. Consequently, activation of these two pathways by GnRH might result in the activation of more CREB than can be completely inhibited by ICERII. Another explanation is that CREB activation might not be the only pathway that GnRH uses to inhibit activin-induced oFSHßLuc. In any case our results justify the conclusion that GnRH inhibited oFSHßLuc through the cAMP and/or PKC pathways, at least in part, by inducing CREB.

We observed dose-dependent reversal of the GnRH-mediated inhibition of activin-induced wt-oFSHßLuc expression up to 60% by the NOSI-specific inhibitor, 7-NI. This result implicated NOSI in the GnRH inhibitory pathway. This observation is consistent with reports showing that NOSI is present in gonadotropes and that its expression is induced by GnRH in these cells to inhibit FSH release (31, 32, 33, 34). It is also consistent with a previous study showing that 100 nM GnRH increases NO production within 2 h in LßT2 cells (35). Finally, these data are in agreement with the notion that CREB can induce NOSI expression in vivo and in vitro (50, 51). Indeed, 10 nM GnRH phosphorylates CREB in {alpha}T3 cells within 5 min, and this phosphorylation persists during the entire experimental period, which lasts 4 h (29). Our results led us to conclude that NOSI was responsible for a large part (60%) of the inhibition caused by GnRH.

In summary, our data support the hypothesis that chronic administration of 100 nM GnRH inhibits activin-induced ovine FSHB through either cAMP and/or PKC pathways that regulate activation of CREB followed by induction of NOSI expression.


    Acknowledgments
 
We thank Dr. Richard N. Day, Dr. Marc Montminy, and Dr. Kelly E. Mayo for generously providing the expression vectors for these studies. We also thank Dr. Pamela L. Mellon for LßT2 cells (see Materials and Methods) and Ms. Lara E. Marxreiter for her laboratory expertise throughout this work.


    Footnotes
 
This work was supported by National Institutes of Health Grant R01-HD-045429.

Disclosure Statement: The authors of this manuscript have nothing to declare.

First Published Online April 19, 2007

Abbreviations: AP, Activator protein; CRE, cAMP response element; CREB, cAMP response element binding protein; CTX, cholera toxin; DMSO, dimethylsulfoxide; IBMX, 3-isobutyl-1-methylxanthine; ICER, inducible cAMP early repressor; 7-NI, 7-nitroindazole; NO, nitric oxide; NOSI, nitric oxide synthase type I; PACAP, pituitary adenylyl cyclases activating polypeptide; PKA, protein kinase A; PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; RT-rtPCR, real-time rt-PCR; Sp-8-Br-cAMPS, 8-bromoadenosine-3',5'-cyclic monophosphorothioate, Sp isomer.

Received December 27, 2006.

Accepted for publication April 6, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kumar TR, Wang Y, Lu N, Matzuk MM 1997 Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nat Genet 15:201–204[CrossRef][Medline]
  2. Tapanainen JS, Aittomaki K, Min J, Vaskivuo T, Huhtaniemi IT 1997 Men homozygous for an inactivating mutation of the follicle-stimulating hormone (FSH) receptor gene present variable suppression of spermatogenesis and fertility. Nat Genet 15:205–206[CrossRef][Medline]
  3. Aittomaki K, Herva R, Stenman UH, Juntunen K, Ylostalo P, Hovotta O, de la Chapelle A 1996 Clinical features of primary ovarian failure caused by a point mutation in the follicle-stimulating hormone receptor gene. Clin Endocrinol Metab 81:3722–3726[CrossRef]
  4. Bousfield GR, Perry WM, Ward DN 1994 Gonadotropins: chemistry and biosynthesis. In Knobil E, Neill JD, eds. The physiology of reproduction. 2nd ed. Chap 30. New York: Raven Press; 1749–1792
  5. DePaolo LV, Shimonaka M, Schwall RH, Ling N 1991 In vivo comparison of the follicle-stimulating hormone-suppressing activity of follistatin and inhibin in ovariectomized rats. Endocrinology 128:668–674[Abstract/Free Full Text]
  6. Graham KE, Nusser KD, Low MJ 1999 LßT2 gonadotroph cells secrete follicle stimulating hormone (FSH) in response to activin A. J Endocrinol 162:R1–R5
  7. Bilezikjian LM, Blount AL, Leal AM, Donaldson CJ, Fischer WH, Vale WW 2004 Autocrine/paracrine regulation of pituitary function by activin, inhibin and follistatin. Mol Cell Endocrinol 225:29–36[CrossRef][Medline]
  8. Grady RR, Shin L, Charlesworth MC, Cohen-Becker IR, Smith M, Rivier C, Rivier J, Vale W, Schwartz NB 1985 Differential suppression of follicle-stimulating hormone and luteinizing hormone secretion in vivo by a gonadotropin-releasing hormone antagonist. Neuroendocrinology 40:246–252[Medline]
  9. Haisenleder DJ, Dalkin AC, Ortolano GA, Marshall JC, Shupnick MA 1991 A pulsatile gonadotropin-releasing hormone stimulus is required to increase transcription of the gonadotropin subunit genes: evidence for differential regulation of transcription by pulse frequency in vivo. Endocrinology 128:509–517[Abstract/Free Full Text]
  10. Haisenleder DJ, Dalkin AC, Marshall JC 1994 Regulation of gonadotropin gene expression. In: Knobil E, Neill JD, eds. The physiology of reproduction. 2nd ed. Chap 31. New York: Reven Press; 1793–1832
  11. Bedecarrats GY, Kaiser UB 2003 Differential regulation of gonadotropin subunit gene promoter activity by pulsatile gonadotropin-releasing hormone (GnRH) in perifused LßT2 cells: role of GnRH receptor concentration. Endocrinology 144:1802–1811[Abstract/Free Full Text]
  12. Attardi B, Keeping HS, Winters SJ, Kotsuji F, Troen P 1989 Effect of inhibin from primate Sertoli cells and GnRH on gonadotropin subunit mRNA in rat pituitary cell cultures. Mol Endocrinol 3:1236–1242[Abstract/Free Full Text]
  13. Fujii Y, Okada Y, Moore JP, Dalkin AC, Winters SJ 2002 Evidence that PACAP and GnRH down-regulate follicle-stimulating hormone-ß mRNA levels by stimulating follistatin gene expression: effects on folliculostellate cells, gonadotrophs and LßT2 gonadotroph cells. Mol Cell Endocrinol 192:55–64[CrossRef][Medline]
  14. Lerrant Y, Kottler ML, Bergametti F, Moumni M, Blumberg-Tick J, Counis R 1995 Expression of gonadotropin-releasing hormone (GnRH) receptor gene is altered by GnRH agonist desensitization in a manner similar to that of gonadotropin ß-subunit genes in normal and castrated rat pituitary. Endocrinology 136:2803–2808[Abstract]
  15. Melamed P, Abdul Kadir MN, Wijeweera A, Seah S 2006 Transcription of gonadotropin ß subunit genes involves cross-talk between the transcription factors and co-regulators that mediate actions of the regulatory hormones. Mol Cell Endocrinol 252:167–183[CrossRef][Medline]
  16. Leung K, Kim KE, Maurer RA, Landefeld TD 1988 Divergent changes in the concentrations of gonadotropin ß-subunit messenger ribonucleic acid during the estrous cycle of sheep. Mol Endocrinol 2:272–276[Abstract/Free Full Text]
  17. Moenter SM, Caraty A, Locatelli A 1991 Pattern of gonadotropin-releasing hormone (GnRH) secretion leading up to ovulation in the ewe: existence of a preovulatory GnRH surge. Endocrinology 129:1175–1182[Abstract/Free Full Text]
  18. Moenter SM, Brand RC, Karsch FJ 1992 Dynamics of gonadotropin-releasing hormone (GnRH) secretion during the GnRH surge: insights into the mechanism of GnRH surge induction. Endocrinology 130:2978–2984[Abstract/Free Full Text]
  19. Hotchkiss J, Knobil E 1994 The menstrual cycle and its neuroendocrine control. In: Knobil E, Neill J, eds. The physiology of reproduction. 2nd ed. New York: Reven Press; 711–749
  20. Reiss N, Llevi LN, Shacham S, Harris D, Senger R, Naor Z 1997 Mechanism of mitogen-activated protein kinase activation by gonadotropin-releasing hormone in the pituitary {alpha}T3-1 cell line: differential roles of calcium and protein kinase C. Endocrinology 138:1673–1682[Abstract/Free Full Text]
  21. Liu F, Austin DA, Mellon PA, Olefsky JM, Webster NJ 2002 GnRH activates ERK1/2 leading to the induction of c-fos and LHß protein expression in LßT2 cells. Mol Endocrinol 16:419–434[Abstract/Free Full Text]
  22. Strahl BD, Huang HJ, Pedersen NR, Wu JC, Ghosh BR, Miller WL 1997 Two proximal activating protein-1 binding sites are sufficient to stimulate transcription of the ovine follicle-stimulating hormone-ß gene. Endocrinology 138:2621–2631[Abstract/Free Full Text]
  23. Strahl BD, Huang HJ, Sebastian J, Ghosh BR, Miller WL 1998 Transcriptional activation of the ovine follicle-stimulating hormone ß-subunit gene by gonadotropin-releasing hormone: involvement of two activating protein-1-binding sites and protein kinase C. Endocrinology 139:4455–4465[Abstract/Free Full Text]
  24. Huang HJ, Sebastian J, Strahl BD, Wu JC, Miller WL 2001 Transcriptional regulation of the ovine follicle-stimulating hormone-ß gene by activin and gonadotropin-releasing hormone (GnRH): involvement of two proximal activator protein-1 sites for GnRH stimulation. Endocrinology 142:2267–2274[Abstract/Free Full Text]
  25. Burger LL, Dalkin AC, Aylor KW, Haisenleder DJ 2002 GnRH pulse frequency modulation of gonadotropin subunit gene transcription in normal gonadotropes-Assessment by primary transcript assay provides evidence for role of GnRH and follistatin. Endocrinology 143:3243–3249[Abstract/Free Full Text]
  26. Lariviere S, Garrel G, Simon V, Soh JW, Laverriere JN, Counis R, Cohen-Tannoudji J 2006 GnRH couples to cAMP pathway through novel PKC {delta} and {epsilon} in LßT2 gonadotrope cells. Endocrinology 148:1099–1107[CrossRef][Medline]
  27. Liu F, Usui I, Evans LG, Austin DA, Mellon PL, Olefsky JM, Webster NG 2002 Involvement of both Gq/11 and Gs proteins in gonadotropin-releasing hormone receptor-mediated signaling in LßT2 cells. J Biol Chem 277:32099–32108[Abstract/Free Full Text]
  28. Stanislaus D, Ponder S, Ji TH, Conn PM 1998 Gonadotropin-releasing hormone receptor couples multiple G proteins in rat gonadotrophs and in GGH3 cells: evidence from palmitoylation and overexpression of G proteins. Biol Reprod 59:579–586[Abstract/Free Full Text]
  29. Duan WR, Shin JL, Jameson JL 1999 Estradiol suppresses phosphorylation of cyclic adenosine 3', 5'-monophosphate response element binding protein (CREB) in the pituitary: evidence for indirect action via gonadotropin-releasing hormone. Mol Endocrinol 13:1338–1352[Abstract/Free Full Text]
  30. Xie H, Rothstein TL 1995 Protein kinase C mediates activation of nuclear cAMP response element-binding protein (CREB) in B lymphocytes stimulated through surface Ig. J Immunol 154:1717–1723[Abstract]
  31. Garrel G, Lerrant Y, Siriostis C, Berault A, Magre S, Bouchaud C, Counis R 1998 Evidence that gonadotropin-releasing hormone stimulates gene expression and levels of active nitric oxide synthase type I in pituitary gonadotrophs, a process altered by desensitization and, indirectly, by gonadal steroids. Endocrinology 139:2163–2170[Abstract/Free Full Text]
  32. Ceccatelli S, Hulting AL, Zhang X, Gustafsson L, Villar M, Hokfelt T 1993 Nitric oxide synthase in the rat anterior pituitary gland and the role of nitric oxide in regulation of luteinizing hormone secretion. Proc Natl Acad Sci USA 90:11292–11296[Abstract/Free Full Text]
  33. Yamada K, Xu ZQ, Zhang X, Gustafsson L, Hulting AL, de Vente J, Steinbusch HW, Hokfelt T 1997 Nitric oxide synthase and cGMP in the anterior pituitary gland: effect of a GnRH antagonist and nitric oxide donors. Neuroendocrinology 65:147–156[Medline]
  34. Lozach A, Garrel G, Lerrant Y, Berault A, Counis R 1998 GnRH-dependent up-regulation of nitric oxide synthase I level in pituitary gonadotrophs mediates cGMP elevation during rat proestrus. Mol Cell Endocrinol 143:43–51[CrossRef][Medline]
  35. Chen L, Sakai T, Sakamoto S, Kato M, Inoue K 1999 Direct evidence of gonadotropin-releasing hormone (GnRH)-stimulated nitric oxide production in the LßT-2 clonal gonadotropes. Pituitary 2:191–196[CrossRef][Medline]
  36. Huang HJ, Sebastian J, Strahl BD, Wu JC Miller WL 2001 The promoter for the ovine follicle-stimulating hormone-ß Gene (FSHß) confers FSHß-like expression on luciferase in transgenic mice: regulatory studies in vivo and in vitro. Endocrinology 142:2260–2266[Abstract/Free Full Text]
  37. O’Byrne MB, Tipton KF 2002 Inhibition of the neuronal isoform of nitric oxide synthase significantly attenuates 1-methyl-4-phenylpyridium (MPP+) toxicity in vitro. J Neural Transm 109:585–596[CrossRef][Medline]
  38. Gore AJ, Philips DP, Miller WL, Bernard DJ 2005 Differential regulation of follicle stimulating hormone by activin A and TGFBI in murine gonadotropes. Reprod Biol Endocrinol 3:73[CrossRef][Medline]
  39. Hurley JH 1999 Structure, mechanism, and regulation of mammalian adenylyl cyclase. J Biol Chem 274:7599–7602[Free Full Text]
  40. Ryves WJ, Evans AT, Olivier AR, Parker PJ, Evans FJ 1991 Activation of the PKC-isotypes {alpha}, ß1, {gamma}, {delta} and {epsilon} by phorbol esters of different biological activities. FEBS Lett 288:5–9[CrossRef][Medline]
  41. Pacheco MA, Pastoor TE, Wecker L 2003 Phosphorylation of the {alpha}4 subunit of human {alpha}4ß2 nicotinic receptors: role of cAMP-dependent protein kinase (PKA) and protein kinase C (PKC). Brain Res Mol Brain Res 114:65–72[Medline]
  42. Coffin VL, Spealman RD 1989 Psychomotor-stimulant effects of 3-isobutyl-1-methylxanthine: comparison with caffeine and 7-(2-chloroethyl) theophyllin. Eur J Pharmacol 170:35–40[CrossRef][Medline]
  43. Teter K, Jobling MG, Sentz D, Holmes RK 2006 The cholera toxin A13 subdomain is essential for interaction with ADP-ribosylation factor 6 and full toxic activity but is not required for translocation from the endoplasmic reticulum to the cytosol. Infect Immunol 74:2259–2267[Abstract/Free Full Text]
  44. Basille M, Gonzalez BJ, Desrues L, Demas M, Fournier A, Vaudry H 1995 pituitary adenylate cyclase-activating poly peptide (PACAP) stimulates adenylyl cyclase and phospholipase C activity in rat cerebellar neuroblasts. J Neurochem 65:1318–1324[Medline]
  45. Zhou CJ, Yada T, Kohno D, Kikuyama S, Suzuki R, Mizushima H, Shioda S 2001 PACAP activates PKA, PKC and Ca+2 signaling cascades in rat neuroepithelial cells. Peptides 22:1111–1117[CrossRef][Medline]
  46. Sassone-Corsi P 1995 Transcription factors responsive to cAMP. Annu Rev Cell Dev Biol 11:355–377[CrossRef][Medline]
  47. Du K, Asahara H, Jhala US, Wagner BL, Montminy M 2000 Characterization of a CREB gain-of-function mutant with constitutive transcriptional activity in vivo. Mol Cell Biol 20:4320–4327[Abstract/Free Full Text]
  48. Burkart AD, Mukherjee A, Mayo KE 2006 mechanism of repression of the inhibin {alpha}-subunit gene by inducible 3', 5'-cyclic adenosine monophosphate early repressor. Mol Endocrinol 20:584–597[Abstract/Free Full Text]
  49. Burger LL, Haisenleder DJ, Dalkin AC, Marshall JC 2004 Regulation of gonadotropin subunit gene transcription. J Mol Endocrinol 33:559–584[Abstract/Free Full Text]
  50. Sasaki M, Gonzales-Zulueta M, Huang H, Herring WJ, Ahn S, Ginty DD, Dawson VL, Dawson TM 2000 Dynamic regulation of neuronal NO synthase transcription by calcium influx through a CREB family transcription factor-dependent mechanism. Proc Natl Acad Sci USA 97:8617–8622[Abstract/Free Full Text]
  51. Mantelas A, Stamatakis A, Kazanis I, Philippidis H, Stylianopoulou F 2003 control of neuronal nitric oxide synthase and brain-derived neurotrophic factor levels by GABA-A receptors in the developing rat cortex. Brain Res Dev Brain Res 145:185–195[CrossRef][Medline]



This article has been cited by other articles:


Home page
J EndocrinolHome page
Y. Xia and A. L Schneyer
The biology of activin: recent advances in structure, regulation and function
J. Endocrinol., July 1, 2009; 202(1): 1 - 12.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
L Nicol, M-O Faure, J R McNeilly, J Fontaine, C Taragnat, and A S McNeilly
Bone morphogenetic protein-4 interacts with activin and GnRH to modulate gonadotrophin secretion in L{beta}T2 gonadotrophs
J. Endocrinol., March 1, 2008; 196(3): 497 - 507.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shafiee-Kermani, F.
Right arrow Articles by Miller, W. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shafiee-Kermani, F.
Right arrow Articles by Miller, W. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals