| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Molecular and Structural Biochemistry, North Carolina State University, Raleigh, North Carolina 27695-7622
Address all correspondence and requests for reprints to: Dr. William L. Miller, Department of Molecular and Structural Biochemistry, Box 7622, North Carolina State University, Raleigh, North Carolina 27695-7622. E-mail: wlmiller{at}ncsu.edu.
| Abstract |
|---|
|
|
|---|
AP1, a luciferase transgene driven by 4.7 kb of ovine FSHB promoter. This promoter lacks two GnRH-inducible activator protein-1 sites, making it easier to observe GnRH-mediated inhibition. Luciferase expression from this transgene was decreased 94% by 100 nM GnRH with a half-time of approximately 4 h in pituitary cultures, and this inhibition was independent of follistatin. Activators of cAMP and protein kinase C like forskolin and phorbol 12-myristate 3-acetate (PMA), respectively, mimicked GnRH action. Kinetic studies of wild-type ovine FSHBLuc in LßT2 cells showed continuous induction by activin (4-fold) over 20 h. Most of this induction (78%) was blocked, beginning at 6 h. cAMP response element binding protein (CREB) was implicated in this inhibition because overexpression of its constitutively active mutant mimicked GnRH, and its inhibitor (inducible cAMP early repressor isoform II) reversed the inhibition caused by GnRH, forskolin, or PMA. In addition, GnRH, forskolin, or PMA increased the expression of a CREB-responsive reporter gene, 6xCRE-37PRL-Luc. Inhibition of nitric oxide type I (NOSI) by 7-nitroindazole also reversed GnRH-mediated inhibition by 60%. It is known that GnRH and CREB induce production of NOSI in gonadotropes and neuronal cells, respectively. These data support the concept that chronic GnRH inhibits activin-induced ovine FSHB expression by sequential activation of CREB and NOSI through the cAMP and/or protein kinase C pathways. | Introduction |
|---|
|
|
|---|
/ß-heterodimer. The ß-subunit is in limiting amounts and thus controls the overall synthesis of FSH (4). Studies with rats and LßT2 cells suggest that activins are the primary inducers of FSHB gene expression (5, 6) and are produced in pituitaries (7).
Hypothalamic GnRH is another important inducer of FSH synthesis and release. Withdrawal of GnRH in rats causes serum FSH to fall 50% within 12 h (8). GnRH regulation is complex, however, because relatively slow pulses of GnRH (
1 per hour) favor FSHB expression (9, 10, 11), whereas chronic treatment with GnRH decreases FSHB below control levels in vivo and in vitro (12, 13, 14, 15). In a physiological context, studies with ewes show that mRNA from FSHB expression declines 80%, whereas LHB and CGA expression are at their highest levels during the preovulatory LH surge (16) when GnRH levels are increased dramatically for a prolonged time period (17). This GnRH surge, which is not strictly episodic and is sustained chronically for 1220 h (18), may be responsible for the decline in FSHB expression during this time.
With the exception of the preovulatory surge, GnRH normally pulses at approximately 1 pulse/h (19) and has been studied primarily as an inducer of all the gonadotropin subunit genes (CGA, LHB, and FSHB) or as a secretogogue. The positive effects of GnRH on secretion and transcription of gonadotropins are thought to involve activation of the G
q pathway (20, 21, 22, 23, 24). Our laboratory used in vitro and transgenic studies to identify two GnRH-responsive Jun/Fos binding sites (AP-1 enhancers at 120 and 83 bp) on the ovine promoter for FSHB. In pituitary cultures of transgenic mice carrying wild-type ovine FSHBLuc (wt-oFSHßLuc) (4.7 kb of ovine promoter for FSHB driving luciferase expression), GnRH (1 nM) increases activin-induced wt-oFSHßLuc expression by 2.5-fold within 4 h. When the AP-1 sites are destroyed to create the mutant ovine FSHBLuc-
AP1 (mut-oFSHßLuc-
AP1) transgene, and pituitary cultures from these mice were studied, we did not observe induction by GnRH under the same experimental conditions. Instead, we observed negative regulation of activin-induced mut-oFSHßLuc expression by GnRH (24).
This apparent inhibition of mut-oFSHßLuc-
AP1 by GnRH occurs within 4 h and might be dismissed as a simple down-regulation of the GnRH receptor or desensitization of the G
q pathway that normally leads to induction of FSHB. However, inhibition occurs in the same time frame as induction of the wild-type transgene (wt-oFSHßLuc) and therefore cannot reflect down-regulation or desensitization. This inhibition of activin-dependent expression of mut-oFSHßLuc-
AP1 by GnRH might also be dismissed as inhibition by follistatin that can be induced by GnRH (13, 25). However, the experiments are done in the presence of 300 ng/ml activin, which cannot possibly be inactivated by endogenous mouse follistatin made during the short (4 h) period of testing. Furthermore, if a rise in follistatin can cause this inhibition, it should also reduce wild-type expression as well, which does not happen. The question then is what undiscovered mechanism is responsible for the GnRH mediated inhibition of activin-induced FSHB expression? Here we examined the cellular pathways that mediated the negative control of activin-induced expression of ovine FSHB by the chronic presence of GnRH.
In addition to activating the G
q signaling pathway, GnRH can also couple to G
s and increase intracellular cAMP (26, 27, 28, 29). GnRH is known to activate cAMP response element binding protein (CREB) in the
T3 gonadotrope lineage (29). Whereas CREB is mainly phosphorylated by protein kinase A (PKA), studies show that protein kinase C (PKC) (30) can also phosphorylate CREB. Because GnRH can activate both pathways (G
s and G
q), it is not clear which pathway is responsible for CREB phosphorylation in
T3 cells (29). In fact, the effect of CREB activation on regulation of FSHB expression has not been studied to date.
Nitric oxide synthase type I (NOSI) is an enzyme that catalyses nitric oxide (NO) production from L-arginine. Studies show that GnRH can induce expression of NOSI exclusively in rat gonadotropes, which is correlated with a dramatic decrease in FSH secretion in rat pituitaries (31). Furthermore, studies using in situ hybridization and immunohistochemistry of rat pituitaries show that NOSI is present in gonadotropes (32, 33) and that changes in NOSI coincide with the pattern of GnRH release during proestrus in the rat (34). Finally, GnRH increases NO production in LßT2 cells (35), but the effect of NO on FSHB expression has not yet been studied.
This study was undertaken to confirm the original data that suggests GnRH can inhibit activin-induced expression of ovine FSHB (24) and discover the molecular mechanism(s) involved. Here we focused on CREB and NOSI as intermediates in the GnRH-activated cellular pathway leading to this inhibition. We also investigated the possible involvement of cAMP and/or PKC pathways in this process.
| Materials and Methods |
|---|
|
|
|---|
Reporter plasmids and expression vectors
The wild-type ovine FSHB promoter/reporter plasmid (wt-oFSHßLuc), which was transiently expressed in LßT2 cells in this study, was described previously (36). Briefly, it contained 4.7 kb of the ovine FSHB promoter plus intron 1 driving expression of a luciferase gene in the GL3 basic vector. The mutant ovine FSHBLuc-
AP1 (mut-oFSHß-
AP1) transgene expressed in transgenic mice in this study was derived from wt-oFSHßLuc by mutating two AP-1 sites at 120 and 83 bp. This construct was also described previously (24).
The construct used as a wild-type gene to make transgenic mice in this study (Ljwt-oFSHßLuc) was derived from the original wt-oFSHßLuc construct that was used to produce wild-type transgenic mice reported previously (36). The original wild-type mice were replaced by the Ljwt-oFSHßLuc transgenic mice that also expressed high levels of luciferase specifically in pituitaries, and luciferase expression was regulated by activin, follistatin, and GnRH in a similar manner. These new lines contained two distal 5' deletions (from 4736 to 3980 bp and 3398 to 2817 bp). Except for the description in this section, Ljwt-oFSHßLuc is referred to as wt-oFSHßLuc throughout this study because its expression and regulation were indistinguishable from the wild-type constructs already reported in transgenic mice (36).
The expression vector, 6xCRE-37PRL-Luc (6xCRE-Luc), was provided by Dr. Richard N. Day (Department of Medicine and Cell Biology, University of Virginia, Charlottesville, VA). The expression construct pCFY/F CREB was provided by Dr. Marc Montminy (The Salk Institute for Biological Studies, La Jolla, CA), and the expression vector ICERII was provided by Dr. Kelly E. Mayo (Center for Reproductive Science, Northwestern University, Evanston, IL).
Transgenic mice
All transgenic mice were maintained and studied with the approval and oversight of the Institutional Animal Care and Use Committee at the University of North Carolina, Chapel Hill, NC, or North Carolina State University. Mice containing Ljwt-oFSHßLuc were produced as described earlier (36) at the transgenic mouse facility at the University of North Carolina. All transgenic mice were bred and cared for at the Biological Resource Facility of North Carolina State University. Testing mice for the presence of a transgene was performed as previously reported (36).
Pituitary cell cultures
Transgenic mice between 7 and 40 wk old were killed, and their pituitaries were dissected and dispersed into single cell suspensions as described elsewhere (36). Briefly, the pituitaries were cut into small pieces and digested with collagenase and Pancreatin. The yield was approximately 0.5 x 106 cells/pituitary, and cells were plated in 96-well Primaria tissue culture plates (Becton Dickinson & Co., Franklin Lakes, NJ) at a density of 30,000 cells/well and allowed to attach for 2 d at 37 C under 5% CO2 in a humidified chamber before treatments. The cells were treated with drugs at the indicated doses and times described in the figure legends. Cells were terminated by lysis in 30 µl of 1x passive lysis buffer, and 15 µl of each cell lysate was assayed for luciferase activity. All of the experiments were performed at least three times and each assayed in triplicate. Although activins are produced in pituitary cell cultures as autocrine/paracrine factors, all the experiments in pituitary cell cultures or LßT2 cells were done in the presence of 50 ng/ml activin to ensure the maximal induction of FSHB-associated genes to maintain consistency from preparation to preparation. The only exception was for basal expression of wt-oFSHßLuc in LßT2 cells. The concentration of activin used in this report is in the range reported by us and others (25300 ng/ml) (6, 15, 24). The maximum concentration of GnRH used in our experiments was 100 nM, which is also in the range used by us and others in static cultures (0.01100 nM) (13, 15, 24). The 20-h period of our experiments was chosen for optimal results and approximates the length of the GnRH surge in ewes (17, 18). The concentration of 7-nitroindazole was also in the normal range of its usage (37).
LßT2 cell cultures
Immortalized murine LßT2 gonadotropes were provided by Dr. Pamela L. Mellon (University of California, San Diego, San Diego, CA). They were grown to 80% confluency in 75-cm2 flasks containing DMEM supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin under 5% CO2 in a humidified incubator at 37 C. Cells were then cultured in 96-well Primaria cell culture plates at a density of approximately 25,000 cells/well. Cells were allowed to attach overnight before transfection according to the manufacturers instruction, using 0.15 µl Fugene6 for 50 ng of plasmids/well. After 24 h of transfection, the media were replaced with fresh DMEM containing different treatments for the indicated times as described in each figure legend. Cells were then lysed using 30 µl of passive lysis buffer, and 15 µl of cell lysates were assayed for luciferase activity. Experiments were repeated at least three times and each experiment was assayed in triplicate.
Luciferase assay
Luciferase activity was measured by combining 50 µl of the luciferase assay system with 15 µl of each cell lysate. Activity was measured for 20 sec using an automated Victor-Light microplate luminometer no. 1420 (PerkinElmer, Boston, MA). The luciferase activity is reported as relative light units.
Real-time rt-PCR (RT-rtPCR)
Total RNA was isolated from mouse primary pituitary cells using Tri-reagent and converted to cDNA using an iScript cDNA synthesis kit as reported previously (38). Oligonucleotides for Taqman RT-rtPCR were designed for murine cDNA using software from Integrated DNA Technologies, Inc. (Coralville, IA). Murine 18s rRNA served as an internal control. The probes were 5'-labeled with FAM. The PCR primers and probes for RNA for mouse FSHB and 18s rRNA were reported previously (38). The primers and probes for mouse follistatin were 5'-CCTCCTGCTGCTGCTACTCT (forward), CTCTTCCTTGCTCAGTTCTGTCTT (reverse), and CAGTTCATGGAGGACCGCAGCGCC (probe). RT-rtPCR was performed in duplicate on triplicate cDNA samples using an iCycler from Bio-Rad Laboratories. Samples were incubated at 95 C for 3 min and then for 40 complete cycles (95 C for 30 sec, 55 C for 30 sec, and 72 C for 3 min). There was a final extension step of 72 C for 3 min. Threshold cycle values were determined with Bio-Rad software and used for relative quantitation with the 2-
Ct method (38).
Statistical analysis
Statistical calculations were performed using Prism version 4 (GraphPad Software, Inc., San Diego, CA). The data shown are the averages of at least three independent experiments, each assayed in triplicate. The mean ± SEM are reported in all figures. Significant differences between two means were calculated using the unpaired t test and comparisons of more than 2 means used one-way ANOVA, followed by Tukeys post hoc test. P < 0.05 was considered a significant difference.
| Results |
|---|
|
|
|---|
AP1, and endogenous FSHß in mouse pituitary cultures
AP1 and treated them for 20 h with activin alone or activin with increasing amounts of GnRH. Promoter activity of wt-oFSHßLuc was inhibited as much as 60% in a dose-dependent manner (Fig. 1A
AP1 was also inhibited in a dose-dependent manner to an even greater extent (94%) with an EC50 of 0.1 nM (Fig. 1A
AP1 was significant at 2 h and reached 85% at 20 h with a half-time of approximately 4 h (Fig. 1C
|
q/PKC and G
s/PKA signaling pathways in gonadotropes. We initially studied the PKA pathway to determine whether it could inhibit activin-dependent FSHB expression because the G
q/PKC pathway has always been associated with induction of FSHB expression. We compared the effect of forskolin, a potent stimulator of cAMP synthesis and CREB activation (39), with the effect of GnRH. Cells were treated for 20 h with activin alone or activin plus increasing concentrations of forskolin for 20 h (Fig. 2A
AP1 in a dose-dependent manner and to the same extent as GnRH (94%).
|
AP1, although to a lesser degree (55%) than GnRH or forskolin. It is of note that because we were interested in studying inhibition caused by cAMP and PKC activators, we chose mouse pituitary cultures harboring mut-oFSHßLuc-
AP1 that do not respond to positive regulation through activator protein (AP-1) sites to study the effect of these reagents in this and the next section. This enabled us to generate data that reflected only negative regulation by GnRH.
Sp-8-Br-cAMP, IBMX, CTX, and PACAP also mimicked GnRH in mouse pituitary cultures
To further test the ability of G
s and G
q signaling pathways to inhibit expression of mut-oFSHßLuc-
AP1, primary cell cultures were treated with: 1) a cell-permeable analog of cAMP (Sp-8-Br-cAMP) (Fig. 3A
); 2) a phosphodiesterase inhibitor (IBMX), which increases steady-state levels of cAMP by decreasing its hydrolysis (Fig. 3B
); 3) CTX, which acts as a constitutive activator of G
s to stimulate adenylyl cyclase (Fig. 3C
); and 4) PACAP, which increases intracellular cAMP and also activates PKC (Fig. 3D
) (41, 42, 43, 44, 45). All treatments were done for 20 h in the presence of activin. All these reagents inhibited mut-oFSHßLuc-
AP1 in a dose-dependent manner similar to that of GnRH.
|
|
|
GnRH, forskolin, and PMA induced 6xCRE-Luc expression in LßT2 cells
Phosphorylation of CREB on its serine 133 is generally accomplished by PKA after an increase in cAMP. Activated CREB can then bind cAMP response elements (CRE) to induce gene expression (46). Because CREB can also be phosphorylated by PKC in some cells (30) and GnRH in gonadotrope
T3 cells (29), we used a cAMP-responsive plasmid in LßT2 cells to determine whether GnRH, forskolin, or PMA could activate gene expression through CREs.
Cells were transiently transfected with a plasmid containing six tandem CREs linked to a prolactin minimal promoter fused to a luciferase gene (6xCRE-Luc). Cells were then treated for 20 h with activin alone or activin with increasing concentrations of GnRH, forskolin, or PMA. Activin alone had no significant effect on 6xCRE-Luc expression (data not shown). Forskolin up to 1 µM induced 6xCRELuc in a dose-dependent manner but at higher concentrations (10 µM) decreased the induction dramatically. GnRH (Fig. 6A
), forskolin (Fig. 6B
), and PMA (Fig. 6C
) induced the expression of the reporter gene 25-, 14-, and 6-fold, respectively. Time-course studies showed that the induction of 6xCRELuc by 100 nM GnRH at 1.5 h was equal to that of 20 h, but the peak induction was at 8 h, which was 8.5-fold above that of 20 h (data not shown).
|
Phe mutation that enables it to maintain high levels of constitutive Ser 133 phosphorylation in vivo (47). We used an expression plasmid containing this CREB mutant to probe the possible involvement of CREB in the signaling pathway used by GnRH to inhibit induction of wt-oFSHßLuc. LßT2 cells were cotransfected with wt-oFSHßLuc plus increasing amounts of pCF Y/F CREB and then treated with activin for 20 h. Overexpression of pCF Y/F CREB dose-dependently reduced activin induction of wt-oFSHßLuc activity that reached 78%, which mimicked the effect of GnRH (Fig. 7
70%) (data not shown). These data are consistent with the concept that CREB is in the signaling pathway used by GnRH to inhibit activin-induced wt-oFSHßLuc.
|
, -II, -II
). These isoforms can bind to CRE or CRE-like elements and may differ in their modes of action as repressors (48).
To determine whether inhibiting CREB could prevent the inhibitory effect of GnRH, we cotransfected LßT2 cells with wt-oFSHßLuc and increasing amounts of ICERII. Cells were then treated for 20 h with activin alone or activin and 100 nM GnRH. ICERII partially, but significantly (49%), reversed the inhibition caused by GnRH (Fig. 7B
) without affecting activin-induced expression of wt-oFSHßLuc (data not shown). Next, we examined the effect of ICERII on inhibition caused by forskolin and PMA. We cotransfected LßT2 cells with wt-oFSHßLuc and increasing amounts of ICERII expression plasmid and treated them for 20 h with activin alone, activin plus forskolin (1 µM), or activin plus PMA (100 nM). Whereas the effect of forskolin was significantly reversed, compared with the reversal observed for the effect of GnRH (Fig 7C
), the inhibition by PMA was completely reversed and expression of wt-oFSHßLuc even exceeded control levels (Fig. 7D
).
7-NI reversed the inhibitory effect of GnRH in LßT2 cells
GnRH increases expression of the NOSI gene in rat gonadotropes, and this increase is accompanied by a dramatic decrease in FSH release. GnRH also increases NO in LßT2 cells (31, 32, 33, 34, 35). We used a NOSI-specific inhibitor (7NI) along with activin and GnRH in transient transfections of LßT2 cells to determine whether NOSI might participate in GnRH-mediated inhibition of wt-oFSHßLuc. We transfected LßT2 cells with wt-oFSHßLuc and then treated them for 20 h with activin alone, activin with 100 nM GnRH, or activin with GnRH and increasing amounts of 7-NI up to 250 µM. The inhibition of wt-oFSHßLuc caused by GnRH was significantly (60%) reversed by 7-NI (Fig. 8
). At 250 µM, 7-NI did not significantly affect basal or activin-induced expression of wt-oFSHßLuc, but at 1 mM, it significantly inhibited both basal and activin-induced expression (data not shown).
|
| Discussion |
|---|
|
|
|---|
We showed that chronic treatment with 100 nM GnRH can inhibit activin-induced expression of FSHB in mouse pituitary cultures and LßT2 cells. In fact, there is no evidence of inhibition without activin induction because GnRH did not affect basal expression of wt-oFSHßLuc in LßT2 cells. The data in Fig. 1A
show that GnRH inhibited wt-oFSHßLuc and mut-oFSHßLuc-
AP1 in a dose-dependent manner in primary pituitary cultures obtained from transgenic mice. The two inhibition curves are different, however. The data from mut-oFSHßLuc-
AP1 show a typical semilogarithmic response with a well-defined IC50 of 0.1 nM and inhibition that reached 90% at 1 nM GnRH. The response curve for wt-oFSHßLuc was linear and inhibition was only 60% at 100 nM GnRH with no calculable EC50, suggesting that at least two underlying events were occurring. The only difference between the two transgenes was the presence or absence of two AP-1 enhancers associated with positive regulation by GnRH (23, 24). It is likely, therefore, that the inhibition curve for wild-type promoter reflects both induction and inhibition by GnRH, whereas the inhibition curve for the mutant promoter shows only inhibition. This composite situation might account for the 50% inhibition of endogenous mouse FSHB we observed (Fig. 1B
), which might be regulated like wt-oFSHßLuc. In fact, this agrees with reports showing that chronic GnRH inhibits rat FSHß expression in vivo and pituitary cell cultures (12, 13, 14, 15). Hence, our data suggest that GnRH may regulate activin-induced expression of FSHB in the sheep, rat, and mouse using the same general mechanisms.
The results of dose-response studies using wt-oFSHßLuc in transient transfections of LßT2 cells were comparable with those using wt-oFSHßLuc as a transgene in primary pituitary cells, validating the suitability of LßT2 cells for studying the effects of GnRH on wt-oFSHßLuc. Our kinetic studies showed that 100 nM GnRH rapidly reversed activin-induced expression of the mut-oFSHßLuc-
AP1 in mouse pituitary cultures, had a significant impact as early as 2 h, and caused 60% inhibition by 4 h. This relatively rapid inhibition was similar to inhibition of the wt-oFSHßLuc that we reported previously. That earlier study shows that 100 nM GnRH inhibits activin induction of wt-oFSHßLuc 70% within 4 h (24). However, the kinetics of inhibition for wt-oFSHLuc in LßT2 cells was slower showing an inhibitory response after only 6 h. This might be explained by the fact that activin induction of the wt-oFSHßLuc is also slower in LßT2 cells because in this study activin slowly and progressively induced the wt-oFSHßLuc within 20 h in LßT2 cells, and the induction was only 50% within 4 h, whereas activin robustly induces the wt-oFSHßLuc (7-fold) in primary cultures within 4 h that was shown previously (24). The slower response in LßT2 cells might also be due to differences between the structure and conformation of transgene DNA that is integrated into chromosomes vs. plasmids that are extrachromosomal DNA.
Quantitation of endogenous follistatin mRNA in mouse pituitary cultures failed to show a significant change in follistatin gene expression during the time frame and culture conditions used in our studies. This is in contrast to other reports showing induction of follistatin expression by pulsatile (25) or continuous (13) GnRH in rat pituitary cultures. This difference might be caused by different experimental procedures and time frames used in those and this reports or might be caused by species specific differences between mice and rats.
Because the G
q/PKC pathway is reported to be involved in FSHB induction, we originally expected the G
s/PKA/CREB pathway to be responsible for the GnRH inhibitory effect. This expectation was corroborated by inhibition of activin-induced mut-oFSHßLuc-
AP1 caused by CTX, forskolin, IBMX, PACAP, and Sp-8-cAMP in mouse pituitary cultures. Furthermore, a constitutively active CREB also inhibited wt-oFSHßLuc induction in LßT2 cells the same as GnRH. In addition, the inhibitory effects of GnRH and forskolin on wt-oFSHßLuc in LßT2 cells were significantly and equally well reversed by ICERII (a naturally occurring CREB inhibitor). The possible involvement of the cAMP/PKA CREB pathway was strengthened by our observation that GnRH and forskolin could induce expression of 6xCRE-Luc by 25- and 14-fold, respectively, in transient transfections of LßT2 cells. Thus, all components we examined that are associated with activation of the G
s signaling pathway mimicked GnRH by inhibiting activin-induced expression of ovine FSHB in primary or transformed gonadotrope cultures.
Surprisingly, however, PMA (a potent activator of PKC) also mimicked the inhibitory effect of GnRH in pituitary cultures of transgenic mice and activated 6xCRE-Luc in LßT2 cells, although to a lesser degree. Additionally, the inhibition of wt-oFSHßLuc by PMA was reversed by ICERII in transient transfections of LßT2 cells. The inhibition of CREB by ICERII not only reversed the inhibitory effect of PMA but also increased wt-oFSHßLuc induction above control levels. These observations could be explained by the fact that PKC should have a dual effect on wt-oFSHßLuc expression: 1) an induction through activation of AP-1 transcription factors that increases expression of wt-oFSHßLuc (23) and 2) an inhibitory effect through induction of CREB. Because the inhibitory effect of PMA was not as dramatic as that of GnRH, it could be fully reversed by ICERII, allowing PMA-mediated induction to become dominant. In contrast, the inhibitory effect of GnRH was only partially reversed by ICERII. A possible explanation for this difference could be that PMA induces CREB only through PKC activation, whereas GnRH can activate CREB through both cAMP and PKC pathways. Indeed, the activators of cAMP and PKC pathways showed the same effect that mimicked the action of GnRH and inhibition of CREB reversed the inhibitory effect of these cAMP or PKC activators. Consequently, activation of these two pathways by GnRH might result in the activation of more CREB than can be completely inhibited by ICERII. Another explanation is that CREB activation might not be the only pathway that GnRH uses to inhibit activin-induced oFSHßLuc. In any case our results justify the conclusion that GnRH inhibited oFSHßLuc through the cAMP and/or PKC pathways, at least in part, by inducing CREB.
We observed dose-dependent reversal of the GnRH-mediated inhibition of activin-induced wt-oFSHßLuc expression up to 60% by the NOSI-specific inhibitor, 7-NI. This result implicated NOSI in the GnRH inhibitory pathway. This observation is consistent with reports showing that NOSI is present in gonadotropes and that its expression is induced by GnRH in these cells to inhibit FSH release (31, 32, 33, 34). It is also consistent with a previous study showing that 100 nM GnRH increases NO production within 2 h in LßT2 cells (35). Finally, these data are in agreement with the notion that CREB can induce NOSI expression in vivo and in vitro (50, 51). Indeed, 10 nM GnRH phosphorylates CREB in
T3 cells within 5 min, and this phosphorylation persists during the entire experimental period, which lasts 4 h (29). Our results led us to conclude that NOSI was responsible for a large part (60%) of the inhibition caused by GnRH.
In summary, our data support the hypothesis that chronic administration of 100 nM GnRH inhibits activin-induced ovine FSHB through either cAMP and/or PKC pathways that regulate activation of CREB followed by induction of NOSI expression.
| Acknowledgments |
|---|
| Footnotes |
|---|
Disclosure Statement: The authors of this manuscript have nothing to declare.
First Published Online April 19, 2007
Abbreviations: AP, Activator protein; CRE, cAMP response element; CREB, cAMP response element binding protein; CTX, cholera toxin; DMSO, dimethylsulfoxide; IBMX, 3-isobutyl-1-methylxanthine; ICER, inducible cAMP early repressor; 7-NI, 7-nitroindazole; NO, nitric oxide; NOSI, nitric oxide synthase type I; PACAP, pituitary adenylyl cyclases activating polypeptide; PKA, protein kinase A; PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; RT-rtPCR, real-time rt-PCR; Sp-8-Br-cAMPS, 8-bromoadenosine-3',5'-cyclic monophosphorothioate, Sp isomer.
Received December 27, 2006.
Accepted for publication April 6, 2007.
| References |
|---|
|
|
|---|
T3-1 cell line: differential roles of calcium and protein kinase C. Endocrinology 138:16731682
and
in LßT2 gonadotrope cells. Endocrinology 148:10991107[CrossRef][Medline]
, ß1,
,
and
by phorbol esters of different biological activities. FEBS Lett 288:59[CrossRef][Medline]
4 subunit of human
4ß2 nicotinic receptors: role of cAMP-dependent protein kinase (PKA) and protein kinase C (PKC). Brain Res Mol Brain Res 114:6572[Medline]
-subunit gene by inducible 3', 5'-cyclic adenosine monophosphate early repressor. Mol Endocrinol 20:584597This article has been cited by other articles:
![]() |
Y. Xia and A. L Schneyer The biology of activin: recent advances in structure, regulation and function J. Endocrinol., July 1, 2009; 202(1): 1 - 12. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Nicol, M-O Faure, J R McNeilly, J Fontaine, C Taragnat, and A S McNeilly Bone morphogenetic protein-4 interacts with activin and GnRH to modulate gonadotrophin secretion in L{beta}T2 gonadotrophs J. Endocrinol., March 1, 2008; 196(3): 497 - 507. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |