help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-1632
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Levy, N.
Right arrow Articles by Leitman, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Levy, N.
Right arrow Articles by Leitman, D. C.
Endocrinology Vol. 148, No. 7 3449-3458
Copyright © 2007 by The Endocrine Society

Multiple Transcription Factor Elements Collaborate with Estrogen Receptor {alpha} to Activate an Inducible Estrogen Response Element in the NKG2E Gene

Nitzan Levy, Xiaoyue Zhao, Hui Tang, Robert B. Jaffe, Terence P. Speed and Dale C. Leitman

Departments of Obstetrics, Gynecology, and Reproductive Sciences, Center for Reproductive Sciences (N.L., R.B.J., D.C.L), and Cellular and Molecular Pharmacology (N.L., D.C.L), University of California, San Francisco, California 94143; Department of Statistics (X.Z, H.T., T.P.S.), University of California, Berkeley, California 94720; and Division of Genetics and Bioinformatics (T.P.S.), The Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria 3052, Australia

Address all correspondence and requests for reprints to: Dale Leitman, Department of Obstetrics, Gynecology, and Reproductive Sciences, 513 Parnassus Avenue, S-1258, San Francisco, California 94143. E-mail: leitmand{at}obgyn.ucsf.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Estrogen receptors (ERs) regulate transcription by interacting with regulatory elements in target genes. However, known ER regulatory elements cannot explain the expression profiles of genes activated by estradiol (E2) and selective estrogen receptor modulators (SERMs). We previously showed that the killer cell lectin-like receptor (NKG2E) gene is regulated by E2, tamoxifen, and raloxifene. Here we used the NKG2E gene as a model to investigate the mechanism whereby target genes are regulated by E2 and SERMs with ER{alpha}. The ER regulatory element in the NKG2E promoter was mapped to the –1825 and –1686 region. Full activation of the NKG2E promoter required the collaboration between a transcription factor cluster containing c-jun, heat-shock factor 2, and CCAAT/enhancer-binding protein ß and a unique variant estrogen response element (ERE) that has only a two nucleotide spacer between half sites. The cluster elements and the variant ERE were inactive on their own, but the regulation by E2 and SERMs was restored when the c-jun, heat-shock factor-2, and CCAAT/enhancer-binding protein ß cluster was placed upstream of the variant ERE. The activation of the NKG2E gene by E2 and selective ER modulators was associated with the recruitment of the p160 coactivators glucocorticoid receptor-interacting protein 1 and amplified in breast cancer 1 but not steroid receptor coactivator 1. These studies identified one of the most complex ER regulatory units thus far reported and demonstrate that a cluster of flanking transcription factors collaborate with ER to induce a functional ERE in the NKG2E promoter.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ESTROGENS AND SELECTIVE estrogen receptor modulators (SERMs) induce physiological and clinical effects by interacting with estrogen receptors (ERs), which are members of a large family of proteins known as nuclear receptors (1, 2). Two types of ERs have been identified, ER{alpha} and ERß (3, 4). These receptors have different tissue distributions and biological roles. ERs act through two signaling pathways: a genomic pathway, in which ERs in the nucleus regulate gene transcription (5), and a nongenomic pathway, in which ERs located in the plasma membrane regulate signal transduction (6). Binding of estradiol (E2) to nuclear ER induces a conformational change of the receptor that allows it to directly attach to an estrogen response element (ERE) (7). Once the liganded ER is tethered to an ERE, distinct classes of coregulatory proteins, including p160s coactivators, mediator complex proteins, and cAMP response element-binding (CREB) protein/p300, and histone acetyltransferases are recruited in a sequential and cyclical manner that activate gene transcription (8, 9, 10, 11).

ERs bind to the classical ERE as a dimer through two zinc fingers in the central DNA binding domain. The classical ERE consists of a 13-nucleotide inverted palindromic sequence separated by any three nucleotides (5' GGTCAnnnTGACC 3'). This ERE was first discovered in the Xenopus vitellogenin gene (12, 13). Surprisingly, this exact classical ERE sequence is only found in a few human genes (14, 15). However, ERE variants with one or two nucleotide substitutions have been found in numerous mammalian genes that are activated by ER{alpha} and ERß (16, 17).

Although the ERE is considered to be the major response element in genes regulated by ERs, additional elements are required to regulate the full pattern of target genes and to elicit tissue-specific gene expression by E2 and SERMs. Activator protein 1 (AP-1) and stimulatory protein 1 (Sp1) are the best characterized alternative elements present in ER target genes activated by E2 and SERMs (18, 19). The AP-1 element binds the transcription factors jun and fos (20, 21), whereas Sp1 elements are GC-rich regions that bind the Sp1 family of transcription factors (22). The alternative elements can be distinguished from an ERE in several ways. First, ER is tethered to alternative elements through protein-protein interactions rather than binding directly to DNA (23, 24, 25). Second, whereas the ERE is typically activated by E2 and antagonized by SERMs, the alternative elements can be activated by both E2 and SERMs (25, 26, 27, 28). Third, the ERE is activated by E2 in all tissues, whereas alternative elements are activated by E2 and SERMs in a tissue-specific manner and therefore can mediate tissue-specific effects of E2 and SERMs (25, 26, 27, 28).

Although the ERE and alternative elements are important mediators of the ER regulation of genes, recent microarray data from our laboratory and others (29, 30, 31) have revealed a pattern of gene regulation by E2 and SERMs that cannot be understood by the pharmacology of the known response elements. For example, many genes regulated by E2 with ER{alpha} are distinct from those regulated by ERß, and some genes that are regulated by tamoxifen are different from those regulated by raloxifene (30). Because it is known that both ER{alpha} and ERß activate an ERE (32, 33), it is likely that the genes differentially regulated by ER{alpha} and ERß contain response elements other than EREs. Furthermore, both tamoxifen and raloxifene activate AP-1 and Sp1 elements with ER{alpha} and ERß (27, 28, 34), making it unlikely that these elements are responsible for the differential activation of genes by these drugs. Together, these findings suggest that, in addition to the ERE and known alternative elements, other types of elements exist in ER target genes that are regulated by E2 and SERMs. Identifying novel regulatory elements in ER target genes is a critical step in the elucidation of how estrogens and SERMs induce both therapeutic and adverse effects.

One of the ER target genes that exhibited an interesting pharmacological profile in our microarrays is the killer cell lectin-like receptor (NKG2E) gene. In our studies with U2OS cells expressing ER{alpha}, both tamoxifen and raloxifene elicited an agonist effect similar to E2 (30). These studies indicate that the NKG2E gene could be used as a model to better understand the mechanism whereby E2 and SERMs activate regulatory elements in the context of a native gene rather than simple consensus elements such as AP-1 and Sp1. In the present study, we identified a complex ER regulatory element that requires the collaboration between ER{alpha} and multiple transcription factors. We also show that the p160 coactivators mediate the activation of the NKG2E gene by SERMs.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Preparation of stable cell lines
Tetracycline-inducible U2OS-ER{alpha} cells were prepared and maintained as described previously (30).

Plasmids, transfection, and luciferase assay
The NKG2E promoter was prepared by PCR using primers designed based on the human genome. The PCR product was cloned into the pGEM t-easy vector (Promega, Madison, WI) and sequenced. The promoter was then cloned upstream of the luciferase reporter gene. Deletions of the NKG2E promoter were prepared by using unique restriction sites (HindIII, PstI, and AccI). Point mutations in the NKG2E promoter were prepared with the QuikChange Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA). Transfections of the various vectors into wild-type U2OS cells were performed by electroporation (35). Oligonucleotides were cloned upstream of –32 to +45 thymidine kinase promoter-luciferase gene (TK-luc). Cells were assayed with a luciferase assay system according to the protocol of the manufacturer (Promega).

RNA extraction and quantitative real-time PCR
Total RNA was extracted and then treated with deoxyribonuclease using the Absolutely RNA miniprep kit (Stratagene). Reverse transcriptase reactions were performed using 1 µg of total RNA as described previously (36). Real-time PCR was performed with the Bio-Rad (Hercules, CA) iCycler using iQ SYBR Green Supermix. Mean ± SE was calculated using Prism curve-fitting program (version 3.03; GraphPad Software, San Diego, CA). Primers were designed using Oligo5.1 (National Biosciences, Inc., Plymouth, MN) and Amplify 1.2 (FaceWare) software and then blasted against all GenBank, Reference Sequence Nucleotides, European Molecular Biology Laboratory, DNA Data Bank of Japan, and Protein Data Bank sequences to verify that there was no cross-reaction with other genes. The sequences of the NKG2E primers used are as follows: forward, 5'-GCCAGCATTTTACCTTCCTCAT-3'; reverse, 5'-AACATGATGAAACCCCGTCTAA-3'.

Chromatin immunoprecipitation (ChIP)
After treatments, cells were cross-linked, washed, collected, and lysed as described previously (37, 38). Fifty microliters of each sample were saved for total input. Immunoprecipitations were performed overnight at 4 C with anti-steroid receptor coactivator 1 (SRC-1) (1135), anti-heat-shock factor 2 (HSF-2) (3E2) (Upstate, Charlottesville, VA), anti-ER{alpha} (HC-20), anti-c-jun (H-79), anti-CCAAT/enhancer-binding protein ß (C/EBPß) (C-19) (Santa Cruz Biotechnology, Santa Cruz, CA), anti-glucocorticoid receptor-interacting protein 1 (GRIP1) (ab9261), and amplified in breast cancer 1 (AIB1) (ab2782) (Abcam, Cambridge, MA). DNA fragments were purified (QIAquick PCR Purification kit; Qiagen, Valencia, CA) and PCR amplified. The NKG2E chip primers used were as follows: forward, 5'-AGCCACCCAAAGTCTCCTAT-3'; reverse, 5'-TTCAGTGGAGAGGTCAGGTT-3'. Real-time PCR using primers spanning sites far from the NKG2E response element and non-immune assays served as negative controls (data not shown).

Coimmunoprecipitation
After treatments, U2OS-ER{alpha} cells were washed and lysed [150 mM NaCl, 1% Triton X-100, and 50 mM Tris (pH 7.5)]. Fifty microliters of each sample were saved for total input. Immunoprecipitations were performed overnight at 4 C with anti-HSF-2, anti-C/EBPß, or anti-c-jun antibodies mixed with protein-G agarose beads (Upstate). Beads were then washed and proteins eluted with SDS sample buffer containing dithiothreitol.

Immunoblotting
Proteins (15 µg) were separated using 4–12% gradient Bis-Tris gels (Invitrogen, Carlsbad, CA), transferred to polyvinylidene difluoride membranes, and detected with anti-HSF-2, anti-C/EBPß, anti-c-jun, or anti-ER{alpha} antibodies in blocking buffer and anti-IgG conjugated with horseradish peroxidase (BD PharMingen, San Diego, CA). An ECL detection system (GE Healthcare Biosciences, Piscataway, NJ) was used to visualize the proteins.

RNA interference
RNA interference for C/EBPß, c-jun, or nonspecific RNA was performed using SMARTpool small interfering RNA (siRNA) reagent (Dharmacon, Lafayette, CO). siRNA, 50 nM, was transfected into U2OS cells using oligofectamine (Invitrogen) according to the protocol of the manufacturer. For HSF-2, transient transfection of 3 µg pSilencer 1.0-U6 (Ambion, Austin, TX) containing the hairpin forming oligonucleotides (5'CAGGCGAGTACAACAGCATTTCAAGAGAATGCTGTTGTACTCGCCTG3' and 5'CAGGCGAGTACAACAGCATTCTCTTGAAATGCTGTTGTACTCGCCTG3') or an empty vector was used. At 72 h after transfections, cells were treated with E2 for 12 h and collected for RNA and protein extraction.

EMSAs
32P-labeled classical ERE or 32P-labeled NKG2E (–1852 to –1687) regulatory element was incubated with or without purified ER{alpha} (Invitrogen) in buffer (30 mM HEPES, 120 mM KCl, 2 mM EDTA, 10 mM MgCl, 24% glycerol, and 2 µg dIdC). Samples were then run on 6% polyacrylamide gel, which was dried and exposed to film.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
E2 and SERMs activate the NKG2E gene
U2OS-ER{alpha} cells were treated with E2, tamoxifen, and raloxifene for increasing times, and then NKG2E mRNA was measured by quantitative real-time PCR. All three drugs activated the NKG2E gene by 6 h, and the maximal activation was observed by 24 h (Fig. 1AGo). The E2-induced activation of the NKG2E gene was inhibited by tamoxifen and abolished by raloxifene (Fig. 1BGo). These results demonstrate that tamoxifen and raloxifene act as a mixed agonist/antagonist at the NKG2E gene, because they activate the gene in the absence of E2 and inhibit the gene in the presence of E2.


Figure 1
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 1. E2 and SERMs activate the NKG2E gene. A, U2OS-ER{alpha} cells were treated with 10 nM E2, 1 µM tamoxifen (Tamox), or 1 µM raloxifene (Ralox) for the indicated times. B, U2OS-ER{alpha} cells were treated with 1 nM E2 alone or combined with 1 µM tamoxifen or 1 µM raloxifene for 12 h. NKG2E mRNA was measured by quantitative real-time PCR. Each data point is the average ± SEM of triplicate determinations. *, a, b, P < 0.05, significant difference between the indicated treatments.

 
Multiple and distant elements are required for E2 and SERM activation of the NKG2E gene
To study the mechanism whereby E2 and SERMs regulate the NKG2E gene, we cloned a 3438 nucleotide fragment of the NKG2E promoter upstream of the luciferase reporter gene. The –3438 NKG2E promoter and several deletions (Fig. 2AGo) were transiently cotransfected into U2OS cells with an expression vector for ER{alpha} and then treated with E2, tamoxifen, or raloxifene. Consistent with the mRNA expression data, all three drugs stimulated the –3438 and –1825 NKG2E promoters. E2 produced a 12-fold activation of the NKG2E promoter, whereas tamoxifen and raloxifene activated the promoter by about 4- and 3-fold, respectively (Fig. 2BGo). The magnitude of activation of the NKG2E promoter by the SERMs is similar to their activation at AP-1 (26) and Sp1 (25) elements. No activation by E2 or SERMs occurred when the NKG2E promoter was deleted to –1686 (Fig. 2BGo). These results demonstrate that the ER regulatory element is located between –1825 and –1686.


Figure 2
View larger version (22K):
[in this window]
[in a new window]

 
FIG. 2. Multiple and distant elements are required to activate the NKG2E promoter by E2 and SERMs. A, Different lengths of the NKG2E promoter located upstream of the luciferase reporter gene. B, Wild-type U2OS cells were transfected with NKG2E promoter-luciferase reporter constructs and an expression vector for ER{alpha}. The cells were treated with 10 nM E2, 1 µM tamoxifen, or 1 µM raloxifene for 18 h, and luciferase activity was measured. C, The –1825 to –1686 region of the NKG2E promoter and deletion mutants of the proximal and distal ends were located upstream of the minimal TK promoter. D, U2OS cells were transfected with the –1825 to –1686 region of the NKG2E promoter or deletion mutant constructs along with an expression vector for ER{alpha}. The cells were treated with 10 nM E2, 1 µM tamoxifen, or 1 µM raloxifene for 18 h, and luciferase activity was measured. Each data point is the average ± SEM of triplicate determinations. *, P < 0.05, significant difference from control values.

 
To further map the ER response element, the –1825 to –1686 NKG2E promoter fragment was cloned upstream of minimal TK-luc, and then deletions at the proximal and distal ends were prepared (Fig. 2CGo). The constructs were transiently transfected into U2OS cells with the ER{alpha} expression vector. Similar to the native –3438 NKG2E promoter (Fig. 2BGo), the –1825 to –1686 fragment was activated by both E2 and SERMs (Fig. 2DGo), Surprisingly, the activation was abolished by deletions at either end of the –1825 to –1686 region (Fig. 2DGo). These findings demonstrate that E2 and SERM activation of the NKG2E regulatory region requires multiple and distant elements.

The activation of the NKG2E promoter by E2 and SERMs requires a transcriptional factor cluster and a unique variant ERE
The –1825 to –1686 region contains potential binding sites for multiple transcription factors, including AP-1, myeloid zinc finger (MZF-1), HSF-2, C/EBPß, GATA, and octamer-binding transcription factor 1. This region also contains a variant ERE-like element (vERE) (Fig. 3AGo). These elements were individually mutated and then tested in transient transfections for responses to E2 and SERMs. The activation by E2 was markedly inhibited by mutations in the AP-1, HSF-2, and C/EBPß elements (Fig. 3BGo). These mutations also abolished tamoxifen and raloxifene activation of the promoter (Fig. 3BGo). Mutations in the other transcription factor elements (Mzf-1, GATA, and octamer-binding transcription factor 1) did not have any effect on the activation by E2 or SERMs (data not shown). The vERE (5' GGTAAccTGACC 3') has a perfect distal half-site and a proximal half-site with one nucleotide difference compared with the classical ERE (5' GGTCAnnnTGACC 3'). This site also differs from the classical ERE in that it contains two nucleotides, rather than the usual three, between the half-sites (Fig. 3CGo, top). Mutations in the proximal or the distal vERE half-site sequence (Fig. 3CGo, middle and bottom, respectively) abolished the activation by E2 and SERMs (Fig. 3DGo), demonstrating that the complete vERE is required for activation.


Figure 3
View larger version (30K):
[in this window]
[in a new window]

 
FIG. 3. AP-1, HSF-2, C/EBPß, and a vERE are required for E2 and SERM activation of the NKG2E promoter. A, Mutations were made in the AP-1, HSF-2, and C/EBPß elements located within the –1825 to –1686 NKG2E promoter. B, U20S cells were cotransfected with the luciferase reporter constructs containing wild-type NKG2E or AP-1, HSF-2, or C/EBPß mutants and an ER{alpha} expression vector. The cells were treated with 10 nM E2, 1 µM tamoxifen (Tamox), or 1 µM raloxifene (Ralox) (top, middle, and bottom, respectively) for 18 h, and luciferase activity was measured. Each data point is the average ± SEM of triplicate determinations. C, Mutations in both half-sites of the vERE located within the –1825 to –1686 NKG2E promoter. D, U20S cells were cotransfected with the luciferase reporter constructs containing wild-type vERE or mutations in the vERE. The cells were treated with 10 nM E2 (E), 1 µM tamoxifen (T), or 1 µM raloxifene (R) for 18 h, and luciferase activity was measured. C, Control. Each data point is the average ± SEM of triplicate determinations. *, P < 0.05, significant difference from control. a, b, P < 0.05, significant difference between the indicated treatments.

 
To explore the functional significance of the vERE, we cloned the vERE upstream of TK-luc (Fig. 4AGo) and transfected the construct into U2OS cells along with an ER{alpha} expression vector. We found that the vERE by itself was not activated by E2 (Fig. 4BGo) or SERMs (data not shown). Similarly, the transcription factor cluster containing the AP-1, HSF-2, and C/EBPß elements upstream of TK-luc was not regulated by E2 (Fig. 4BGo) or SERMs (data not shown), although it contains an AP-1 element. To determine whether the vERE is influenced by cluster proteins, an oligonucleotide containing the cluster elements positioned 24 bp proximal to the vERE was cloned upstream of TK-luc (Fig. 4AGo, bottom). The activation by E2 was restored when the cluster elements were positioned adjacent to the vERE (Fig. 4BGo). However, the activation of cluster-vERE TK-Luc was about half of that observed with the wild-type vERE region. This finding likely results from the different number of nucleotides spaced between the cluster and vERE in the synthetic oligonucleotide (Fig. 4AGo, bottom) compared with the native sequence (Fig. 4AGo, top). These results demonstrate that the vERE is only active when cluster elements are present and define the ER{alpha} regulatory unit in the NKG2E gene, which consists of AP-1, HSF-2, and C/EBPß elements along with a vERE.


Figure 4
View larger version (28K):
[in this window]
[in a new window]

 
FIG. 4. The activation of the NKG2E promoter requires a transcription factor cluster and a vERE. A, The native sequence (top) or a synthetic oligonucleotide (bottom) containing AP-1, HSF-2, and C/EBPß cluster elements and vERE in the ER regulatory element of the NKG2E gene. B, U20S cells were cotransfected with the vERE alone, cluster elements alone, or cluster elements and vERE and an expression vectors for ER{alpha}. The cells were treated with 10 nM E2 for 18 h, and luciferase activity was measured. C, U20S cells were cotransfected with the –3438 NKG2E construct and expression vectors for wild-type (WT) ER{alpha} or ER{alpha} HE82 mutant, which does not bind to an ERE. The cells were treated with 10 nM E2, 1 µM tamoxifen (Tamox), or 1 µM raloxifene (Ralox) for 18 h, and luciferase activity was measured. Each data point is the average ± SEM of triplicate determinations. *, P < 0.05, significant difference from control values. D, The classical ERE or the NKG2E regulatory region containing the vERE were labeled with 32P and incubated without (–) or with (+) purified ER{alpha}. EMSAs were done as described in Materials and Methods.

 
To investigate whether ER{alpha} binds directly to the vERE, we used an ER{alpha} mutant (HE82) with three mutations in the DNA binding domain that makes it unable to bind directly to an ERE (39). E2 or SERMs failed to activate the transfected cluster-vERE TK-luc construct in the presence of HE82 (Fig. 4CGo), suggesting that DNA binding is required for ER activation. To further explore this point, we performed EMSAs. We found that purified ER{alpha} did not bind to the native NKG2E regulatory region containing vERE but strongly bound to the classical ERE, which served as a positive control (Fig. 4DGo). We also did not observe ER{alpha} binding with nuclear extracts prepared from E2-treated U2OS-ER{alpha} cells (data not shown). Altogether, these results show that the vERE is required for activation, although ER{alpha} does not bind directly to the vERE in EMSA. To reconcile these apparently conflicting data, we hypothesize that the cluster proteins form a complex with ER{alpha} that allows it to bind to the vERE. EMSA may not serve as an adequate method to detect ER{alpha} binding because it is done in conditions that might not allow the cluster proteins to form a complex with ER{alpha}.

ER{alpha} interacts with AP-1, HSF-2, and C/EBPß
The observation that mutations in the binding sites for the cluster proteins markedly inhibited E2 and SERM activation of the NKG2E gene demonstrates the importance of these elements in NKG2E regulation. However, it is important to determine whether ER{alpha} interacts with the cluster proteins. U2OS-ER{alpha} cells were treated for increasing periods of time with E2, and cellular lysates were immunoprecipitated with antibodies to c-jun, HSF-2, or C/EBPß. The immunoprecipitated proteins were run on a SDS-polyacrylamide gel, and Western blots were done with an ER{alpha} antibody. ER{alpha} interacted strongly with HSF-2 and C/EBPß after 1 h of E2 treatment (Fig. 5AGo). A decrease in the amount of HSF-2 and C/EBPß was observed at 2 and 3 h. This decrease might be attributable to the recruitment of ER, coactivators, and possibly other factors that make the antibodies less accessible for binding to HSF-2 and C/EBPß. ER{alpha} also interacted with c-jun, but the binding was weaker at all time points. These results demonstrate that ER{alpha} interacts with a transcription factor complex containing c-jun, HSF-2, and C/EBPß.


Figure 5
View larger version (33K):
[in this window]
[in a new window]

 
FIG. 5. ER{alpha} interacts with and recruits c-jun, HSF-2, and C/EBPß. A, ER{alpha} coimmunoprecipitates with c-jun, HSF-2, and C/EBPß. U2OS-ER{alpha} cells were treated with increasing times of E2, and cellular lysates were immunoprecipitated with antibodies to c-jun, HSF-2, or C/EBPß. The immunoprecipitated proteins were run on a SDS-PAGE and then immunoblotted with an antibody to ER{alpha}. B, U2OS-ER{alpha} cells were treated with 10 nM E2 for the times indicated, and then kinetic ChIP assays were performed using antibodies to ER{alpha}, c-jun, HSF-2, or C/EBPß. C, Immunoblot of C/EBPß, c-jun, and HSF-2 in U2OS-ER{alpha} cells transfected in the absence or presence of 50 nM pooled control, c-jun, or C/EBPß siRNA duplex or with the empty pSilencer 1.0-U6 or the vector containing a hairpin to HSF-2. After 3 d, the cells were treated with 10 nM E2 for 12 h, and then protein levels were determined by immunoblotting. NKG2E mRNA was measured by real-time PCR in U2OS-ER{alpha} cells treated for 3 d with c-jun, HSF-2, and C/EBPß siRNA (D, E, and F, respectively). siRNA did not effect basal NKG2E gene expression. Each data point is the average ± SEM of triplicate determinations. a, b, c, P < 0.05, significant difference between the indicated treatments. *, P < 0.05, significant difference from control values.

 
Kinetics of ER{alpha} and cluster protein assembly on the NKG2E promoter after E2 treatment
Whereas the coimmunoprecipitation studies demonstrate that ER{alpha} interacts with the cluster proteins in intact cells, they do not show that these factors interact at the NKG2E promoter. To assess the occupancy of ER{alpha} and cluster proteins at the NKG2E promoter over time, we performed kinetic ChIP assays. U2OS-ER{alpha} cells were treated with E2 for 15, 30, 60, or 180 min before they were cross-linked with formaldehyde. ER{alpha} binding to the NKG2E promoter was first detected 15 min after E2 treatment and steadily increased to reach maximal levels by 180 min (Fig. 5BGo). The kinetics of HSF-2 binding to the NKG2E promoter was similar to ER{alpha}. Significant C/EBPß binding only occurred at 180 min (Fig. 5BGo). Similarly, recruitment of c-jun to the NKG2E promoter was only observed at 180-min treatment with E2, but the basal levels of c-jun bound to NKG2E gene were high (data not shown), suggesting that c-jun is already present at the promoter before E2 treatment.

Silencing of c-jun, HSF-2, and C/EBPß inhibits E2-mediated activation of the NKG2E gene
To further explore a functional role for cluster proteins in ER{alpha} activation of the NKG2E gene, we used RNA interference to silence the cluster protein genes. After 3 d of gene silencing, we observed a significant reduction in c-jun, HSF-2, and C/EBPß protein levels (Fig. 5CGo). The decline in protein levels was associated with a 40–70% reduction in the activation of the NKG2E gene by E2 (Fig. 5D–FGo) compared with cells treated with control siRNA. Silencing treatments did not affect gene expression of control genes regulated by E2 (naked cuticle, solute carrier family 4, H19, and cat eye syndrome chromosome region, candidate 6) (data not shown). These results provide additional evidence that the amount of cluster proteins present in cells determines the magnitude of ER activation of the NKG2E gene.

The activation of the NKG2E promoter by E2 and SERMs requires both activation function 1 (AF-1) and AF-2 domains of ER{alpha}
ER contains two functional domains, AF-1 and AF-2, that mediate transcriptional activation in response to ligands (40). AF-1 is located in the N-terminal A/B domains and is constitutively active (41). The AF-1 is activated by antiestrogens, such as tamoxifen (26), which causes the recruitment of coactivators (42, 43, 44). AF-2 is located in the ligand binding domain (LBD) and is activated by agonists that lead to the recruitment of coactivators (10) and is antagonized with SERMs by the recruitment of corepressors (9). To explore the role of AF-1 and AF-2 in the activation of the NKG2E promoter, U2OS cells were transfected with the NKG2E promoter and an ER{alpha} mutant that lacks AF-1 (HE19) or two point mutations that impair AF-2 by preventing coactivator interaction (K362A and E542K) (45). The activation of the NKG2E promoter by E2, tamoxifen, and raloxifene was abolished with HE19 (Fig. 6AGo). A marked reduction in activation by E2 and tamoxifen occurred with both AF-2 mutants, whereas the effect of the AF-2 mutants was not as pronounced in the presence of raloxifene. These results indicate that E2 and SERMs promote AF-1 and AF-2 cooperation to activate the NKG2E promoter.


Figure 6
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 6. The activation of the NKG2E promoter by E2 and SERMs requires both AF-1 and AF-2 domains of ER{alpha} and is mediated by p160 coactivators. A, U20S cells were cotransfected with the –3438 NKG2E construct and expression vectors for wild-type (WT) ER{alpha} or an ER{alpha} mutant, which lacks the AF-1 domain (HE19), or ER{alpha} mutants, which impair the AF-2 domain (K362A and E542K). The cells were treated with 10 nM E2, 1 µM tamoxifen (Tamox), or 1 µM raloxifene (Ralox) for 18 h, and luciferase activity was measured. B–E, U2OS-ER{alpha} cells were treated with 10 nM E2 (E), 1 µM tamoxifen (T), or 1 µM raloxifene (R) for 3 h. C, Control. ChIP was performed using antibodies to ER{alpha}, SRC-1, GRIP1, or AIB1 (B, C, D, and E, respectively). Immunoprecipitated chromatin fragments were PCR amplified and quantitated by real-time PCR using primers for the NKG2E promoter. Each data point is the average ± SEM of three independent assays. *, P < 0.05, significant differences from control values. a, b, P < 0.05, significant difference between the indicated treatments.

 
Coactivator-specific recruitment by E2 and SERMs
As mentioned above, we used the NKG2E gene as a model to better understand the mechanism whereby target genes are regulated by E2 and SERMs. Therefore, we next sought to study the downstream factors involved in this regulation. It is well known that E2 activates genes by recruiting p160/SRC coactivators, SRC-1, SRC-2 (GRIP1), and SRC-3 (AIB1), (10, 46) to the AF-2 surface of ER (47, 48, 49). However, the mechanisms involved in SERM activation of genes are poorly understood. After identifying the ER regulatory unit in the NKG2E gene, we examined whether the p160 coactivators play a role in the activation by SERMs. We performed ChIP with ER{alpha} or p160s antibodies. ER{alpha} was recruited to the NKG2E element after treatment with all three drugs (Fig. 6BGo). E2 and tamoxifen recruited GRIP1 (Fig. 6DGo) and AIB1 (Fig. 6EGo) to the NKG2E gene. Raloxifene recruited only AIB1 to the NKG2E gene (Fig. 6EGo). None of the drugs recruited SRC-1 to the NKG2E gene (Fig. 6CGo). It is unlikely that the lack of recruitment of SRC-1 is attributable to the differential expression of coactivators, because our microarray data show that SRC-1 and AIB1 mRNA levels are 7.5-fold and 2-fold higher than GRIP1 mRNA in U2OS-ER{alpha} cells (data not shown). Furthermore, we found that SRC-1 is recruited to other genes regulated by E2 (data not shown), demonstrating that SRC-1 protein is expressed in the U2OS cells. These results demonstrate that level of recruitment of GRIP1 correlated with the activity of the ligands in functional assays and provide evidence that coactivators mediate the activation of the NKG2E gene by both E2 and SERMs.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We studied the NKG2E gene as a model to characterize a regulatory element derived from a native gene that is activated by both E2 and SERMs in the presence of ER{alpha} (30). The ER regulatory element was mapped to the –1.83 to –1.68 kb region of the NKG2E promoter. Surprisingly, our deletion and mutation studies showed that the NKG2E regulatory element is extremely complex and requires multiple and distant elements for regulation by E2 and SERMs. The activation of the NKG2E promoter by E2 and SERMs was inhibited by mutations in c-jun, HSF-2, and C/EBPß elements. The NKG2E promoter does not contain a classical ERE but instead it has a vERE. This sequence includes a variant proximal half-site and a perfect distal half-site separated by only two nucleotides instead of three, which is characteristic of the classical EREs. Mutations in both half-sites of the vERE blocked the activation by E2 and SERMs, demonstrating that both sites are required for full activation. This vERE was not detected in software designed to identify EREs. Furthermore, ER{alpha} did not bind to this element in gel shift assays, and the element was not activated by E2 or SERMs upstream of the TK promoter. These findings demonstrate that the vERE is inactive on its own. In contrast, the vERE was activated by E2 and SERMs in the presence of a transcription factor cluster containing c-jun, HSF-2, and C/EBPß elements positioned adjacent to the vERE. Surprisingly, the cluster by itself was not regulated upstream of TK, although it contains an AP-1 element.

Our ChIP analyses confirm that E2 causes the assembly of a complex at the NKG2E regulatory element that consists of ER{alpha}, c-jun, HSF-2, and C/EBPß. The complex interactions between ER{alpha} and multiple transcription factors that are required for binding to the vERE could explain our inability to observe ER{alpha} binding in nuclear extracts prepared from U2OS-ER{alpha} cells treated with E2 (data not shown). We propose that the role of the transcription factor cluster is to create a platform for ER binding and a functional ERE by stabilizing ER binding to the vERE. Without the cluster proteins, any binding of ER{alpha} to the vERE is probably too unstable for it to remain there long enough to recruit coactivators and other factors required for gene activation. It is known that single transcription factors, such as AP-1 (26) and Sp1 (18), can interact with ER to alter the magnitude of regulation by estrogens and SERMs. More recently, it has been shown that the transcription factor forkhead box A1 can be essential for ER binding to DNA regulatory elements (50, 51). Our study extends these findings by showing that ER{alpha} can interact with a cluster of transcription factors to regulate transcription at a vERE that by itself is incapable of binding ER{alpha} and therefore is nonfunctional. Unlike the typical EREs in known target genes, which ER{alpha} can bind to independent of other factors, our findings indicate that there are EREs induced by transcription factors. ER{alpha} can activate inducible EREs, such as the one in the NKG2E promoter, only when it is tethered to a transcription factor complex. The activation of the vERE most likely results from direct ER/DNA binding as demonstrated by the observation that the ERE binding mutant (HE82) was ineffective at activating the NKG2E promoter.

The observation that a vERE can be activated, although the half-sites are separated by only two nucleotides instead of the standard three, might significantly expand the number of EREs in the genome. Using bioinformatics to search the human genome, we found that there are 8199 genes that contain a putative ERE with a two nucleotide spacer. Of these genes, 3307 have expression data, of which 21 genes were regulated by estrogens by at least 1.5-fold change. Whereas it is unknown whether any of these genes are regulated by EREs containing a two nucleotide spacer, our data with the NKG2E regulatory element indicates that it conceivable that some of these genes are regulated by two spacer EREs.

We demonstrated that silencing of c-jun, HSF-2, and C/EBPß genes with siRNA resulted in a marked decline in the magnitude of induction of NKG2E mRNA after treatment with E2. These findings suggest that, in cells containing ER{alpha}, the magnitude of activation of the NKG2E gene will be altered by the relative levels of c-jun, HSF-2, and C/EBPß. In this model, only those tissues that express sufficient levels of c-jun, HSF-2, and C/EBPß would be expected to show an activation of the NKG2E gene by E2 and SERMs with ER{alpha}. Interestingly, a similar regulatory unit is also present in the NKG2D family member, which is differentially expressed in tissues. However, like NKG2E, NKG2D is also activated by E2 and SERMs in the U2OS cells (data not shown). Our data along with the observations that HSF-2 (52) or C/EBPß (53) knock-out mice exhibit female subfertility or sterility also suggest that these transcription factors may have a more extensive role in the tissue-specific regulation of target genes by estrogens.

It is well established that SERMs exert antagonistic effects on gene expression by disrupting the AF-2 surface and recruiting corepressors, such as nuclear receptor corepressor, to ERs. In contrast, the mechanism underlying the agonist action of SERMs that leads to gene activation is poorly understood. Studies by Kushner et al. (19) have suggested that the activation at AP-1 elements by SERMs may involve the sequestration of corepressors, such as nuclear receptor corepressor or silencing mediator of retinoic acid and thyroid hormone receptors. By blocking corepressor recruitment to ER, the SERMs would allow activation function-1 (AF-1) activity in the A/B domain to operate more efficiently so as to activate the gene (49). The role of the p160 coactivators in SERM gene activation is unclear. Structural analysis of the ER LBDs has shown that SERMs act as antagonists by blocking the movement of helix 12 to a position that creates a functional AF-2 surface. In fact, in the presence of SERMs, helix 12 actually occupies the coactivator binding site (49). This prevents the binding of coactivators to the ER LBD required to activate gene transcription. These findings suggest that SERMs do not recruit p160s to activate genes. However, several studies suggest that coactivators may be involved in gene activation in response to SERMs. Coactivators can bind to the A/B domain of ER in the presence of SERMs (42, 43, 44), which could potentiate intrinsic AF-1 activity. Shang and Brown (54) reported that tamoxifen recruits the coactivator SRC-1 to genes activated in endometrial cells but not in MCF-7 breast cancer cells. Alternatively, it is conceivable that the AF-2 surface is not destroyed when ER is tethered to transcriptional factor complexes bound to NKG2E gene, which would allow some coactivator recruitment to the AF-2 surface even in the presence of SERMs. Another possible explanation is that the SERMs recruit coactivators to a unique surface of ER{alpha}. Regardless of the precise location of the coactivator binding to ER{alpha}, our studies clearly indicate that the agonist action of SERMs at the NKG2E gene is mediated by ER{alpha} recruitment of p160s coactivators.

Our study demonstrates that the collaboration between multiple transcription factors and ER could be an important mechanism to elicit tissue-specific effects and determine the magnitude of gene activation by E2 and SERMs. A greater understanding of the elements in native genes that mediate the regulation by E2 and SERMs could provide the basis to develop safer SERMs that regulate only selective genes in target tissues.


    Acknowledgments
 
We thank Pierre Chambon for providing plasmids and Peter Kushner, Guy Cinamon, and Rina Meidan for valuable comments on this manuscript.


    Footnotes
 
This work was supported by National Center for Complementary and Alternative Medicine Grant AT002173 and the American Cancer Society (to D.C.L.).

Disclosure Statement: The authors have nothing to declare.

First Published Online March 29, 2007

Abbreviations: AF, Activation function; AIB1, amplified in breast cancer-1 protein; AP-1, activator protein 1; C/EBPß, CCAAT/enhancer-binding protein ß; ChIP, chromatin immunoprecipitation; CREB, cAMP response element-binding protein; ER, estrogen receptor, ERE, estrogen response element; E2, estradiol; GRIP1, glucocorticoid receptor-interacting protein 1; HSF-2, heat-shock factor 2; LBD, ligand binding domain; NKG2E, killer cell lectin-like receptor; siRNA, small interfering RNA; SERM, selective estrogen receptor modulator; Sp1, stimulatory protein 1; SRC, steroid receptor coactivator; TK-luc, thymidine kinase promoter-luciferase gene; vERE, variant ERE-like element.

Received December 5, 2006.

Accepted for publication March 19, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889–895[Abstract/Free Full Text]
  2. Green S, Chambon P 1988 Nuclear receptors enhance our understanding of transcription regulation. Trends Genet 4:309–314[CrossRef][Medline]
  3. Green S, Walter P, Kumar V, Krust A, Bornert JM, Argos P, Chambon P 1986 Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature 320:134–139[CrossRef][Medline]
  4. Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA 1996 Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  5. McDonnell DP, Norris JD 2002 Connections and regulation of the human estrogen receptor. Science 296:1642–1644[Abstract/Free Full Text]
  6. Levin ER 2003 Bidirectional signaling between the estrogen receptor and the epidermal growth factor receptor. Mol Endocrinol 17:309–317[Abstract/Free Full Text]
  7. McDonnell DP, Clemm DL, Hermann T, Goldman ME, Pike JW 1995 Analysis of estrogen receptor function in vitro reveals three distinct classes of antiestrogens. Mol Endocrinol 9:659–669[Abstract/Free Full Text]
  8. Metivier R, Penot G, Hubner MR, Reid G, Brand H, Kos M, Gannon F 2003 Estrogen receptor-{alpha} directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115:751–763[CrossRef][Medline]
  9. Shang Y, Hu X, DiRenzo J, Lazar MA, Brown M 2000 Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103:843–852[CrossRef][Medline]
  10. Smith CL, O’Malley BW 2004 Coregulator function: a key to understanding tissue specificity of selective receptor modulators. Endocr Rev 25:45–71[Abstract/Free Full Text]
  11. Metivier R, Reid G, Gannon F 2006 Transcription in four dimensions: nuclear receptor-directed initiation of gene expression. EMBO Rep 7:161–167[CrossRef][Medline]
  12. O’Lone R, Frith MC, Karlsson EK, Hansen U 2004 Genomic targets of nuclear estrogen receptors. Mol Endocrinol 18:1859–1875[Abstract/Free Full Text]
  13. Klein-Hitpass L, Schorpp M, Wagner U, Ryffel GU 1986 An estrogen-responsive element derived from the 5' flanking region of the Xenopus vitellogenin A2 gene functions in transfected human cells. Cell 46:1053–1061[CrossRef][Medline]
  14. Bajic VB, Tan SL, Chong A, Tang S, Strom A, Gustafsson JA, Lin CY, Liu ET 2003 Dragon ERE Finder version 2: a tool for accurate detection and analysis of estrogen response elements in vertebrate genomes. Nucleic Acids Res 31:3605–3607[Abstract/Free Full Text]
  15. Tang S, Han H, Bajic VB 2004 ERGDB: estrogen responsive genes database. Nucleic Acids Res 32:D533–D536
  16. Klinge CM, Jernigan SC, Mattingly KA, Risinger KE, Zhang J 2004 Estrogen response element-dependent regulation of transcriptional activation of estrogen receptors {alpha} and ß by coactivators and corepressors. J Mol Endocrinol 33:387–410[Abstract/Free Full Text]
  17. Bourdeau V, Deschenes J, Metivier R, Nagai Y, Nguyen D, Bretschneider N, Gannon F, White JH, Mader S 2004 Genome-wide identification of high-affinity estrogen response elements in human and mouse. Mol Endocrinol 18:1411–1427[Abstract/Free Full Text]
  18. Krishnan V, Wang X, Safe S 1994 Estrogen receptor-Sp1 complexes mediate estrogen-induced cathepsin D gene expression in MCF-7 human breast cancer cells. J Biol Chem 269:15912–15917[Abstract/Free Full Text]
  19. Kushner PJ, Agard DA, Greene GL, Scanlan TS, Shiau AK, Uht RM, Webb P 2000 Estrogen receptor pathways to AP-1. J Steroid Biochem Mol Biol 74:311–317[CrossRef][Medline]
  20. Lee W, Mitchell P, Tjian R 1987 Purified transcription factor AP-1 interacts with TPA-inducible enhancer elements. Cell 49:741–752[CrossRef][Medline]
  21. Angel P, Imagawa M, Chiu R, Stein B, Imbra RJ, Rahmsdorf HJ, Jonat C, Herrlich P, Karin M 1987 Phorbol ester-inducible genes contain a common cis element recognized by a TPA-modulated trans-acting factor. Cell 49:729–739[CrossRef][Medline]
  22. Dynan WS, Tjian R 1983 The promoter-specific transcription factor Sp1 binds to upstream sequences in the SV40 early promoter. Cell 35:79–87[CrossRef][Medline]
  23. Jakacka M, Ito M, Weiss J, Chien PY, Gehm BD, Jameson JL 2001 Estrogen receptor binding to DNA is not required for its activity through the nonclassical AP1 pathway. J Biol Chem 276:13615–13621[Abstract/Free Full Text]
  24. Kim K, Barhoumi R, Burghardt R, Safe S 2005 Analysis of estrogen receptor {alpha}-Sp1 interactions in breast cancer cells by fluorescence resonance energy transfer. Mol Endocrinol 19:843–854[Abstract/Free Full Text]
  25. Saville B, Wormke M, Wang F, Nguyen T, Enmark E, Kuiper G, Gustafsson JA, Safe S 2000 Ligand-, cell-, and estrogen receptor subtype ({alpha}/ß)-dependent activation at GC-rich (Sp1) promoter elements. J Biol Chem 275:5379–5387[Abstract/Free Full Text]
  26. Webb P, Lopez GN, Uht RM, Kushner PJ 1995 Tamoxifen activation of the estrogen receptor/AP-1 pathway: potential origin for the cell-specific estrogen-like effects of antiestrogens. Mol Endocrinol 9:443–456[Abstract/Free Full Text]
  27. Paech K, Webb P, Kuiper G, Nilsson S, Gustafsson J-A, Kushner P, Scanlan T 1997 Differential ligand activation of estrogen receptors ER{alpha} and ERß at API sites. Science 277:1508–1510[Abstract/Free Full Text]
  28. Schultz JR, Petz LN, Nardulli AM 2005 Cell- and ligand-specific regulation of promoters containing activator protein-1 and Sp1 sites by estrogen receptors {alpha} and ß. J Biol Chem 280:347–354[Abstract/Free Full Text]
  29. Frasor J, Danes JM, Komm B, Chang KC, Lyttle CR, Katzenellenbogen BS 2003 Profiling of estrogen up- and down-regulated gene expression in human breast cancer cells: insights into gene networks and pathways underlying estrogenic control of proliferation and cell phenotype. Endocrinology 144:4562–4574[CrossRef][Medline]
  30. Kian Tee M, Rogatsky I, Tzagarakis-Foster C, Cvoro A, An J, Christy RJ, Yamamoto KR, Leitman DC 2004 Estradiol and selective estrogen receptor modulators differentially regulate target genes with estrogen receptors {alpha} and ß. Mol Biol Cell 15:1262–1272[Abstract/Free Full Text]
  31. Hodges LC, Cook JD, Lobenhofer EK, Li L, Bennett L, Bushel PR, Aldaz CM, Afshari CA, Walker CL 2003 Tamoxifen functions as a molecular agonist inducing cell cycle-associated genes in breast cancer cells. Mol Cancer Res 1:300–311[Abstract/Free Full Text]
  32. Hanstein B, Liu H, Yancisin MC, Brown M 1999 Functional analysis of a novel estrogen receptor-ß isoform. Mol Endocrinol 13:129–137[Abstract/Free Full Text]
  33. Hall JM, McDonnell DP 1999 The estrogen receptor ß-isoform (ERß) of the human estrogen receptor modulates ER{alpha} transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology 140:5566–5578[Abstract/Free Full Text]
  34. Zou A, Marschke KB, Arnold KE, Berger EM, Fitzgerald P, Mais DE, Allegretto EA 1999 Estrogen receptor ß activates the human retinoic acid receptor {alpha}-1 promoter in response to tamoxifen and other estrogen receptor antagonists, but not in response to estrogen. Mol Endocrinol 13:418–430[Abstract/Free Full Text]
  35. Tzagarakis-Foster C, Geleziunas R, Lomri A, An J, Leitman DC 2002 Estradiol represses human T-cell leukemia virus type 1 Tax activation of tumor necrosis factor-{alpha} gene transcription. J Biol Chem 277:44772–44777[Abstract/Free Full Text]
  36. Paruthiyil S, Parmar H, Kerekatte V, Cunha GR, Firestone GL, Leitman DC 2004 Estrogen receptor ß inhibits human breast cancer cell proliferation and tumor formation by causing a G2 cell cycle arrest. Cancer Res 64:423–428[Abstract/Free Full Text]
  37. Cvoro A, Tzagarakis-Foster C, Tatomer D, Paruthiyil S, Fox MS, Leitman DC 2006 Distinct roles of unliganded and liganded estrogen receptors in transcriptional repression. Mol Cell 21:555–564[CrossRef][Medline]
  38. Burakov D, Crofts LA, Chang CP, Freedman LP 2002 Reciprocal recruitment of DRIP/mediator and p160 coactivator complexes in vivo by estrogen receptor. J Biol Chem 277:14359–14362[Abstract/Free Full Text]
  39. Mader S, Kumar V, de Verneuil H, Chambon P 1989 Three amino acids of the oestrogen receptor are essential to its ability to distinguish an oestrogen from a glucocorticoid-responsive element. Nature 338:271–274[CrossRef][Medline]
  40. Kumar V, Green S, Stack G, Berry M, Jin JR, Chambon P 1987 Functional domains of the human estrogen receptor. Cell 51:941–951[CrossRef][Medline]
  41. Metzger D, Ali S, Bornert JM, Chambon P 1995 Characterization of the amino-terminal transcriptional activation function of the human estrogen receptor in animal and yeast cells. J Biol Chem 270:9535–9542[Abstract/Free Full Text]
  42. Webb P, Nguyen P, Shinsako J, Anderson C, Feng W, Nguyen MP, Chen D, Huang SM, Subramanian S, McKinerney E, Katzenellenbogen BS, Stallcup MR, Kushner PJ 1998 Estrogen receptor activation function 1 works by binding p160 coactivator proteins. Mol Endocrinol 12:1605–1618[Abstract/Free Full Text]
  43. Dutertre M, Smith CL 2003 Ligand-independent interactions of p160/steroid receptor coactivators and CREB-binding protein (CBP) with estrogen receptor-{alpha}: regulation by phosphorylation sites in the A/B region depends on other receptor domains. Mol Endocrinol 17:1296–1314[Abstract/Free Full Text]
  44. Tremblay A, Tremblay GB, Labrie F, Giguere V 1999 Ligand-independent recruitment of SRC-1 to estrogen receptor ß through phosphorylation of activation function AF-1. Mol Cell 3:513–519[CrossRef][Medline]
  45. Feng W, Ribeiro RC, Wagner RL, Nguyen H, Apriletti JW, Fletterick RJ, Baxter JD, Kushner PJ, West BL 1998 Hormone-dependent coactivator binding to a hydrophobic cleft on nuclear receptors. Science 280:1747–1749[Abstract/Free Full Text]
  46. Lonard DM, O’Malley BW 2005 Expanding functional diversity of the coactivators. Trends Biochem Sci 30:126–132[CrossRef][Medline]
  47. Brzozowski AM, Pike AC, Dauter Z, Hubbard RE, Bonn T, Engstrom O, Ohman L, Greene GL, Gustafsson JA, Carlquist M 1997 Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389:753–758[CrossRef][Medline]
  48. Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA, Greene GL 1998 The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95:927–937[CrossRef][Medline]
  49. Nettles KW, Greene GL 2005 Ligand control of coregulator recruitment to nuclear receptors. Annu Rev Physiol 67:309–333[CrossRef][Medline]
  50. Carroll JS, Liu XS, Brodsky AS, Li W, Meyer CA, Szary AJ, Eeckhoute J, Shao W, Hestermann EV, Geistlinger TR, Fox EA, Silver PA, Brown M 2005 Chromosome-wide mapping of estrogen receptor binding reveals long-range regulation requiring the forkhead protein FoxA1. Cell 122:33–43[CrossRef][Medline]
  51. Laganiere J, Deblois G, Lefebvre C, Bataille AR, Robert F, Giguere V 2005 From the cover: location analysis of estrogen receptor {alpha} target promoters reveals that FOXA1 defines a domain of the estrogen response. Proc Natl Acad Sci USA 102:11651–11656[Abstract/Free Full Text]
  52. Wang G, Zhang J, Moskophidis D, Mivechi NF 2003 Targeted disruption of the heat shock transcription factor (hsf)-2 gene results in increased embryonic lethality, neuronal defects, and reduced spermatogenesis. Genesis 36:48–61[CrossRef][Medline]
  53. Sterneck E, Tessarollo L, Johnson PF 1997 An essential role for C/EBPß in female reproduction. Genes Dev 11:2153–2162[Abstract/Free Full Text]
  54. Shang Y, Brown M 2002 Molecular determinants for the tissue specificity of SERMs. Science 295:2465–2468[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
N. Levy, D. Tatomer, C. B. Herber, X. Zhao, H. Tang, T. Sargeant, L. J. Ball, J. Summers, T. P. Speed, and D. C. Leitman
Differential Regulation of Native Estrogen Receptor-Regulatory Elements by Estradiol, Tamoxifen, and Raloxifene
Mol. Endocrinol., February 1, 2008; 22(2): 287 - 303.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Levy, N.
Right arrow Articles by Leitman, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Levy, N.
Right arrow Articles by Leitman, D. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals