help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-1737
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elsasser, T. H.
Right arrow Articles by Rodrigo, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elsasser, T. H.
Right arrow Articles by Rodrigo, J.
Endocrinology Vol. 148, No. 8 3803-3813
Copyright © 2007 by The Endocrine Society

Caveolae Nitration of Janus Kinase-2 at the 1007Y-1008Y Site: Coordinating Inflammatory Response and Metabolic Hormone Readjustment within the Somatotropic Axis

Ted H. Elsasser, Stanislaw Kahl, Cong-Jun Li, James L. Sartin, Wesley M. Garrett and José Rodrigo

Agricultural Research Service (T.H.E., S.K., C.-J.L., W.M.G.), U.S. Department of Agriculture, Beltsville, Maryland 20705; Department of Anatomy, Physiology, and Pharmacology, College of Veterinary Medicine (J.L.S.), Auburn University, Auburn, Alabama 36849; and Department of Neuroanatomy and Cellular Biology (J.R.), Cajal Institute, E-28002 Madrid, Spain

Address all correspondence and requests for reprints to: Ted H. Elsasser, Growth Biology Laboratory, U.S. Department of Agriculture, Agricultural Research Service, B-200, Room 201, BARC-east, Beltsville, Maryland 20705. E-mail: elsasser{at}anri.barc.usda.gov.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Life-threatening proinflammatory response (PR) induces severe GH resistance. Although low-level PR is much more commonly encountered clinically, relatively few studies have investigated the accompanying change in GH signal transduction progression and, in particular, the impact of low-level PR on Janus kinase (JAK)-2. Using a low-level, in vivo endotoxin [lipopolysaccharide (LPS)] challenge protocol, we demonstrated that the liver tissue content of JAK2 declined 24 h (62%, P < 0.02) after LPS and that tyrosine-nitrated JAK2 could be immunoprecipitated from post-LPS liver biopsy homogenates. With antibodies developed to probe specifically for nitration at the 1007Y-1008Y phosphorylation epitope of JAK2, we demonstrated that the nitrated 1007Y-1008Y-JAK-2 (nitro-JAK2) coimmunoprecipitated with caveolin-1 and 1177phospho-SER-endothelial nitric oxide synthase when post-LPS liver homogenates were treated with anticaveolin-1 and protein A/G. The magnitude of increase in nitro-JAK2 was attenuated in animals treated with vitamin E prior to LPS. The increase in nitro-JAK2 after LPS was greater in a line of experimental animals with a genetic propensity for higher PR at the given LPS dose than responses measured in their normal counterparts. The development and remission of nitro-JAK2 was temporally concordant with changes in plasma concentrations of IGF-I; hepatocellular IGF-I mRNA content was inversely proportional to nitro-JAK2 content. Localized changes in the state of nitration of regulatory phosphorylation domains of JAK2 in caveolar microenvironments and tissue content of JAK2 during PR suggest a unique mechanism through which discrete signal transduction switching might occur in the liver to fine tune cellular responses to the endocrine-immune signals that develop during low-level, transient proinflammatory stress.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE PROINFLAMMATORY STRESS cascade (PSC) in sepsis and endotoxemia initiates a reprioritization of metabolic processes necessary for survival (1, 2, 3), measured steps but with critical impact on the rapidly growing young. For example, after the administration of endotoxin [lipopolysaccharide (LPS)], as used to model and initiate the proinflammatory cascade, many of the anabolic events associated with GH-directed metabolism are attenuated or restrained to divert and conserve nutrients for use in homeostatic processes at the onset of PSC. Collectively over time, this can be recognized in association with the temporary decreases in rates of growth observed in the young during bouts of illness. There develops a state of refractory GH responsiveness in cells termed an uncoupling of the somatotropic axis or GH resistance. This manifests itself as an inability for GH to direct metabolic activities, especially those credited to GH but mediated more directly by IGF-I (4, 5). The magnitude of change in metabolic status is largely proportional to the intensity of the immune challenge. Responses impacting growth range from simple lower levels of protein accretion through frank catabolism (1, 4, 5). These perturbations are considered the cellular response to actions initiated by the increased flux of proinflammatory cytokines like TNF-{alpha} and IL-1 released at the onset of the acute phase response. Significant in this cascade is the TNF-{alpha}-directed generation of nitric oxide (NO) by nitric oxide synthase (NOS) and any of several metabolic fates of NO (6, 7).

Several regulatory phenomena relevant to the change in activity of the somatotropic axis during PSC have been documented. These include decreased GH receptor (GHR) content, altered activity of signal transducer and activators of transcription (STAT) proteins, increased activity of suppressors of cytokine signaling (SOCS) proteins by TNF-{alpha} (8, 9, 10), and a generalized decrease in IGF-I message transcription (11). In many instances, during the host response to proinflammatory stimuli, the generated reaction products of NO and superoxide anion interact with the resulting production of highly reactive oxynitrogen species such as peroxynitrite (ONOO) (12, 13, 14). Endogenously produced ONOO is capable of chemically nitrating in vivo several molecular targets, in particular, phenolic ring-containing compounds like tyrosine (forming 3-nitrotyrosine) (14). Mostly considered a reaction with pathological implications, posttranslational nitration modifications such as these largely have been defined as biomarkers signifying the ONOO-derived generation of 3-nitrotyrosine in proteins in situations ranging from host responses to immune stimuli (14) to drug metabolism toxicities (15). Whereas several changes in protein function have been associated with tyrosine nitration, the majority of changes have been considered an impairment to protein function, especially where conformational change or steric hindrance in protein structure coincides with the site of nitration (12, 13, 14, 16, 17). The half-life of nitrated proteins is also significantly shortened (18), suggesting that nitration has an impact on cellular function via alterations in protein turnover. In addition, new data suggest that prolonged tyrosine nitration can further impact normal function through the development of autoimmune characteristics in which nitrated proteins lose self-recognition (19).

In previous experiments within our laboratory, we observed that an increase in generalized hepatic protein tyrosine nitration, generated after low-level LPS challenge in calves, coincided with attenuation of IGF-I regulation by GH (20, 21). In that work (21), the significant reduction in tyrosine nitration observed in calves pretreated with vitamin E before the LPS challenge was consistent with the capacity for vitamin E to counteract ONOO-directed tyrosine nitration (22) as well as exert its major antioxidant activity within biological membranes (23, 24). Janus kinase (JAK)-2, in particular its phosphorylation status, is considered a critical control point in the progression of GH signaling to the nucleus (25, 26, 27). However, to date, few if any studies on the impact of oxidative stress on this main postreceptor signal transduction initiating element have been reported. In particular, no references to the more commonly encountered low-level, transient proinflammatory stress are reported. To fill in missing information on the posttranslational fate of JAK2 during the PSC, we undertook a series of studies aimed at determining whether critical control epitopes of JAK2 might undergo oxidative nitration concurrent with down-regulation of IGF-I status. We used a mild challenge with LPS to elicit the proinflammatory cytokine-driven generation of ONOO and detailed the impact on JAK2 with further associative reference to changes in the IGF-I axis. Our reasoning was that in kinases like JAK2, if tyrosine phosphorylation activation sites served as targets for in vivo posttranslational nitration by ONOO, a phenomenon with selective rather than random focus, the result would entail impaired orthophosphorylation due to steric and charge interference by the nitrate positioned at the adjacent 3' carbon of the phenolic ring of tyrosine (7, 17, 28). We recently demonstrated that this 1007Y-1008Y epitope of JAK2 resided in an aspartate/glutamate sequence motif previously identified with increased propensity for ONOO-mediated nitration (29) and that nitration in this site blocked further phosphorylation of the 1007Y (30).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Experimental subjects
Experimental LPS challenge protocols were conducted in vivo in calves. All calves used in these studies were born and reared at the U.S. Department of Agriculture Beltsville Agricultural Research Center (Beltsville, MD); their use in the study and the associated protocols were preapproved by the U.S. Department of Agriculture Beltsville Animal Care and Use Committee in regard to an animal comfort, safety, and welfare. After their use in a protocol, each animal was returned to the herd after an appropriate period of veterinary observation. For the various experiments, one or both of the two immune response phenotypes were used. Immune response phenotype was designated as normal (NORM) or hyperresponder (HPR) according to previously validated observations and published characterizations on changes in plasma TNF-{alpha} and hepatic NOS activity (31). Calves termed NORM responded to LPS with increased plasma concentrations of TNF-{alpha}, fever, biphasic glucose response, and increased plasma concentrations of nitrate + nitrite (end products of NO production and oxidation). As characteristic of the normal response to repeated LPS, the magnitude of change in these same variables was significantly attenuated after a second challenge with the same dose of LPS 5 d later, a commonly encountered phenomenon called endotoxin tolerance or down-regulation (32). In comparison, HPR calves fail to exhibit tolerance, present increased plasma concentrations of TNF-{alpha} after the repeated LPS challenge and consequently maintain or up-regulate the intensity of metabolic and hormonal perturbations or impairments.

Calves were fed ad libitum a balanced growth diet supplying 14% crude protein and 2.67 Mcal metabolizable energy per kilogram dried diet with appropriate vitamin and mineral additives to support a daily weight gain between 1.1 and 1.5 kg as per National Research Council Nutrient Requirements of Beef Cattle (33). All calves used in these studies were tested between 5 and 12 months of age with management of backgrounding health supported by a standardized program of vaccination, periodic deworming for parasite control, and veterinary oversight. For a given protocol, however, animals were of a uniform age (month of age ± 0.5).

Endotoxin challenge protocol
One day before immune challenge and blood sampling, a sterile Teflon cannula (Abbocath-T, 14 gauge; Abbot Laboratories, North Chicago, IL) was inserted into the jugular vein under sterile conditions and secured in place. Jugular cannula insertion was performed under local anesthesia using an ethyl chloride topical refrigerant spray (Gebauer Chemical Co., Cleveland, OH) with the patency of each cannula maintained with a heparin lock (20 U/ml). LPS (Escherichia coli 055:B5; Sigma Chemicals, St. Louis, MO; 0.2 or 2.5 µg/kg live weight according to protocol) was administered by iv bolus as previously described and validated (28). Blood samples for plasma harvest were obtained at time 0 just before LPS administration and at 1, 2, 3, 4, 7, and 24 h after LPS. Where a dual challenge was administered, the same dose of LPS was reinjected into the same animal 5 d later. The dual challenge protocol was used to demonstrate how the principle of LPS tolerance (31, 32) to repeated exposure to this proinflammatory agent would affect the observed biological responses.

Liver biopsy procedure
Three to five liver biopsy cores averaging approximately 30 mg wet weight each were obtained by intercostal transcutaneous biopsy under sterile conditions under a lidocaine (0.5%; Butler Co., Columbus, OH) tissue block administered with a descending tissue infiltration. Biopsy cores were obtained using the Tru-cut biopsy needle (14 gauge; Allegiance Healthcare Corp., McGraw Park, IL) for each animal at specified time points. To facilitate the insertion of the biopsy needle through the body wall, a 10-cm, 10-gauge guide needle was inserted between the ribs. Samples were obtained in accordance with the centimeter depth guide markings on the biopsy needle with coordinates used to obtain tissue approximately 1–2 cm below the surface of the liver. Biopsy cores were either frozen in liquid N and stored at –85 C or fixed overnight in 4% paraformaldehyde in PBS, transferred to 70% ethanol, and processed by paraffin embedding for sectioning at 6 µ for immunohistochemical evaluation. Unless otherwise stated, the general protocol for biopsy involved repeated tissue harvest at time 0, 7, and 24 h relative to an LPS injection. Based on several metabolite, blood cell, and clinical serology profiles conducted on blood samples analyzed at the New York State College of Veterinary Medicine Clinical Pathology Unit (Ithaca, NY), this sampling regimen had no significant impact on liver biochemistry or organ physiology.

Development of antiserum against nitrated JAK-2 kinase
In light of the information developed by Feng et al. (34) wherein an important phosphorylation activation domain of JAK-2 kinase at the 1007Y-1008Y epitope was reported, we had constructed to our specifications several 20-amino acid peptides corresponding to the JAK2 sequence spanning residues 1001–1020 as well as the respective nitrotyrosine and phosphotyrosine analog substitutions at the 1007 and 1008 positions (Fig. 1Go). Peptides were synthesized by SynPep Corp. (Dublin, CA) and purified by reverse-phase HPLC to greater than 95% purity. For antibody production, the peptide indicated by letter b (... nitro1007Y-nitro1008Y...) in Fig. 1Go was linked to keyhole limpet hemocyanin and used as the antigen for antibody (antinitro1007Y-nitro1008Y-JAK2 = antinitro-JAK2) generation in New Zealand white rabbits. Serum from the peak ELISA binding test bleeds was further purified by reverse-affinity, solid-phase adsorption using the native a, d, and f peptides linked to a polycarbonate plastic surface with further absorption performed agarose-conjugated keyhole limpet hemocyanin (Sigma). As judged by a solid-phase immuno-dot-blot method, the antiserum tested positive for the peptides containing nitrotyrosine at either or both the 1007 or 1008 locations and had 0 cross-reactivity with the phosphorylated or the native peptides.


Figure 1
View larger version (51K):
[in this window]
[in a new window]

 
FIG. 1. Amino acid sequences of native, phosphorylated, and nitrated analog peptides spanning the 1001- to 1020-residue region of JAK2 kinase with accompanying dot blot analysis of cross-reactivity and specificity.

 
Immunoprecipitation and Western blot protocols
Liver homogenates were prepared by disrupting 30 mg wet weight liver biopsy samples in ice-cold radioimmunoprecipitation (RIPA) buffer [50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 2 mM EGTA] containing 0.1% Tritox X-100 (35) using three 10-sec bursts of a Polytron homogenizer (Brinkmann Instruments Inc., Westbury, NY) set at maximum. This material was further subjected to sonication using a Misonex-XL sonicator (Misonex Co., Farmingdale, NY). The supernatant from a centrifugation at 14,000 x g was collected and retained. Protein concentrations were normalized after analysis (BCA protein reagents, Pierce, Inc., Rockford, IL).

For direct Western blot of SOCS-3, 20 µg total homogenate protein were loaded per lane into polyacrylamide gels. After the protein separation run, transfer to nitrocellulose, and nonspecific blocking, SOCS-3 was visualized by incubating the blots in 1% BSA in Tris-saline buffer containing 3 µg/ml affinity-purified rabbit antihuman CIS3/SOCS3 (IBL Co. Ltd., Gunma, Japan).

For purposes of immunoprecipitation purification, supernatant fractions were incubated at 4 C overnight with agarose-conjugated rabbit-antimouse JAK-2 (Santa Cruz Biotech, Santa Cruz, CA) or anticaveolin-1 (mouse anticaveolin clone 2234; B-D Biosciences, San Jose, CA). Caveolar proteins bound to the caveolin-anticaveolin complex were immunoprecipitated using agarose-conjugated protein A/G (Santa Cruz Biotechnology). The beads washed four times in L-radioimmunoprecipitation assay without Triton X-100. After aspiration of the final wash, the beads were resuspended in Laemmli ß-mercaptoethanol reducing electrophoresis buffer containing bromphenol blue tracking dye and heated to 80 C for 10 min. Proteins were separated by standard PAGE methods, transferred to nitrocellulose, and prepared for standard Western blot identification of proteins using anti-JAK-2 (Santa Cruz Biotechnology), antinitrotyrosine (36), anticaveolin-1 (B-D Biosciences), anti-1177SER-phospho-endothelial NOS (phospho-eNos; Upstate Biotechnology, Inc., Lake Placid, NY), or anti-JAK2. Bands were identified by standard chemiluminescent detection and band densities quantified where applicable using gray scale OD units were derived from the image analysis as performed using the Image-Pro software (ImagePro-Plus; Media Cybernetics, Inc., Silver Spring, MD).

Quantitative nitrated (nitrotyrosine) protein immunohistochemistry
Biopsy cores were collected from each animal at the needed time points, fixed in paraformaldehyde, embedded in paraffin, and analyzed for nitro-1007Y-1008Y-JAK2 immunoreactivity. Two section slices were mounted per slide and the continuity of staining, compared for quality control purposes. Tissue sections were deparaffinized in xylene, treated with methanolic peroxide to eliminate endogenous peroxidase activity, rehydrated to water through progressively decreasing ethanol concentrations, and transferred to 0.05 M Tris-0.135 M saline (pH 7.5). Sections were treated for 10 min with 0.05% Triton X-100, washed in Tris, and treated for 1 h with 3% normal goat serum in 1% casein-Tris-saline (Bio-Rad Laboratories, Hercules, CA) to block nonspecific binding.

All relevant tissue samples were batch processed in a single run to eliminate interprocedural daily variation in results. Quantitative measures of nitro-1007Y-1008Y-JAK2 resulting from the nitro-oxidative stresses of LPS challenge were established using immunohistochemical staining procedures with the absorbed rabbit antinitro-1007Y-1008Y-JAK2. The specificity of antigen recognition was validated through a series of quality control procedures as suggested by Gow et al. (37). Visualization of immunostaining was accomplished using the avidin-biotin complex (ABC)-horseradish peroxidase (HRP; ABC method) complex method (Vector Laboratories, Burlingame, CA). Nuclei were counterstained for 2 min using Carrazzi’s hematoxylin. After dehydration of sections through 100% ethanol into xylene, coverslips were applied using optically clear Permaslip liquid mounting media (Alban Scientific, Inc., St. Louis, MO).

Confocal fluorescent colocalization studies were performed using the same primary antibodies further labeled with either ALEXA 488 (green) or ALEXA 594 (red) bound to goat antirabbit antibodies (Invitrogen-Molecular Probes, Carlsbad, CA). In these instances, the methanolic peroxide step was omitted from the processing protocol. As an additional positive control, the principle of supraoptimal dilution of anti-JAK2 (20, 38, 39) was applied to several specimen slides. Briefly, this process increases the sensitivity of the method in which the lower levels of antigen abundance in a structure is progressively less visualized as the dilution of primary antibody increases. In this manner, the highest levels of antigen can be resolved at the lower concentrations of primary antibody. For the data presented here, anti-JAK2 serum was applied at the optimized 1:2,500 dilution. Supraoptimal (1:5,000) dilutions yielded correspondingly diminished pixel intensity and density, whereas signal extinction occurred at 1:10,000 (data not shown).

In situ hybridization for IGF-I mRNA
In situ hybridization for IGF-I mRNA was performed for visual microscopy localization within cells as well as quantification using a validated image analysis technique described in detail in the following section. The basic protocol followed the probe manufacturer’s specifications. Sense, antisense and poly(dT) reactants were manufactured by IBT Immunological and Biochemical Test Systems GmBH (Reutlingen, Germany). The sense and antisense probes were 48-mer oligos derivatized with biotin for use in avidin-biotin detection: sense control, ACCCGTGCCTGTCTCGCTCGACTGAACCGTCCGAACTCCCCACGCGTT antisense probe, TGGGCACGGACAGAGCGAGCTGACTTGGCAGGCTTGAGGGGTGCGCAA.

This probe recognizes the conserved nucleotides 426–473 within the coding sequence of M37484.

Paraformaldehyde-preserved liver tissue biopsy specimens were prepared for in situ hybridization as paraffin-embedded sections, 6 µm thick, using RNase protection protocols as performed by the commercial histology laboratory performing the service (Histoserve, Inc., Gaithersburg, MD). All solutions, including organic solvents, were fresh, first-time-use reagents to ensure an RNase-free environment. Specimens were rehydrated by traditional paraffin dewaxing using xylene with sequential baths in decreasing concentrations of ethanol to pure water (nuclease-free water; Ambion Inc., Austin, TX). After rehydration, cells were permeabilized using a 45-min incubation with proteinase-K [10 µg/ml in 0.1 M Tris and 50 mM EDTA (pH 7.4), 37 C]. The reaction was stopped by immersion into a solution of 0.1 M glycine in PBS (pH 7.3, 5 min). Acetylation of tissues was accomplished using an initial incubation of slides in 0.1 M triethanolamine (pH 8.0) followed by the addition of acetic anhydride to a final concentration of 0.5% (5 min with gentle shaking). Slides were rinsed twice for 5 min each in RNase-free water. The antisense probe was diluted to 40 µg/ml and the sense and poly-dT probes diluted to 300 µg/ml in hybridization buffer (PerfectHyb Plus; Sigma) and incubated overnight at 37 C in a humidified block heater. After removal of the slides from the block heater, stringency washes were performed. Buffer for stringency washes was prepared from a 20x stock [20x saline sodium citrate (SSC)] of sodium chloride (3.0 M) and sodium citrate (0.3 M) obtained from Ambion. Sequential washes were performed: 1) twice with 2x SSC buffer with 0.1% sodium dodecyl sulfate (2 min, room temperature); 2) once with 1x SSC with 10 mM dithiothreitol (DTT; 2 min, room temperature); 3) twice with 1x SSC with 10 mM DTT (15 min, 55 C); 4) twice with 0.5x SSC with 10 mM DTT (15 min, 55 C); and 5) once with 0.5x SSC with 10 mM DTT (10 min, room temperature).

Visualization of the in situ probes
Procedure 1.
Visualization and image analysis quantification were accomplished using HRP conversion of 3'-diaminobenzidine (DAB) to a brown product. The sensitivity of the detection process was enhanced using a biotinylated tyramide deposition on the specimens modified from kit components obtained from Molecular Probes. Briefly, the biotin-IGF-I probes on the tissue sections were incubated with avidin-HRP (Neutravidin; Molecular Probes; 1:2000, 30 min, room temperature) and washed three times in 50 mM Tris saline. Biotinylated tyramide was diluted 1:100 in H2O2 reaction buffer as per kit instructions and applied to the slides for 10 min. Slides were washed twice in 50 mM Tris saline. Final resolution of the image was accomplished using a second incubation with avidin-HRP at 1:2000 for 30 min followed by extensive washing. DAB (0.75 mg/ml) was dissolved in Tris buffer (pH 7.5), filtered through a nitrocellulose 0.2 M filter, and activated with H2O2 (final concentration 0.000075%). All slides were reacted for the same time and the reaction stopped at 5 min with the transfer of the slides to Tris buffer. Nuclei were counterstained using freshly prepared Carrazzi’s hematoxylin for 2 min followed by flushing in running tap water for 15 min. Slides were dehydrated and coverslip mounted.

Procedure 2.
Confocal colocalization of IGF-I mRNA and nitro-JAK2 were performed using laser-activated triple fluorescence. IGF-I mRNA in situ hybridization was performed as described above through the biotinylated tyramide enhancement with the exception that the final reporter for the fluorescence was avidin-Alexa-Fluor 488 (Molecular Probes; green fluorescence). Localization and visualization of nitro-JAK2 was accomplished on the same tissue section after the in situ hybridization reaction using the ABC immunohistochemical process described. The final fluorescent signal was boosted using a custom synthesized reporter consisting of goat anti-rabbit IgG conjugated to a 70,000-MW dextran coupled with multiple Alexa-Fluor 680 probe reporters (Molecular Probes; red fluorescence). This fluorescent reporter displayed a maximum absorption at 676 nM and a relative degree of labeling at 1.4 mol of dye per mole of protein as determined using an extinction coefficient ({epsilon}) of 180,000 cm–1M–1 at 676 nM (analysis performed by Molecular Probes). Nuclear localization staining was accomplished with 4',6-diamidino-2-phenylindole (blue fluorescence).

Digitized image analysis process
For DAB-light microscopy photography, each section was photographed in two separate locations in each of the three biopsy cores at full illumination power through an BX-40 microscope (Olympus, Center Valley, PA) using an Olympus DP-70 digital camera. Fluorescent confocal images were acquired in frame mode with a Zeiss LSM 410 (Carl Zeiss, Thornwood, NY) confocal microscope through a x63 C-apochromat 1.2 numerical aperture water immersion objective. The 488- and 568-nm wavelengths of an Omnichrome Corp. (Chino, CA) Ar/Kr laser were used to excite green- and red-emitting fluorochromes, respectively. A 515- to 540-nm band-pass filter was used for green-emitting fluorochromes and long-pass 590-nm filter for red emitting fluorochromes. Individual optical sections were digitally recombined into a single composite image using LSM software (Carl Zeiss).

For quantification purposes, each image was analyzed using the Image-Pro Plus image analysis software (version 4.5.1; MediaCybernetics) through a protocol previously validated in our laboratory for light microscopy (20) and immunofluorescence (40). Captured images were equalized in terms of contrast, brightness, and gamma using the software-driven internal best-fit equalization. The intensity of DAB color-specific staining was obtained by defining through color cube-based segmentation a spectrum-specific range of wavelengths, hues, and intensities that corresponded to those color attributes detectable by the same staining procedure applied to an internal control liver specimen known to contain positive and gradient levels of nitrotyrosine immunostaining (20). Similarly, by using serial sections of this internal standardized tissue and effecting a decreasing signal intensity to extinction with the use of progressively increasing dilutions of the nitro-1JAK-2 primary antibody (supraoptimal dilution), we could accurately define and quantify signal intensity and differentiate true signal from background on the immunostained slides. For light as well as fluorescent images, specificity of staining was further defined in the software application cutoff criteria in which object counts lower than a 3-by-3 pixel unit were eliminated. As defined in this manner, this analytical solution was found to be most commonly associated with false-negative staining, thus minimizing errors of false-positive inclusion through this conservative rubric. This spectral information was filed into retrievable *.rge formats that were subsequently used for analyzing images.

Statistical data evaluation
Comparisons between treatment groups for in vivo data were made using a mixed-model polynomial regression-based ANOVA as per the mixed models procedure (Proc MIXED) of the Statistical Analysis System (SAS) program (41). Main effects and interactions were considered significant where the derived P value was less than 0.05. Animal within treatment was used as the random error term.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Levels of tyrosine nitrated JAK-2 are affected by the proinflammatory response to LPS
Western blot analysis of proteins immunoprecipitated from a total liver homogenates with agarose-conjugated anti-JAK2 indicated that JAK2 was nitrated after animals were challenged with LPS (Fig. 2Go). In this figure, the level of tyrosine nitration visualized using antinitrotyrosine serum, largely absent from JAK2 obtained from calves before LPS, was starkly up-regulated in total homogenate samples obtained 24 h after LPS.


Figure 2
View larger version (37K):
[in this window]
[in a new window]

 
FIG. 2. Representative Western blot of liver homogenate proteins from control (before LPS, lane 1) and after LPS (24 h, 2.5 µg/kg E. coli 055:B5 LPS, lanes 2 and 3) biopsy samples. Homogenate proteins were subjected to an immunoprecipitation protocol using agarose-conjugated antimouse JAK2. After separation of proteins by PAGE and transfer to nitrocellulose, Western blot analysis in contemporary duplicate gels for JAK2 and nitrotyrosine was performed. Samples are representative of biopsy cores from three calves at the respective time points.

 
Detection of epitope-specific JAK-2 nitration and its modulation by antioxidant treatment before a proinflammatory challenge
Tissues collected at 24 h from animals challenged with 2.5 µg/kg LPS presented a 6-fold increase (P < 0.01) over basal levels in the nitration of the nitro-JAK2 epitope (Fig. 3AGo). Average epitope-specific nitro-JAK2 pixel density was decreased 32% (P < 0.04) in samples collected from calves pretreated with {alpha}-tocopherol (vitamin E) before the LPS challenge, compared with LPS-challenged calves not receiving vitamin E, suggesting the potential for much of the specific nitration to be derived from membrane-based reactions. When tissues were immunostained for nitro-JAK2 using the biotinylated tyramide enhancement technique, we quantified by color spectrum-specific pixel identification a low but measurable presence of this epitope-specific nitrated JAK2 in tissues from animals not yet challenged with LPS. The omission of primary antibody resulted in a total loss of immunostaining in any of the tissue sections; in addition, performing the immunostaining under conditions of supraoptimal dilution resulted in the loss of immunostaining in the control tissues (–LPS, –vitamin E) but still detected the more abundant antigen density in tissues from LPS-treated animals (data not shown).


Figure 3
View larger version (125K):
[in this window]
[in a new window]

 
FIG. 3. A, Immunohistochemical localization of epitope-specific protein tyrosine nitration in liver tissue of normal calves after a single challenge (2.5 µg/kg, bolus, iv, E. coli 055:B5) using an antinitro-JAK2 antibody and an ABC reporter with HRP/DAB color development. Panels labeled 60x represent high-power photomicrographs of the letter-labeled region of the corresponding x20 low-power field. DAB color spectrum-specific epitope-nitration, represented by red pixels from the image analysis algorithm, was minimally present in tissues obtained from calves not challenged with LPS (left panel). In contrast, 24 h after LPS challenge, intense staining was apparent (middle panel), whereas pretreatment with a mixed {alpha}- and {gamma}-tocopherol (VitE; right panel) significantly decreased the development of nitration. Graphed data (far right panel) summarizes the mean pixel density (±SEM) of four to six animals per treatment group summated from five fields per animal tissue slide. Control vs. LPS: P < 0.01, +LPS +VitE vs. +LPS –VitE: P < 0.04. B, Presentation of epitope-specific nitration of JAK2 using the nitro-JAK2 antibody in immunohistochemical evaluation of liver biopsy samples of normal and proinflammatory hyperresponding calves collected before (Pre) or 7 or 24 h after the second LPS challenge (left panels). The heightened sensitivity of HPR calves to LPS challenge is manifested in significantly more digitally identified, epitope-specific JAK2 nitration before (Pre, i.e. as a carryover from the first LPS challenge 4 d earlier) and at 7 and 24 h (far right graphic) after LPS. *, P < 0.05 NORM vs. HPR at indicated times.

 
Further testing this observation in the separate challenge study, we were able to refine observations regarding the development of epitope-specific JAK2 nitration wherein we observed differences in the levels of nitration between NORM and HPR calves not only after the first of two LPS challenges but also at time 0 (Pre) of the second of the two LPS challenge (Fig. 3BGo). This increased JAK2 nitration at time 0 in the second LPS challenge period reflects the general propensity of the HPR calves to sustain the proinflammatory perturbations that resulted from the initializing LPS challenge dose. The increase in pixel density for nitro-JAK2 occurred sooner (7 h after LPS, P < 0.02) and to a higher extent (24 h after LPS, P < 0.05) in HPR calves, compared with responses measured in their normal counterparts. Immunolocalization of this nitro-JAK2 antigen further suggested that the nitration response was also prevalent as a structure-oriented nitration; the presence of positive immunostaining localized was more prominently in regions surrounding central veins and the hepatic sinuses.

Relationships between nitro-JAK2 development and the IGF-I axis during the proinflammatory response
The nature of the response to LPS in the HPR and NORM calves was further evaluated with regard to a biological end point, namely the association of the proinflammatory expression of nitro-JAK2 nitration with the status of the IGF-I axis. We had obtained plasma samples from all NORM and HPR calves before (time 0) and at 7 and 24 h after a very low (0.2 µg/kg, iv), single LPS challenge. When plasma IGF-I concentrations were measured at these various time points (Fig. 4AGo), we determined that the magnitude of the decrease in plasma IGF-I after LPS was greater in the HPR than the NORM calves. When we quantified these relationships by performing quantitative immunohistochemistry for nitro-JAK2 (DAB) and in situ hybridization (DAB) for IGF-I mRNA in serial section of tissues, the inverse relationship between IGF-I message and the generation of nitro-JAK-2 was striking (Fig. 4BGo). Furthermore, the relative sensitivity of the phenotype of the subjects was clearly separated at the 7-h point at which time both the generation of increased levels of nitro-JAK-2 and decreased IGF-I mRNA in HPR was significantly different from that quantified in NORM calves. Interestingly and in contrast to plasma IGF-I level responses, mRNA responses appeared to rebound at the 24-h point in NORM calves, whereas plasma IGF-I levels as well as tissue mRNA content remained low in HPR. This suggests a multiplicity of influences over the final plasma concentration of IGF-I more complex than simple regulation of transcription and the abundance of mRNA.


Figure 4
View larger version (38K):
[in this window]
[in a new window]

 
FIG. 4. A, Changes in plasma concentrations of IGF-I in normal and hyperresponder calves challenged with a single low-level LPS dose (E. coli 055:B5, 0.2 µg/kg, iv). B, Quantification of nitro-JAK2 (red) and IGF-I mRNA (blue) indicated an inverse relationship wherein increases in nitro-1007Y-1008YJAK-2 corresponded to decreases in IGF-I mRNA. Values represent mean pixel densities per field for 12 calves per phenotype before 0.2 µg/kg LPS and three calves per phenotype per time point at 7 and 24 h, respectively. Values were obtained using an ABC-DAB reporter for both immunohistochemistry (nitro-JAK2) and in situ hybridization on serial-cut sections of biopsied liver (IGF-I mRNA). *, P < 0.05, **, P < 0.02, normal vs. hyperresponders.

 
When we subjected tissue specimens collected by biopsy from calves to a triple fluorescent label confocal microscopic evaluation to localize the relative structural proximity of nitro-JAK2 (by immunohistochemistry) and mRNA for IGF-I (by in situ hybridization), it became apparent that on an almost cell-by-cell basis (Fig. 5Go) in which nitration was present, mRNA for IGF-I was largely absent. This feature was most striking in the structure-related areas in close proximity to the central veins with a gradient-like decrease in intensity occurring with more distance away from the central veins. The color shift associated with colocalization of red and green fluorescence produces a yellow pixel; analysis of the images generated here indicate relatively few yellow pixels, further suggesting that where intensely present to indicate a large generation of nitro-JAK-2, there is practically no green, e.g. few molecules of IGF-I mRNA.


Figure 5
View larger version (99K):
[in this window]
[in a new window]

 
FIG. 5. Triple-color confocal microscopic images of nitro-JAK2 antigen (red fluorescence) and IGF-I mRNA (bright green fluorescence) in liver tissue harvested from calves before and 7 h after they were challenged with LPS (E. coli 055:B5, 2.5 µg/kg, iv). Color-specific pixel density image analysis revealed that liver cells displaying elevated pixel densities of nitro-JAK2 were relatively devoid of mRNA for IGF-I and vice versa. A, Low level of pixels specific for nitro-JAK2 or IGF-I mRNA in the general liver parenchyma. B (+7 h after LPS), C (before LPS), and D (7 h after LPS), The much higher antigen and mRNA presence in cells more closely positioned with a central vein. Image regions immediately to the left of the double asterisk and the single asterisk in D were reproduced (E and F, respectively) at x10 higher magnification to illustrate the nature of the punctuate staining patterns in cells close to the central vein. The blue color represents nuclear staining, whereas the dull green is a background autofluorescence characteristic of RBCs and endogenous porphyrin compounds in the liver.

 
Nitro-JAK2 colocalizes to caveolae and phosphorylation-activated eNOS
When we further used a Triton X-100 liver homogenate preparation and subjected this to immunoprecipitation with anticaveolin, we observed a coprecipitation of both eNOS and nitro-JAK2. Our Western blot analysis (Fig. 6Go) of the liver tissue homogenates revealed that the mean caveolin content was decreased by LPS challenge (77%, P < 0.01 vs. time 0) at the 3 h sampling point, slightly rebounding to increase over time, but attaining only 64% of the initial value at 24 h. Probing with the antibody specific for activated phospho-eNOS indicated that LPS increased caveolae-associated eNOS activation early in the response followed shortly by a presentation of epitope-specific nitration in JAK2 at the 7 h postchallenge biopsy sampling point.


Figure 6
View larger version (35K):
[in this window]
[in a new window]

 
FIG. 6. A, Western blot analysis of liver proteins obtained by biopsy from representative calves at each time indicated after a single LPS challenge (2.5 µg/kg body weight). Homogenate proteins were immunoprecipitated with anticaveolin, separated by PAGE, transferred to nitrocellulose, and probed for caveolin (top), the nitro-JAK2 (middle), and 1177S-phosphorylation activated eNOS (bottom). Lanes represent the band patterns of two calves at each time point. Peak levels of JAK nitration were observed in samples collected at 6–7 h after LPS, commensurate with the peak of increased plasma nitrite/nitrate concentrations (data not shown) and a marked early decline in plasma IGF-I. B, Mean (±SEM) OD measurements of band intensities of caveolin-1 (black bars), nitro-JAK2 (gray bars), and phosphorylated eNOS (white bars) from Western blot of A as affected by LPS challenge. **, P < 0.01 vs. time 0. C, The specificity of the antinitro-JAK2 serum is indicated in the approximately 130-kDa band highlighted in the full-length Western blot (Blot) of the anticaveolin-1 immunoprecipitated proteins (Gel-Coomassie staining of a contemporary duplicated gel lane of a representative PAGE protein separation).

 
Impacting and fortifying the observation regarding the caveolar localization of this particular nitration reaction, dual-color confocal immunohistochemical (Fig. 7Go) procedures incorporating the use of the rabbit anti-nitro-JAK2 (Fig. 7AGo, green fluorescence) and a mouse monoclonal anticaveolin (Fig. 7BGo, red fluorescence) illustrated that nitro-JAK2 colocalized predominantly with the caveolin-1 (Fig. 7CGo, yellow pixels). With this image superimposed over an interference phase-contrast image (Fig. 7DGo) of the same coordinates, it is realized that many of these caveolin/ nitro-JAK2 colocalizations are identifiable predominantly along what appear to be adjacent cell membrane boarders, consistent with the membrane localization of caveolae as well as some unidentified internal cytoplasmic structures.


Figure 7
View larger version (44K):
[in this window]
[in a new window]

 
FIG. 7. Dual-color fluorescence confocal immunohistochemical identification and colocalization of caveolin-1 and nitro-JAK2. A and B, Green and red channels, respectively. C, The channel overlay with items displaying yellow, indicating antigen colocalization. D, Channel overlay combining the confocal presentation with an interference phase contrast image of the same cellular area. The bottom panels represent x10 magnification images of the regions in the top panels marked by the arrows. Red fluorescence was associated with the caveolin-1, green fluorescence with nitro-JAK2. This specimen represents liver tissue obtained from one of several calves 6–7 h after initial challenge with LPS (E. coli, 055:B5, 2.5 µg/kg body weight).

 
Impact of low-level LPS challenge on changes in the SOCS-3 inhibitory protein
The Western blot and summary statistics regarding the change in mean SOCS3 content at time 0 and 3, 6, and 24 h after LPS challenge is presented in Fig. 8Go.


Figure 8
View larger version (36K):
[in this window]
[in a new window]

 
FIG. 8. Changes in SOCS-3 in liver homogenate preparations obtained from calves (n = 6) before (0) and at 3, 6, and 24 h after LPS (E. coli 055:B5, 2.5 µg/kg, iv). A, Western blot for the six individual calves at the four time points. B, Mean OD of the SOCS-3 band gray-scale intensities as derived from the applied densitometry analysis. Data represent means ± SEM; P > 0.05 for time points 3, 6, and 24 vs. 0.

 
Measurable at time 0, mean liver content of SOCS-3 for the six subjects increased approximately 55% over baseline at 3 and 7 h after LPS, with a subsequent return to baseline at 24 h. The numerical increase for each animal was marginal and was not statistically significant as mean concentrations grouped by time.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we report for the first time the generation of a specific nitration at a regulatory epitope of JAK2 temporally evolving in concert with the cascade of factors launched by the initiation of the proinflammatory response to immune challenge. This posttranslational chemical modification appears to be a prime candidate for inclusion in the select group of signal transduction processes that regulate the change in activity of the somatotropic axis during a low-level proinflammatory response. Nitrations of this form were thought to be inhibitory to phosphorylation at the same site due to presumed significant steric and charge interference (7, 16, 17, 28). Recent data from our laboratory (30) confirm that the presence of a 3'-nitration on either the 1007Y or 1008Y residues blocks any further phosphorylation of the native 1007Y of JAK when 20-amino acid native and nitrated peptide analogs of the epitope were used as substrates for phosphorylation in in vitro kinase reactions.

We used three approaches across several studies to characterize the impact of specific tyrosine nitration at a JAK2 epitope (1007Y-1008Y), a site previously characterized by Feng et al. (34) to be critical for phosphorylation activation of JAK2. The first approach was aligned with the goal of identifying a nitration at this location generated in the highly repeatable, well-timed proinflammatory response to low level in vivo immune challenges with coliform LPS. In the second approach, we also investigated the capacity for this nitration to be modulated by the prevailing redox milieu as effected by the administration of exogenous vitamin E before LPS challenge. The third approach assessed the generation of this nitration and its impact on biologically appropriate reporters down stream from the GHR and mediated by activation of JAK2, namely plasma concentration changes in IGF-I and cell content of IGF-I mRNA. In this assessment, responses specific to each of two phenotypically different calf populations were compared. One population was considered by several proinflammatory response criteria to be normal responding (i.e. plasma TNF-{alpha} levels and development of tolerance to repeated LPS challenge). The other population was characterized as genetically predisposed to heightened proinflammatory response to inciting agents such as LPS. Identified through our laboratory and termed hyperresponders (31), these calves present higher TNF-{alpha} plasma concentration responses to LPS and fail to mount a tolerance response to repeated LPS challenge. Coincident with this, HPRs exhibit a more profound pathophysiological response. As indicated by their higher plasma peak TNF-{alpha} concentrations and acute phase response proteins after repeated LPS challenges as well as critically impaired metabolism, HPRs initiate an earlier state of heightened oxidative stress in response to a primary LPS challenge, compared with that quantifiable in normal animals, and maintain that state longer than that observable in animals that do down-regulate. In essence, what this model contributed to the experimental process was a biology-based increased sensitivity toward the method of detection of epitope-directed nitration achievable with the more robust TNF-{alpha} and NO response to LPS. Previously we had observed that the increase in generalized hepatic protein tyrosine nitration generated after low-level LPS challenge in calves coincided with attenuation of IGF-I regulation by GH (20, 21).

In the results of others in which phosphorylation or allosteric sites in proteins were found nitrated, the functions of some of the proteins (e.g. coagulation factors, superoxide dismutase, ceruloplasmin, cytochrome-C, tyrosine hydroxylase, epidermal growth factor receptor, and inducible NOS) (7, 14, 16, 29, 42) were severely compromised or absent. With regard to this level of protein dysfunction, more than 50 overt, long-term, progressive, or severe diseases spanning proinflammatory, neurological, respiratory, metabolic, cardiovascular, and pulmonary syndromes have been associated with tissue tyrosine nitration (7, 14, 16, 43). Most recently nitrated proteins have been identified in the pathology of pituitary adenoma (44). In the present study, the magnitude of the immune challenge was mild to moderate, transient, and certainly recoverable, given that all calves were returned to the herd and grown out without further consequences. Thus, the development of these nitration responses to immune challenge suggests that their generation may not necessarily be associated only with prolonged intense disease but also may participate in directing needed reprioritizations in hormone signaling on a transient basis.

In in vivo biological systems, nitration reactions are spatially and temporally defined in regard to the limiting diffusion potential of a nitrating reactant such as ONOO and its interactions with moderating species such as CO2, suitable molecular targets such as protein tyrosine residues, and even vitamin E itself (14, 22, 23). Thus, in our low-level immune stress model, the question remained as to how a relatively low-yield, diffusion-limited nitration reaction could and would occur in which a critical feature and potential rate-limiting event was the proximity of the protein phenolic targets to the nitrating milieu. In resolving this, we considered that JAK2 exists in several state- and function-dependent intracellular compartments ranging from plasma membrane-associated to free cytoplasmic. Additionally, our prior successful treatment of experimental subjects with vitamin E to reduce overall tissue nitration concomitant with the restoration of IGF-I status (21) implied that the generation and fate of reactants specific to this observation could be somewhat localized to a membrane-based site of impact in states of both normal (30) and perturbed health (45). Vitamin E has been reported to interact with peroxynitrite and attenuate its capability of nitrating tyrosine residues in proteins as well as exert its major antioxidant effects in hydrophobic environments such as lipid membranes and caveolae (23, 45), thus the justification for probing the membrane-based proinflammatory response cascade generation of ONOO with vitamin E. Our former observations are now extended with the realization that protein nitration as well as the IGF-I mRNA responses to LPS challenge are mutually modulatable with pretreatment of experimental subjects with vitamin E.

Until the present experiments, the specific presence of the JAK2 had not been localized to a caveolae structure nor had the specificity of a nitration at a significant phosphorylation region of this protein been described in a transient proinflammatory process with associated metabolic consequences. Justification was presented for the appropriateness of immunoprecipitation to generate a caveolae-rich preparation not different from that obtained with the more time consuming density centrifugation segregation protocols (46). When we applied the immunoprecipitation protocol for caveolae, we observed that after the LPS challenge the caveolin-1 content of the preparation decreased in accordance to previously published data (47), phosphorylated eNOS was contained in the preparation as was the JAK2 nitration product. Thus, the capability for JAK-2 to become chemically nitrated in a proscribed time course in these domains underscores the potential for this process to occur in a manner that could be considered more deliberate than random, a prime feature of regulatory processes. The inverse association between increased nitrated JAK2 and decreased mRNA content for IGF-I within discrete cells suggests that nitration of JAK2 may play a role in fine tuning the metabolic responses of cells to proinflammatory challenge through its potential to serve as an antagonist to phosphorylation progression within the GH/JAK/STAT cascade.

The research described here explored and characterized a mechanism through which membrane caveolae serve as biochemical work benches on which the needed constituents can be assembled to effect an epitope-specific nitration. Nitrations in these orientations are significant in their impact on key tyrosine residues of JAK2 kinase that ordinarily are phosphorylated to activate this kinase largely through a combination of factors including charge interactions, steric hindrance, and destabilization of tertiary structure associated with altered hydrogen bonding, factors demonstrated to be localized to rather explicit amino acid sequence reaction motifs (17, 29, 48). These interactions suggest a level of regulation for GH/cytokine bioactivity different from, but complementary to, other regulatory components, namely those involving STATs and CIS/SOCS protein effects (8, 9, 10, 11, 25, 26). Because this 1007Y-1008Y site also binds other GHR regulators (26, 27), the potential for the nitration(s) at this site to further modulate GHR activity by facilitating or retarding their respective associations underscores the complexities that develop in the functional regulation of very localized receptor activity during states typical of the proinflammatory response. Many tyrosines are specifically phosphorylated (in contrast to those that are specifically not posttranslationally modified), and the phosphorylation of tyrosine at one site may affect the phosphorylation of tyrosines at another site (26, 27, 49), although these details are only now being unraveled.

The present data depart somewhat from the general conclusion presented in (8), wherein the concept was put forth that LPS challenge provoked a huge increase in SOCS proteins that directly blocked JAK activity. Whereas there was no doubt that the 7.5 mg/kg (ip) dose of LPS used in those studies increased both mRNA and protein for SOCS-3 after challenge in rats (8), our data derived from the much lower dose challenge did not suggest that such a significant SOCS event consistently developed in our calves. The data here are consistent with the idea that probably several mechanisms contribute to the disruption in GH signal transduction, dependent on the intensity of the immune challenge, perhaps on a different time course but certainly localized to select tissue regions impacted by the immune stimulus delivered. The relative magnitude of host response to a given LPS dose may be expected to reach different levels and therefore evoke a different temporal presentation of signal transduction events. Our LPS dose of 2.5 µg/kg body weight was in fact 1/3000th the dose applied to the rats in (8). The uniqueness of the present findings reside in the level of transient, recoverable proinflammatory challenge used in an animal model system very sensitive to endotoxemia wherein homeostatic processes can be addressed, in contrast to levels of stress more typically associated with physiological failure from progressive multiple organ failure.

Several cytokine family receptors have been localized to caveolae, in particular those for GH (50) and TNF-{alpha} (51). Using recent information that the caveolae served as a structural base for eNOS phosphorylation in association with TNF-{alpha}-driven protein kinase B/AKT activity (52, 53), we hypothesized that the caveolae represented a potential physical workbench capable of consolidating the necessary biochemical components in the required proximity for successful nitration of the JAK2 if, in fact, JAK2 was even recruited to or present in the caveolae. We focused on eNOS as the logical source of NO production based on our prior observation that at the concentration of LPS used in our studies to initiate the proinflammatory response, eNOS enzyme activity was significantly more important in the liver than the type 2 inducible NOS isoform (20). Therefore, two of the potential necessary criteria for why a 1007Y-1008Y-JAK2 nitration would be membrane caveolae associated at all were fulfilled, i.e. the receptors using JAK kinases and the NO-generating eNOS were caveolae situated in a functional juxtaposition.

Many aspects of the signal transduction capacities of GH and TNF-{alpha} in interactions with their discrete receptors are mediated through JAK2 (22, 25, 54, 55). There are several potential tyrosine phosphorylation regulatory sites on JAK2, i.e. 221Y, 570Y (26, 27, 49) and 813Y (56), that could be studied for the purpose intended here. However, the 1007Y-1008Y epitope was chosen as an appropriate site to model the nitration effect because it is highly conserved across species, it has a general participation across both stimulatory and inhibitory bioactivities, and shares homology with domains of other proteins like the insulin receptor (27), making the observations potentially relevant to more proteins than just JAK2. More significant may be the nitration sequence defined elsewhere (29) and identified for the 1007/1008Y site for JAK2 (30) and is not present in regions flanking phosphorylation tyrosines located at 221, 570, or 813. We recognize the importance of very localized cell-to-cell differences in function within an organ responding to an immune challenge, in particular the liver in which the architecture proscribes many of the metabolic interactions and functions. However, how these sites of regulatory action are differentially coordinated to achieve discrete function within a defined biological need at a particular time and location is not well understood. The present work complements and extends to a molecular level recent suggestions from Lang et al. (10) describing aspects of clinical GH resistance and accompanying inability for GH to regulate hepatic IGF-I and metabolism mediated by cytokine inhibition of JAK-STAT signaling, especially where the response to low-level proinflammatory stress is the focus. Recent advances in plasma membrane structure/function relationships indicate the tremendous importance of localized microenvironments in the plasma membrane. Microdomains organized around such framework entities as caveolae and lipid rafts facilitate the structured organization of interacting moieties (50, 57).

We can now add to the list of functional caveolar-based activities the presence of the capacity to facilitate site-specific nitration of the signal transduction protein JAK2. The intramolecular pattern of tyrosine nitrations may be influenced by the nature of the intensity of the immune challenge with increased target specificity occurring where the production of the nitrating agent is spatially restricted and temporally defined. This implies a potential regulatory role for constrained, site-specific production of reactive nitrogen species such as ONOO as signal transduction intermediaries with a function toward modulating phosphorylation events. Again, under homeostatic circumstances, the caveolar workbench satisfies the constraints associated with response-directed, diffusion-limited nitration reactions and affords the capability of having cytokine receptor interactions coordinate and integrate the needed metabolic state. Additional work will need to be done to track and verify the cytokine receptor interactions that initiate inhibitory nitration in this format. However, the present data are consistent with nitration of tyrosine in the 1007/1008 site of JAK2 functioning as a means to antagonize phosphorylation at this site and down-modulate stimulatory activities otherwise facilitated by the phosphorylation of JAK at this site. The present work is complementary to and further extends previous findings demonstrating that LPS and TNF-{alpha} promote GH resistance in pathological situations (58, 59).


    Footnotes
 
Disclosure Statement: The authors have nothing to disclose.

First Published Online May 17, 2007

Abbreviations: ABC, Avidin-biotin complex; DAB, diaminobenzidine; DTT, dithiothreitol; eNOS, endothelial NOS; GHR, GH receptor; HRP, horseradish peroxidase; JAK, Janus kinase; LPS, lipopolysaccharide; NO, nitric oxide; NOS, NO synthase; ONOO, peroxynitrite; PSC, proinflammatory stress cascade; SOCS, suppressors of cytokine signaling; SSC, saline sodium citrate; STAT, signal transducer and activators of transcription.

Received December 22, 2006.

Accepted for publication May 9, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Elsasser TH, Klasing KC, Filipov N, Thompson F 2000 The metabolic consequences of stress: targets for stress and priorities of nutrient use. In: Moberg G, Mench J, eds. The biology of animal stress: basic principles and implications for animal welfare. New York: CABI Publishing; 77–110
  2. Sartin JL, Elsasser TH, Kahl S, Baker J, Daniel JA, Schwartz DD, Steele B, Whitlock BK 2003 Estradiol plus progesterone treatment modulates select elements of the proinflammatory cytokine cascade in steers: attenuated nitric oxide and thromboxane B2 production in endotoxemia. J Anim Sci 81:1546–1551[Abstract/Free Full Text]
  3. Colson A, Willems B, Thissen JP 2003 Inhibition of TNF-{alpha} production by pentoxifylline does not prevent endotoxin-induced decrease in serum IGF-I. J Endocrinol 178:101–109[Abstract]
  4. Thissen JP, Underwood LE, Ketelslegers JM 1999 Regulation of insulin-like growth factor-I in starvation and injury. Nutr Rev 57:167–176[Medline]
  5. Welbourne TC, Milford L, Carter P 1997 The role of growth hormone in substrate utilization. Baillieres Clin Endocrinol Metab 11:699–707[CrossRef][Medline]
  6. Edwards PD, Moldawer LL 1998 Role of cytokines in the metabolic response to stress. Curr Opin Clin Nutr Metab Care 1:187–190[CrossRef][Medline]
  7. Ischiropoulos H, Gow A 2005 Pathophysiological functions of nitric oxide-mediated protein modifications. Toxicology 208:299–303[CrossRef][Medline]
  8. Colson A, Le Cam A, Maiter D, Edery M, Thissen JP 2000 Potentiation of growth hormone-induced liver suppressors of cytokine signaling messenger ribonucleic acid by cytokines. Endocrinology 141:3687–3695[Abstract/Free Full Text]
  9. Defalque D, Brandt N, Ketelslegers JM, Thissen JP 1999 GH insensitivity induced by endotoxin injection is associated with decreased liver GH receptors. Am J Physiol 276:E565–E572
  10. Lang CH, Hong-Brown L, Frost RA 2005 Cytokine inhibition of JAK-STAT signaling: a new mechanism of growth hormone resistance. Pediatr Nephrol 20:306–312[CrossRef][Medline]
  11. Thissen JP, Verniers J 1997 Inhibition by interleukin-1 and tumor necrosis factor-{alpha} of the insulin-like growth factor I messenger ribonucleic acid response to growth hormone in rat hepatocyte primary culture. Endocrinology 138:1078–1084[Abstract/Free Full Text]
  12. Liochev SI, Fridovich I 2002 Superoxide and nitric oxide: consequences of varying rates of production and consumption: a theoretical treatment. Free Radic Biol Med 33:137–141[Medline]
  13. Pryor WA, Squadrito GL 1995 The chemistry of peroxynitrite: a product from the reaction of nitric oxide with superoxide. Am J Physiol 268:L699–L722
  14. Greenacre SA, Ischiropoulos H 2001 Tyrosine nitration: localisation, quantification, consequences for protein function and signal transduction. Free Radic Res 34:541–581[Medline]
  15. James LP, Mayeux PR, Hinson JA 2003 Acetaminophen-induced hepatotoxicity. Drug Metab Dispos 31:1499–1506[Abstract/Free Full Text]
  16. Gow AJ, Farkouh CR, Munson DA, Posencheg MA, Ischiropoulos H 2004 Biological significance of nitric oxide-mediated protein modifications. Am J Physiol Lung Cell Mol Physiol 287:L262–L268
  17. Ischiropoulos H 2003 Biological selectivity and functional aspects of protein tyrosine nitration. Biochem Biophys Res Commun 305:776–783[CrossRef][Medline]
  18. Souza JM, Choi I, Chen Q, Weisse M, Daikhin E, Yudkoff M, Obin M, Ara J, Horwitz J, Ischiropoulos H 2000 Proteolytic degradation of tyrosine nitrated proteins. Arch Bioch Biophys 380:360–366[CrossRef][Medline]
  19. Ohmori H, Kanayama N 2005 Immunogenicity of an inflammation-associated product, tyrosine nitrated self-proteins. Autoimmun Rev 4:224–229[CrossRef][Medline]
  20. Elsasser TH, Kahl S, MacLeod C, Nicholson B, Sartin JL, Li C 2004 Mechanisms underlying growth hormone effects in augmenting nitric oxide production and protein tyrosine nitration during endotoxin challenge. Endocrinology 145:3413–3423[Abstract/Free Full Text]
  21. Elsasser TH, Kahl S, Rumsey TS, Blum JW 2000 Modulation of growth performance in disease: reactive nitrogen compounds and their impact on cell proteins. Domest Anim Endocrinol 19:75–84[CrossRef][Medline]
  22. Pannala AS, Singh S, Rice-Evans C 1999 Interaction of carotenoids and tocopherols with peroxynitrite. Methods Enzymol 301:319–332[Medline]
  23. Goss SP, Singh RJ, Hogg N, Kalyanaraman B 1999 Reactions of *NO, *NO2 and peroxynitrite in membranes: physiological implications. Free Radic Res 31:597–606[CrossRef][Medline]
  24. Wang X, Quinn PJ 2000 The location and function of vitamin E in membranes. Mol Membr Biol 17:1431–1456
  25. Carter-Su C, Smit LS 1998 Signaling via JAK tyrosine kinases: growth hormone receptor as a model system. Recent Prog Horm Res 53:61–82[Medline]
  26. Carter-Su C, Rui L, Herrington J 2000 Role of the tyrosine kinase JAK2 in signal transduction by growth hormone. Pediatr Nephrol 14:550–557[CrossRef][Medline]
  27. Argetsinger LS, Kouadio JL, Steen H, Stensballe A, Jensen ON, Carter-Su C 2004 Autophosphorylation of JAK2 on tyrosines 221 and 570 regulates its activity. Mol Cell Biol 24:4955–4967[Abstract/Free Full Text]
  28. Turko IV, Murad F 2005 Mapping sites of tyrosine nitration by matrix-assisted laser desorption/ionization mass spectrometry. Methods Enzymol 396:266–275[Medline]
  29. Lanone, S, Manivet P, Callebert J, Launay JM, Payden D, Aubier, M, Boczkowski J, Mebazza A 2002 Inducible nitric oxide synthase (NOS2) expressed in septic patients is nitrated on selected tyrosine residues; implications for enzymic activity. Biochem J 366:399–404[CrossRef][Medline]
  30. Elsasser TH, Li C, Caperna TJ, Kahl S, Schmidt WF 2007 Growth hormone (GH)-associated nitration of Janus kinase-2 at the 1007Y-1008Y epitope impedes phosphorylation at this site: mechanism for and impact of a GH, AKT and nitric oxide synthase axis on GH signal transduction. Endocrinology 148:3792–3802[Abstract/Free Full Text]
  31. Elsasser TH, Blum JW, Kahl S 2005 Characterization of calves exhibiting a novel inheritable TNF-{alpha} hyperresponsiveness to endotoxin: associations with increased pathophysiological complications. J Appl Physiol 98:2045–2055[Abstract/Free Full Text]
  32. West MA, Heagy W 2002 Endotoxin tolerance: a review. Crit Care Med 30:64–73[CrossRef]
  33. National Research Council 1984 Nutrient requirements of beef cattle. Washington, DC: National Academy Press
  34. Feng J, Witthuhn BA, Matsuda T, Kohlhuber F, Kerr IM, Ihle JN 1997 Activation of Jak2 catalytic activity requires phosphorylation of Y1007 in the kinase activation loop. Mol Cell Biol 17:2497–2501[Abstract]
  35. Campbell GS, Argetsinger, LS, Ihle JN, Kelly, PA, Rillema JA, Carter-Su C 1994 Activation of JAK-2 tyrosine kinase by prolactin in NB2 cells and mouse mammary gland explants. Proc Nat Acad Sci USA 91:5232–5236[Abstract/Free Full Text]
  36. Uttenthal LO, Alonso D, Fernandez AP, Campbell RO, Moro MA, Leza JC, Lizasoain I, Esteban FJ, Barroso JB, Valderrama R, Pedrosa JA, Peinado MA, Serrano J, Richart A, Bentura ML, Santacana M, Martinez-Murillo R, Rodrigo J 1998 Neuronal and inducible nitric oxide synthase and nitrotyrosine immunoreactivities in the cerebral cortex of the aging rat. Microsc Res Tech 43:75–88[CrossRef][Medline]
  37. Gow AJ, McClelland M, Garner SE, Malcolm S, Ischiropoulos H 1998 The determination of nitrotyrosine residues in proteins. Methods Mol Biol 100:291–299[Medline]
  38. Vacca-Galloway LL 1985 Differential immunostaining for substance P in Huntington’s diseased and normal spinal cord: significance of serial (optimal, supra-optimal and end-point) dilutions of primary anti-serum in comparing biological specimens. Histochemistry 83:561–569[CrossRef][Medline]
  39. Springall DR, Collina G, Barer G, Suggett AJ, Bee D, Polak JM 1988 Increased intracellular levels of calcitonin gene-related peptide-like immunoreactivity in pulmonary endocrine cells of the hypoxic rat. J Pathology 155:259–267[CrossRef][Medline]
  40. Daniel JA, Elsasser TH, Martinez A, Steele B, Whitlock BK, Sartin JL 2005 Interleukin-1ß and tumor necrosis factor-{alpha} mediation of endotoxin action on growth hormone. Am J Physiol Endocrinol Metab 289:E650–657
  41. SAS Institute 1988 SAS system for linear models. Cary, NC: SAS Institute
  42. van der Vliet A, Hristova M, Cross CE, Eiserich JP, Goldkorn T 1998 Peroxynitrite induces covalent dimerization of epidermal growth factor receptors in A431 epidermoid carcinoma cells. J Biol Chem 273:31860–31866[Abstract/Free Full Text]
  43. Gole MD, Souza JM, Choi I, Hertkorn C, Malcolm S, Foust 3rd RF, Finkel B, Lanken PN, Ischiropoulos H 2000 Plasma proteins modified by tyrosine nitration in acute respiratory distress syndrome. Am J Physiol Lung Cell Mol Physiol 278:L961–L967
  44. Zhan X, Desiderio DM 2006 Nitroproteins from a human pituitary adenoma tissue discovered with a nitrotyrosine affinity column and tandem mass spectrometry. Anal Biochem 354:279–289[CrossRef][Medline]
  45. Christen S, Woodall AA, Shigenaga MK, Southwell-Keely PT, Duncan MW, Ames BN 1998 {gamma}-Tocopherol traps mutagenic electrophiles such as NO(X) and complements alpha-tocopherol: physiological implications. Proc Natl Acad Sci USA 94:3217–3222[CrossRef]
  46. Barinaga-Rementeria Ramirez I, Abedinpour P, Jergil B 2004 Purification of caveolae by affinity two-phase partitioning using biotinylated antibodies and NeutrAvidin-dextran. Anal Biochem 331:17–26[Medline]
  47. Sun RJ, Muller S, Zhuang FY, Stoltz JF, Wang X 2003 Caveolin-1 redistribution in human endothelial cells induced by laminar flow and cytokine. Biorheology 40:31–39[Medline]
  48. Souza J, Daikhin E, Yudkoff M, Raman C, Ischiropoulos H 1999 Factors determining the selectivity of protein tyrosine nitration. Arch Biochem Biophys 371:169–178[CrossRef][Medline]
  49. Matsuda T, Feng J, Witthuhn BA, Sekine Y, Ihle JN 2004 Determination of the transphosphorylation sites of Jak2 kinase. Biochem Biophys Res Commun 325:586–594[CrossRef][Medline]
  50. Yang N, Huang Y, Jiang J, Frank SJ 2004 Caveolar and lipid raft localization of the growth hormone receptor and its signaling elements: impact on growth hormone signaling. J Biol Chem 279:20898–20905[Abstract/Free Full Text]
  51. Ko YG, Lee JS, Kang YS, Ahn JH, Seo JS 1999 TNF-{alpha}-mediated apoptosis is initiated in caveolae-like domains. J Immunol 162:7217–7223[Abstract/Free Full Text]
  52. Garcia-Cardena G, Fan R, Stern DF, Liu J, Sessa WC 1996 Endothelial nitric oxide synthase is regulated by tyrosine phosphorylation and interacts with caveolin-1. J Biol Chem 271:27237–27240[Abstract/Free Full Text]
  53. Barsacchi R, Perrotta C, Bulotta S, Moncada S, Borgese N, Clementi E 2003 Activation of endothelial nitric-oxide synthase by tumor necrosis factor-{alpha}: a novel pathway involving sequential activation of neutral sphingomyelinase, phosphatidylinositol-3' kinase, and Akt. Mol Pharmacol 63:886–895[Abstract/Free Full Text]
  54. Guo D, Dunbar JD, Yang CH, Pfeffer LM, Donner DB 1998 Induction of Jak/STAT signaling by activation of the type 1 TNF receptor. J Immunol 1998 160:2742–2750[Abstract/Free Full Text]
  55. Han Y, Rogers N, Ransohoff RM 1999 Tumor necrosis factor-{alpha} signals to the IFN-{gamma} receptor complex to increase Stat1{alpha} activation. J Interferon Cytokine Res 19:731–740[CrossRef][Medline]
  56. Kurzer JH, Argetsinger LS, Zhou YJ, Kouadio JL, O’Shea JJ, Carter-Su C 2004 Tyrosine 813 is a site of JAK2 autophosphorylation critical for activation of JAK2 by SH2-Bß. Mol Cell Biol 2004 24:4557–4570[Abstract/Free Full Text]
  57. Waugh MG, Minogue S, Anderson JS, dos Santos M, Hsuan JJ 2001 Signalling 58 and non-caveolar rafts. Biochem Soc Trans. 29:509–511
  58. Ahmed T, Yumet G, Shumate M, Lang CH, Rotwein P, Cooney RN 2006 Tumor necrosis factor inhibits growth hormone-mediated gene expression in hepatocytes. J Physiol Gastrointest Liver Physiol 291:G35–G44
  59. Mao Y, Ling PR, Fitzgibbons TP, McCowen KC, Frick GP, Bistrian BR, Smith RJ 1999 Endotoxin-induced inhibition of growth hormone receptor signaling in rat liver in vivo. Endocrinology 140:5505–5515[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
M. Kurdi and G. W. Booz
JAK redux: a second look at the regulation and role of JAKs in the heart
Am J Physiol Heart Circ Physiol, November 1, 2009; 297(5): H1545 - H1556.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
T. H. Elsasser, T. J. Caperna, C-J. Li, S. Kahl, and J. L. Sartin
Critical control points in the impact of the proinflammatory immune response on growth and metabolism
J Anim Sci, April 1, 2008; 86(14_suppl): E105 - E125.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. H. Elsasser, C.-J. Li, T. J. Caperna, S. Kahl, and W. F. Schmidt
Growth Hormone (GH)-Associated Nitration of Janus Kinase-2 at the 1007Y-1008Y Epitope Impedes Phosphorylation at This Site: Mechanism for and Impact of a GH, AKT, and Nitric Oxide Synthase Axis on GH Signal Transduction
Endocrinology, August 1, 2007; 148(8): 3792 - 3802.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elsasser, T. H.
Right arrow Articles by Rodrigo, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elsasser, T. H.
Right arrow Articles by Rodrigo, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals