Endocrinology, doi:10.1210/en.2007-0452
Endocrinology Vol. 148, No. 8 3932-3940
Copyright © 2007 by The Endocrine Society
Hepatic Gene Expression Changes in Hypothyroid Juvenile Mice: Characterization of a Novel Negative Thyroid-Responsive Element
Hongyan Dong,
Carole L. Yauk,
Andrew Williams,
Alice Lee,
George R. Douglas and
Michael G. Wade
Environmental and Occupational Toxicology (H.D., C.L.Y., A.L., G.R.D., M.G.W.) and Biostatistics and Epidemiology (A.W.) Divisions, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, Ontario, Canada K1A 0L2
Address all correspondence and requests for reprints to: Carole L. Yauk, Environmental and Occupational Toxicology Division, Healthy Environments and Consumer Safety Branch, Health Canada, 50 Columbine Driveway, Ottawa, Ontario, Canada K1A 0L2. E-mail: carole_yauk{at}hc-sc.gc.ca.
 |
Abstract
|
|---|
The molecular mechanisms involved in the response of developing mice to disruptions in maternal thyroid hormone (TH) homeostasis are poorly characterized. We used DNA microarrays to examine a broad spectrum of genes from the livers of mice rendered hypothyroid by treating pregnant mice from gestational d 13 to postnatal d 15 with 6-propyl-2-thiouracil in drinking water. Twenty-four individuals (one male and one female pup from six litters of control or 6-propyl-2-thiouracil treatment groups, respectively) were profiled using Agilent oligonucleotide microarrays. MAANOVA identified 96 differentially expressed genes (false discovery rate adjusted P < 0.1 and fold change > 2 in at least one gender). Of these, 72 genes encode proteins of known function, 15 of which had previously been identified as regulated by TH. Pathway analysis revealed these genes are involved in metabolism, development, cell proliferation, apoptosis, and signal transduction. An immediate-early response gene, Nr4a1 (nuclear receptor subfamily 4, group A, member 1), was up-regulated by 3-fold in hypothyroid juvenile mouse liver; treatment of HepG2 cells with T3 resulted in down-regulation of Nr4a1. A potential thyroid response element 1218 to 1188 bp upstream of the promoter region of Nr4a1 was identified and demonstrated to bind TH receptor (TR)-
and TRß. Point mutation or deletion of the sequence containing the potential Nr4a1-thyroid response element in transient gene expression studies resulted in both higher basal expression and loss of T3 regulatory capacity, suggesting that this site is responsible for the negative regulation of gene expression by TR and TH.
 |
Introduction
|
|---|
THYROID HORMONES (TH) (T3 and T4) have been recognized as critically important for development, tissue differentiation, and maintenance of metabolic balance in mammals (1). TH exert their effect through interaction with TH receptors (TR) that, upon heterodimerization with the retinoic acid X receptor, act as ligand-activated transcription factors to initiate or block target gene expression by binding to TH response elements (TREs) in the gene promoter regions (2). For positively regulated genes, the interaction of TR with TH causes the corepressor in the complex of TR-TRE to be replaced with a coactivator, which, while remaining bound to consensus TRE sequence (A/G)GGT(C/A)A, initiates transcription (3). TH positively regulated genes are found in various TH target organs. For example, deiodinase I (Dio1), Spot14 (S14), and malic enzyme (ME) are associated with TREs and are up-regulated by TH in liver (4, 5, 6).
The mechanism by which negative regulation of gene expression by TH occurs is less well known. Some studies argue that TH down-regulation of gene expression occurs by a similar TR-TRE binding interaction in sequences located in the first exon and/or 3'-untranslated regions (7, 8, 9, 10). Other studies provide evidence that TH-dependent negative regulation may be caused by protein-protein interaction, without direct TR-TRE binding (11, 12). To date, only a few genes have been identified that are down-regulated by TH via TR-TRE binding or protein-protein interaction (8, 9, 10, 13, 14, 15, 16, 17, 18). Therefore, the mechanisms by which TH exerts positive and negative transcriptional control of target genes are poorly understood.
Severe disruption of TH production during fetal and early neonatal development leads to a suite of permanent deficits, particularly cognitive and sensory function, in experimental animals and humans (1). Iodine deficiency or exposure to environmental TH disruptors, such as polychlorinated biphenyls, dioxins, and bisphenol A, at least partially exert adverse effects via altering the homoeostasis of TH (19, 20, 21). The liver plays a critical role in metabolism and is a major target organ of TH. Microarrays have been used to study TH-dependent hepatic gene expression in adult rodents. These studies show a broad variety of genes, in particular many enzymes responsible for carbohydrate and fatty acid metabolism, that are directly or indirectly regulated by TH (22, 23, 24, 25). However, the hepatic effects of TH deficiency in juveniles have not been thoroughly studied despite the fact that TH is thought to play a significant permissive role in modulating hepatic control of somatic growth (26, 27) and in the marked changes in dietary energy and nutrient sources associated with birth and weaning (28, 29, 30).
To further understand the effects of TH on hepatic development, we carried out a comprehensive analysis of hepatic gene expression in postnatal day (PND) 15 mice made hypothyroid via maternal 6-propyl-2-thiouracil (PTU) exposure through drinking water from gestational day (GD) 13 until euthanasia. We established hepatic gene expression profiles in TH-deficient juvenile mice and identified many novel TH-influenced genes. These genes may be directly regulated by TH through TR-TRE interaction or be indirectly controlled through downstream effects. The derived gene list may be mined to identify genes directly under the control of TRs through TRE binding. Herein, we have identified Nr4a1 (nuclear receptor subfamily 4, group A, member 1) as being greatly overexpressed in hypothyroid juveniles and directly down-regulated by TH in cultured cell lines. We also describe a novel negative TRE located in the promoter region of this gene that provides further insight into TRE structural characteristics and the mechanisms through which TH exerts its effect.
 |
Materials and Methods
|
|---|
Animals and PTU treatment
Pregnant C57BL/6 mice were purchased from Charles River (St. Constant, Quebec, Canada) and were housed individually in hanging polycarbonate cages under a 12-h light,12-h dark cycle at 23 C with food (Purina rodent chow 5010; Ralston-Purina, St. Louis, MO) available ad libitum. Pregnant mice were supplied ad libitum with water containing diet cherry Kool-Aid (Kraft Inc., Cobourg, Ontario, Canada) with or without 0.1% PTU (Sigma Chemical Co., St. Louis, MO) from GD 13 to PND 15. Kool-Aid was added to water to increase palatability of PTU. All animal care and handling were in accordance with Canadian Council for Animal Care Guidelines and were reviewed by the Health Canada Animal Care Committee before the start of the study.
Tissue collection and RNA extraction and purification
Dams were allowed to litter naturally, and litter numbers were not adjusted. On PND 15, a single pup of each sex from each litter was killed by exsanguination under isoflurane anesthesia, and serum was retained for T4 analysis. Liver was dissected as rapidly as possible, immediately frozen in liquid nitrogen, and stored at 80 C.
Total RNA was extracted with TRIzol reagent (Invitrogen, Burlington, Ontario, Canada) followed by RNeasy Mini Kit (QIAGEN, Mississauga, Ontario, Canada) clean-up according to the manufacturers instructions. All RNA samples showed A260/280 ratios between 1.9 and 2.1. The integrity of RNA was determined using an Agilent 2100 Bioanalyzer (Agilent Technologies Inc., Mississauga, Ontario, Canada), and only high-quality RNA samples (28S/18S > 1.8) were used for further analysis.
Microarray hybridization
Individual hepatic total RNA samples from 24 pups (one female and one male pup from each litter; six litters per control and 0.1% PTU-treated group, respectively) were labeled with cyanine 5-CTP, and universal reference mouse total RNA (Stratagene, Cedar Creek, TX) was labeled with cyanine 3-CTP (Perkin-Elmer Life Sciences, Woodbridge, Ontario, Canada) using Agilent linear amplification kits following the manufacturers instructions. Briefly, double-stranded cDNA was synthesized using MMLV-RT with T7 promoter primer, starting with 5 µg total RNA. Cyanine-labeled cRNA targets were in vitro transcribed using T7 RNA polymerase. The synthesized cRNA was precipitated by LiCl, yielding approximately 2535 µg labeled cRNA-target. Three micrograms of labeled cRNA were fragmented at 60 C for 30 min with Agilent fragmentation solution. Cy5-sample cRNA and Cy3-common reference cRNA were hybridized to Agilent mouse oligo microarrays (product number G4121A) containing approximately 20,000 unique 60-mer oligonucleotides at 60 C overnight with Agilent hybridization solution and washed according to the manufacturers instruction. Arrays were scanned on a ScanArray Express (Perkin-Elmer), and data were acquired with ImaGene 5.5 (BioDiscovery, Inc., El Segundo, CA). Present calls were determined in ImaGene as signals that were significantly greater than the local background.
Statistical analysis of microarray data
Data files from the 24 arrays were imported into GeneSpring 6.0 (Silicon Genetics, Redwood City, CA) for normalization and filtering. Only genes that were called present in three or more samples were investigated in subsequent cluster analyses. A standard condition tree was applied to examine data quality.
To detect differentially expressed genes between the control and treated groups, the data were normalized using the transform.madata function in the MAANOVA library (31) in R (32) using a global lowess with a span of 0.2. The background for each array was measured using the negative control ()3xSLv1 probe. Spots with median signal intensities less than the mean plus 3 SD of the ()3xSLv1 probe were flagged. The following ANOVA model was applied to the log2 relative signal intensities. The model included a blocking (33) effect due to the day of hybridization and a fixed effect for treatment, gender, and gender by treatment and a random effect for dam. The Fs statistic (34), a shrinkage estimator for the gene-specific variance components, was used and the P values for all the statistical tests were estimated using the permutation method (500 permutations with sample shuffling). These P values were then adjusted for multiple comparisons by using the Benjamini-Hochberg false discovery rate approach (35), and the fold change was also calculated.
Real-time PCR (RT-PCR) analysis of differentially regulated genes
Reverse transcription was carried out in a 100-µl reaction mix with SuperScript II (Invitrogen) using 1 µg total RNA per animal or cell condition. Quantitative PCR was performed with an iCycler IQ real-time detection system (Bio-Rad, Mississauga, Ontario, Canada) using SYBR-Green. Using 5 µl reverse transcription solution and gene-specific primers (QIAGEN), PCR was performed in a 25-µl reaction Supermix (Bio-Rad). Primers were designed using Beacon design 2.0 (Premier BioSoft International, Palo Alto CA), and sequences will be provided upon request. PCR were performed in duplicate, and the values of threshold cycle were averaged. Gene expression levels were normalized to ß-actin, which was found to be stable using the DNA microarray. PCR efficiency was examined using the standard curve for each gene. The primer specificity was assured by the melting curve for each gene. A Students t test was used for statistical evaluation.
EMSA
The 30-bp oligonucleotides (Operon Biotechnologies, Huntsville, AL) containing potential TRE sequence found in the Nr4a1 promoter region (Nr4a1-TRE) were annealed in 100 mM NaCl by heating 95 C for 5 min, 65 C for 10 min, and 37 C for 10 min. The oligonucleotides were labeled with [
-32P]ATP (Amersham Biosciences, Inc., Baie DUrfe, Quebec, Canada) using a T4 polynucleotide kinase (Promega, Madison, WI) and purified using a Nucleotide Removal Kit (QIAGEN). Positive TRE control (containing direct repeat of consensus TRE half-sites separated by 4 bp: DR+4), TRß containing C32 nuclear extract and chicken TR
(cTR
) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Blocking antibody for TRß was purchased from Affinity BioReagents (Cedarlane Laboratories, Burlington, Ontario, Canada). Probes labeled with
-32P (DR+4, Nr4a1-TRE, or negative control oligonucleotides) were incubated with cTR
or C32 with or without TRß antibody or excess unlabeled probes in binding buffer [50 mM Tris HCl (pH 8.0), 750 mM KCl, 2.5 mM EDTA, 0.5% Triton X-100, 62.5% glycerol, 3.3 ng/µl poly-dI-dC, and 1 mM dithiothreitol] for 30 min. Protein-DNA complexes were separated by electrophoresis through 5% native polyacrylamide gels in 0.5x Tris-buffered ethanolamine running buffer. Radioactivity in the gels was imaged using a Storm phospho-imager system (Molecular Dynamics, Sunnyvale, CA) and quantified using Image Quant (GE Life Sciences, Piscataway, NJ).
Reporter plasmid construction
Mouse Nr4a1 luciferase reporter gene plasmids Nr4a11k, Nr4a11.5k, and Nr4a12k were constructed by cloning a PCR-derived fragment of Nr4a1 (nucleotides +47 to 1k, 1.5k, and 2k) in the luciferase vector PGL4.10 (Promega). Standard techniques were used for all plasmid constructions. PCR products were amplified using mouse genomic DNA as template and primers with XhoI and BglII restriction enzyme sites. PCR fragments were then subcloned into XhoI/BglII sites of pGL4.10, and the constructed sequences were confirmed by restriction enzyme digestion and sequencing. QuikChange Multi site-directed mutagenesis kit (Stratagene) was used to make mutant Nr4a1 1.5K and mutant Nr4a1 2K, which have six mutated oligonucleotides in the potential half-TRE region. Mutant constructs were confirmed by sequencing.
Cell culture and transfection
A human hepatoma cell line (HepG2) and a rat pituitary cell line (GH3) were obtained from American Type Culture Collection (Rockville, MD). Cells were plated in six-well plates with the media supplemented with 10 U/ml penicillin/streptomycin. MEM with 10% fetal bovine serum (FBS) was used for HepG2 cells and F12 with 2.5% FBS and 15% horse serum for GH3 cells (all media and supplements were from Invitrogen).
When HepG2 cells reached approximately 70% confluence, based on visual inspection, medium was replaced with MEM containing 10% dextran-coated charcoal-treated FBS (according to the manufacturer, Medicorp, Montreal, Quebec, Canada, the T3 concentration is 4.9 x 1011 M). Twenty-four hours later, T3, at final concentrations of 109 to 106 M (Sigma-Aldrich, Mississauga, Ontario, Canada), or vehicle (final concentration, 0.33 nM NaOH) was added to culture wells. Total RNAs were extracted at 24 and 48 h after addition of T3 for gene expression analysis by RT-PCR.
For transfection, GH3 cells (2 x 105) were seeded in each well of six-well plates with medium containing 10% dextran-coated charcoal-treated FBS 16 h before transfection. Both 1.02 µg of each luciferase reporter plasmid construct and 0.03 µg of pRL-TK (Promega) were cotransfected into cells using 3 µl FUGENE 6 (Stratagene). T3 was added to a final concentration of 107 M 24 h after transfection. Cells were harvested after 24 h of T3 treatment, and firefly luciferase and renilla luciferase activities were determined using a Vetaris luminometer with the Dua-luciferase reporter assay system (Promega). For normalizing the transfection efficiency, the firefly luciferase activity was divided by renilla luciferase activity, and the reporter gene expression was expressed as relative luciferase units. Each incubation was performed with triplicate wells and each experiment repeated three times.
Statistical analysis
RT-PCR gene expression, EMSA densitometry, and luciferase activity data are expressed as mean ± SE. Significant differences were determined using a two-tailed Students t test and called significant if P < 0.05.
 |
Results
|
|---|
Effects of PTU treatment on the expression of known hepatic TH-responsive genes
Hypothyroidism in pups was confirmed by the significant reduction of T4 levels in PND 15 offspring of dams exposed to 0.1% PTU (P < 0.001) and in dams themselves at weaning on PND 21 (data reported elsewhere) (36). The litter size, pup survival rate, pup body weight, and the number of dams that had successful deliveries were significantly lower in the 0.1% PTU treatment group (see supplemental Table S1, published as supplemental data on The Endocrine Societys Journals Online web site at http://endo.endojournals.org).
To further validate the hypothyroid mouse model, we performed RT-PCR to examine gene expression in treated and control male pup liver RNAs for three known hepatic TH-regulated genes, Dio1, S14, and ME, which contain TREs in their promoter regions. As expected, the expression of each of these three genes decreased significantly in the livers of the perinatally PTU-treated mice (Fig. 1
). Expression of these genes in unmanipulated adult and juvenile livers is presented in supplemental Fig. S1 (published as supplemental data on The Endocrine Societys Journals Online web site at http://endo.endojournals.org).

View larger version (8K):
[in this window]
[in a new window]
|
FIG. 1. The expression of three known TH-responsive genes examined by RT-PCR in the livers of male pups of the control group and the PTU-induced hypothyroid group (see Materials and Methods). Data are expressed as mean ± SE (n = 6). *, P < 0.05.
|
|
Hepatic gene expression profiles in hypothyroid juvenile mice
Hepatic total RNAs from 24 individuals (one female and one male pup from each litter; six litters per control and 0.1% PTU-treated group, respectively) were analyzed using Agilent oligonucleotide microarrays (
20,000 genes) with commercially available mouse total RNA (Stratagene) used as a common reference. The data are publicly available via http://www.ebiac.uk/miamexpress/, accession no.: E-MEXP-1091. Significant Benjamini-Hochberg false discovery rate (35) adjusted P values for the overall treatment effect of the F test were found for 133 genes (P < 0.10) between euthyroid and hypothyroid pups. No significant treatment by gender interactions were identified. Of the differentially expressed genes, 96 had a more than 2-fold change in at least one gender. Among these 96 genes, 72 have known functions and 24 are unknown; 49 were overrepresented in control samples relative to PTU-treated livers, whereas 47 genes were overrepresented in PTU-treated samples. The fold changes of the 72 known genes are shown in Table 1
. We examined the pathways associated with responsive genes using ONTO Express (37) and found the most affected biological processes include metabolism, cell growth and maintenance, development, immune response, transcription, and signal transduction. Two pairs of imprinted genes, Gtl2/Dlk1 and Igf2/H19, were significantly changed (Igf2 was classed into the group of apoptosis and cell proliferation).
For the 72 known genes, 15 were reported to be regulated by TH in previous studies (Table 1
), including Dio1, S14, and ME. The microarray data on the expression of these three genes correspond well with the RT-PCR results reported in Fig. 1
(Table 2
).
Validation of selected genes identified by microarrays
We selected genes whose expression was either increased (three genes) or reduced (three genes) after PTU exposure for RT-PCR analysis to confirm the findings of the microarray analysis in 12 males (six from each group). These genes included Akr1c18 (aldo-keto reductase family 1, member C18), Ntrk2 (neurotrophic tyrosine kinase, receptor, type 2), Cdh1 (Cadherin 1), Jun (Jun oncogene), VLDLR (very low density lipoprotein receptor), and Nr4a1 (nuclear receptor subfamily 4, group A, member 1). Trends of fold change were well correlated with the corresponding microarray data, although the exact values differed (Fig. 2
).
Expression of Nr4a1 in HepG2 cells
Hepatic expression of Nr4a1 was increased markedly in both male and female hypothyroid mice. To further evaluate TH regulation of this gene, we examined the direct effect of T3 on Nr4a1 expression in vitro in HepG2 cells by RT-PCR. T3 significantly repressed Nr4a1 expression at the lowest T3 concentration 24 h after the exposure (109 M) (Fig. 3
). Similar results were obtained after 48 h of exposure (data not shown).

View larger version (6K):
[in this window]
[in a new window]
|
FIG. 3. Nr4a1 expression in HepG2 cells. Total RNA was isolated from HepG2 cell culture in the presence of different concentrations of T3. RT-PCR was performed as described in Materials and Methods. *, P < 0.05.
|
|
Identification of a potential TRE sequence in promoter region of Nr4a1
Using the University of California Santa Cruz Genome Browser (Mouse Feb. 2006 Assembly; http://genome.ucsc.edu/cgi-bin/hgGateway), the 3000-bp sequence upstream of transcription start site (TSS) of Nr4a1 (NM_010444) was obtained. Examination of this sequence in the promoter region revealed three potential half-TRE sequences in a 30-bp fragment located from 1218 to 1188 bp relative to the TSS: 5'-ACTGGGATGGAGATGTGACCTGCAGGGTGA-3' (TRE in bold). Cloning and sequencing this fragment confirmed that these three half-TREs were separated by nine and three nucleotides, respectively. Gel-shift mobility assays showed this 30-bp Nr4a1-TRE bound to cTR
in a dose-dependent fashion as does DR+4 (positive control; Fig. 4A
), and binding was eliminated by pretreatment with cold probe but not with cold unrelated oligonucleotide (Fig. 4B
). Figure 4C
shows that Nr4a1-TRE binding to C32 nuclear extract, which contains TRß, is abolished by pretreatment with either excess cold Nr4a1-TRE probe or TRß-blocking antibody.
Nr4a1-TRE sequence not only binds TR but also inhibits transcriptional activity. Luciferase reporter plasmid constructions, Nr4a12k, Nr4a11.5k, Nr4a11k, and null containing the sequence from +47 to upstream 2k, 1.5k, and 1k of Nr4a1 promoter region or no part of this region, respectively, were transfected into GH3 cells. Although Nr4a12k and Nr4a11.5k contain the potential Nr4a1-TRE, Nr4a11k does not. The luciferase assay (Fig. 5
) showed that the null plasmid, containing no part of the promoter region of the Nr4a1 gene is not expressed in GH3 cells. All three Nr4a1 promoter-containing plasmids were expressed in GH3 cells with the Nr4a11k, which lacks the putative TRE, having twice the expression level of the other two. This indicates that Nr4a12k and Nr4a11.5k contain elements that repress expression. Treatment of cells transfected with either of the TRE-containing plasmids with T3 resulted in significantly reduced luciferase expression, whereas T3 had no effect on luciferase expression in Nr4a11k transfected cells. Furthermore, two mutants (MutNr4a12k and MutNr4a11.5k) derived from wild types by multiple point mutations (ACTGGGATGGAGATGTGACCTGCAGGGTGA to ACTAAGATGGAGATGTGATTTGCAGAATGA) were transfected into GH3 cell. Mutated TREs increased basal expression and eliminated the effect of T3 on transient expression. These results demonstrate that T3 repression of transcription is dependent on the presence of sequence containing Nr4a1-TRE. Similar results were obtained using N2a-ß cells (a TRß-overexpressing cell line, kindly provided by Dr. Jack Puymirat, Laval University, Quebec, Canada) transfected with these constructs (see supplemental Fig. S2, published as supplemental data on The Endocrine Societys Journals Online web site at http://endo.endojournals.org).

View larger version (7K):
[in this window]
[in a new window]
|
FIG. 5. Effect of T3 on the transient expression of Nr4a1-TRE-luciferase of various wild-type or mutated constructs. Three firefly luciferase wild-type reporter constructs, two mutants, and an empty construct were transfected into GH3 cells with cotransfection of pRL-TK (as a transfection efficiency control). Twenty-four hours later, T3 was added to a final concentration of 107 M for 24 h. Firefly luciferase expression was normalized to renilla luciferase expressed by the pRL-TK plasmid. Values are mean ± SE (n = 3). *, P < 0.05.
|
|
 |
Discussion
|
|---|
Several studies have examined the influence of TH on the genome-wide regulation of gene expression in either adult rodents or hepatic cell lines using high-density microarrays (22, 23, 24, 25). Such studies have contributed much toward current understanding of the role of TH in regulating hepatic metabolism. However, little effort has been directed to investigating the influence of TH on the development of the liver despite evidence that TH plays a role in preparing the developing liver for significant shifts in nutrient processing associated with birth and weaning (26, 27, 28, 29). In the current study, changes in hepatic gene expression in mice resulting from PTU-induced hypothyroidism from GD 13 to PND 15 were examined using high-density DNA microarrays. Hypothyroidism was confirmed by the significant reduction of serum T4 levels (36) and the hepatic expression of three known TH-responsive genes (Fig. 1
). The use of a relatively large number of samples (six per sex per treatment group), a common reference design, and comprehensive statistical analysis establishes reliable expression profiles as indicated by the similarity of microarray results with RT-PCR results (Figs. 1
and 2
and Table 2
). A total of 96 genes were found to be significantly changed (P < 0.1 and >2-fold change in at least one gender; Table 1
). Of these, 15 were previously observed to be regulated by TH (Table 1
), and several of them are known to be regulated through well defined TRE (such as ME, Dio1, and S14). In addition, some genes can be inferred to be regulated by TH. For example, although no data directly show the relationship between VLDLR expression and TH level, it is known that VLDLR is the downstream component of the reelin signaling pathway (38), which is up-regulated in hypothyroidism (39). Interestingly, three imprinted genes were found to be altered in hypothyroid mouse (Igf2, Gtl2, and Dlk1). Imprinted genes, a small subset of mouse genes, have been characterized over the last 20 yr, but their function and regulation is still poorly understood. Dlk1 is required for the differentiation of preadiopocytes and appears to be a growth factor (40). TH deficiency may cause abnormal expression of imprinted genes impairing differentiation and retarding development. A marked proportion (47.2%) of the other genes seen to be altered by hypothyroidism in the current study are involved in lipid metabolism and intermediary metabolism.
Among these altered genes, Nr4a1 (also known as NGFI-B, TR3, or Nur77) was strongly up-regulated in hypothyroid mice (Table 1
and Fig. 2
). In addition, the expression of Nr4a1 was repressed by T3 in cultured HepG2 cell lines (Fig. 3
). Higher expression of Nr4a1 in liver tissue than in HepG2 cells in the absence of TH may indicate that Nr4a1 is also expressed in some hepatic accessory cells. These observations indicate that transcriptional expression of Nr4a1 may be regulated by TH.
For some genes, transcriptional control by TH is achieved through a nuclear TR, which recognizes and binds the (A/G)GGT(C/A)A sequence of the TRE. TREs may be arranged in direct repeat (DR+4), palindrome, or inverted palindrome forms (41). Depending on the presence or absence of T3, TR-TRE complex recruits corepressors or coactivators resulting in gene down-regulation or up-regulation, respectively. By searching the promoter region of Nr4a1, three half-TRE sequences were found in the upstream region at 1218 to 1188 bp. Although these three half-TREs are not arranged in the positions described above, they do have the ability to bind to TR and are responsive to transcription regulation by TH (Figs. 4
and 5
and supplemental Fig. S2). Furthermore, the Nr4a1 gene is subject to active repression by unliganded TR, a well known phenomenon involving the corepressor N-CoR being recruited by TR to its target binding sites in the absence of TH (42). In support of this hypothesis, when the negative TRE is removed from the luciferase constructs, the basal activity increases even in the absence of any added T3 (Fig. 5
and supplemental Fig. S2). This strongly suggests that this gene is negatively regulated through the TRE and that expression is further suppressed by the interaction of the liganded TR with this sequence. Therefore, we have identified and characterized a novel negative TREs in the promoter region of Nr4a1 that shows a deviation from the previously described sequences. Published sequences of negative TREs are highly variable (Table 3
) in terms of the precise sequence and orientation. The putative TRE we have found in the 5' region of Nr4a1 superficially resembles many of the published TREs in having two half-sites located in close proximity but differs in that it is located more than 1 kb upstream of the transcription start site. Exploration of the promoter regions of other genes found in the list in this study may lead to further identification of de novo TREs that will clarify the DNA sequence and location of these elements and help resolve questions surrounding transcriptional control by TH.
As an immediate-early response gene, Nr4a1 is strongly and rapidly induced after various stimuli in numerous tissues (43, 44) and is important for differentiation of dopaminergic neurons (45) and for early embryogenesis in the mouse (46). Nr4a1 has been identified as a cell survival factor strongly up-regulated by TNF
(47) yet has been shown to mediate induction of programmed cell death in many cell types (48, 49, 50, 51) including hepatocytes (52). In the liver, expression of Nr4a1 is induced by hepatitis B virus (53), liver regeneration (54), and hypercholesterolemia (55). The current study is the first demonstration of TH-induced down regulation of Nr4a1 expression at the level of transcription. Detailed mechanistic studies of TH regulation of the expression of Nr4a1 are ongoing in our laboratory. Further study of the role of Nr4a1 in liver development and the physiological significance of its down-regulation by TH will help in understanding the subtle consequences of perinatal hypothyroidism on liver function.
 |
Acknowledgments
|
|---|
We thank Guillaume Pelletier and Ivan Curran for helpful comments on the manuscript. We thank Dr. Jack Puymirat for the gift of TR-ß-transfected N2a cells.
 |
Footnotes
|
|---|
This work was supported by the Health Canada Genomics R&D fund. H.D.s salary was provided by Health Canadas Office of the Chief Scientist.
Disclosure Statement: The authors have nothing to disclose.
First Published Online April 26, 2007
Abbreviations: cTR
, Chicken thyroid hormone receptor-
; Dio1, deiodinase I; FBS, fetal bovine serum; GD, gestational day; ME, malic enzyme; PND, postnatal day; PTU, 6-propyl-2-thiouracil; S14, Spot14; TH, thyroid hormone; TR, TH receptor; TRE, TH response elements; TSS, transcription start site.
Received April 6, 2007.
Accepted for publication April 18, 2007.
 |
References
|
|---|
- Boelaert K, Franklyn JA 2005 Thyroid hormone in health and disease. J Endocrinol 187:115[Abstract/Free Full Text]
- Wu Y, Koenig RJ 2000 Gene regulation by thyroid hormone. Trends Endocrinol Metab 11:207211[CrossRef][Medline]
- Campbell MC, Anderson GW, Mariash CN 2003 Human spot 14 glucose and thyroid hormone response: characterization and thyroid hormone response element identification. Endocrinology 144:52425248[Abstract/Free Full Text]
- Yin L, Wang Y, Dridi S, Vinson C, Hillgartner FB 2005 Role of CCAAT/enhancer-binding protein, histone acetylation, and coactivator recruitment in the regulation of malic enzyme transcription by thyroid hormone. Mol Cell Endocrinol 245:4352[CrossRef][Medline]
- Zhang CY, Kim S, Harney JW, Larsen PR 1998 Further characterization of thyroid hormone response elements in the human type 1 iodothyronine deiodinase gene. Endocrinology 139:11561163[Abstract/Free Full Text]
- Liu HC, Towle HC 1994 Functional synergism between multiple thyroid hormone response elements regulates hepatic expression of the rat S14 gene. Mol Endocrinol 8:10211037[Abstract/Free Full Text]
- Saatcioglu F, Deng T, Karin M 1993 A novel cis element mediating ligand-independent activation by c-ErbA: implications for hormonal regulation. Cell 75:10951105[CrossRef][Medline]
- Pombo PM, Barettino D, Espliguero G, Metsis M, Iglesias T, Rodriguez-Pena A 2000 Transcriptional repression of neurotrophin receptor trkB by thyroid hormone in the developing rat brain. J Biol Chem 275:3751037517[Abstract/Free Full Text]
- Perez-Juste G, Garcia-Silva S, Aranda A 2000 An element in the region responsible for premature termination of transcription mediates repression of c-myc gene expression by thyroid hormone in neuroblastoma cells. J Biol Chem 275:13071314[Abstract/Free Full Text]
- Zhang W, Brooks RL, Silversides DW, West BL, Leidig F, Baxter JD, Eberhardt NL 1992 Negative thyroid hormone control of human growth hormone gene expression is mediated by 3'-untranslated/3'-flanking DNA. J Biol Chem 267:1505615063[Abstract/Free Full Text]
- Lazar MA 2003 Thyroid hormone action: a binding contract. J Clin Invest 112:497499[CrossRef][Medline]
- Lopez G, Schaufele F, Webb P, Holloway JM, Baxter JD, Kushner PJ 1993 Positive and negative modulation of Jun action by thyroid hormone receptor at a unique AP1 site. Mol Cell Biol 13:30423049[Abstract/Free Full Text]
- Belandia B, Latasa MJ, Villa A, Pascual A 1998 Thyroid hormone negatively regulates the transcriptional activity of the ß-amyloid precursor protein gene. J Biol Chem 273:3036630371[Abstract/Free Full Text]
- Chatterjee VK, Lee JK, Rentoumis A, Jameson JL 1989 Negative regulation of the thyroid-stimulating hormone
gene by thyroid hormone: receptor interaction adjacent to the TATA box. Proc Natl Acad Sci USA 86:91149118[Abstract/Free Full Text] - Drover VA, Wong NC, Agellon LB 2002 A distinct thyroid hormone response element mediates repression of the human cholesterol 7
-hydroxylase (CYP7A1) gene promoter. Mol Endocrinol 16:1423[Abstract/Free Full Text] - Matsukawa T, Kitagawa M, Katayama K, Nagai Y, Hayashi T, Yasuda H, Ohba Y 1996 The existence of thyroid hormone responsive element, TRE, was confirmed in the first intron of rat
1-acid glycoprotein gene. J Biochem (Tokyo) 119:934939[Abstract/Free Full Text] - Sawada T, Oofusa K, Yoshizato K 2001 Thyroid hormone response element-like sequence in anuran matrix metalloproteinase 1 gene is responsive to in vivo thyroid hormone administration. J Endocrinol 169:477486[Abstract]
- Waters KM, Miller CW, Ntambi JM 1997 Localization of a negative thyroid hormone-response region in hepatic stearoyl-CoA desaturase gene 1. Biochem Biophys Res Commun 233:838843[CrossRef][Medline]
- Moriyama K, Tagami T, Akamizu T, Usui T, Saijo M, Kanamoto N, Hataya Y, Shimatsu A, Kuzuya H, Nakao K 2002 Thyroid hormone action is disrupted by bisphenol A as an antagonist. J Clin Endocrinol Metab 87:51855190[Abstract/Free Full Text]
- Yamada-Okabe T, Aono T, Sakai H, Kashima Y, Yamada-Okabe H 2004 2,3,7,8-Tetrachlorodibenzo-p-dioxin augments the modulation of gene expression mediated by the thyroid hormone receptor. Toxicol Appl Pharmacol 194:201210[CrossRef][Medline]
- Bansal R, You SH, Herzig CT, Zoeller RT 2005 Maternal thyroid hormone increases HES expression in the fetal rat brain: an effect mimicked by exposure to a mixture of polychlorinated biphenyls (PCBs). Brain Res Dev Brain Res 156:1322[CrossRef][Medline]
- Stahlberg N, Merino R, Hernandez LH, Fernandez-Perez L, Sandelin A, Engstrom P, Tollet-Egnell P, Lenhard B, Flores-Morales A 2005 Exploring hepatic hormone actions using a compilation of gene expression profiles. BMC Physiol 5:8[CrossRef][Medline]
- Feng X, Jiang Y, Meltzer P, Yen PM 2000 Thyroid hormone regulation of hepatic genes in vivo detected by complementary DNA microarray. Mol Endocrinol 14:947955[Abstract/Free Full Text]
- Flores-Morales A, Gullberg H, Fernandez L, Stahlberg N, Lee NH, Vennstrom B, Norstedt G 2002 Patterns of liver gene expression governed by TRß. Mol Endocrinol 16:12571268[Abstract/Free Full Text]
- Weitzel JM, Hamann S, Jauk M, Lacey M, Filbry A, Radtke C, Iwen KA, Kutz S, Harneit A, Lizardi PM, Seitz HJ 2003 Hepatic gene expression patterns in thyroid hormone-treated hypothyroid rats. J Mol Endocrinol 31:291303[Abstract]
- Cabello G, Wrutniak C 1989 Thyroid hormone and growth: relationships with growth hormone effects and regulation. Reprod Nutr Dev 29:387402[CrossRef][Medline]
- Nanto-Salonen K, Glasscock GF, Rosenfeld RG 1991 The effects of thyroid hormone on insulin-like growth factor (IGF) and IGF-binding protein (IGFBP) expression in the neonatal rat: prolonged high expression of IGFBP-2 in methimazole-induced congenital hypothyroidism. Endocrinology 129:25632570[Abstract/Free Full Text]
- Almeida A, Lopez-Mediavilla C, Medina JM 1997 Thyroid hormones regulate the onset of osmotic activity of rat liver mitochondria after birth. Endocrinology 138:764770[Abstract/Free Full Text]
- Gluckman PD, Sizonenko SV, Bassett NS 1999 The transition from fetus to neonate: an endocrine perspective. Acta Paediatr Suppl 88:711[Medline]
- Izquierdo JM, Luis AM, Cuezva JM 1990 Postnatal mitochondrial differentiation in rat liver. Regulation by thyroid hormones of the ß-subunit of the mitochondrial F1-ATPase complex. J Biol Chem 265:90909097[Abstract/Free Full Text]
- Wu H, Kerr MK, Cui X, Churchill GA 2003 MAANOVA: a software package for the analysis of spotted cDNA microarray experiments
- Team R Development Core 2005 R: A language and environment for statistical computing. Vienna, Austria ISBN 3900051-070, http://www.R-project.org.
- Montgomery DC 2001 Design and analysis of experiments. 5th ed. New York: John Wiley & Sons
- Cui X, Hwang JT, Qiu J, Blades NJ, Churchill GA 2005 Improved statistical tests for differential gene expression by shrinking variance components estimates. Biostatistics 6:5975[Abstract]
- Benjamini Y, Hochberg Y 1995 Controlling the false discovery rate: a practical and powerful approach to multiple testing. J Royal Stat Soc 57:289300
- Dong H, Wade M, Williams A, Lee A, Douglas GR, Yauk C 2005 Molecular insight into the effects of hypothyroidism on the developing cerebellum. Biochem Biophys Res Commun 330:11821193[CrossRef][Medline]
- Draghici S, Khatri P, Bhavsar P, Shah A, Krawetz SA, Tainsky MA 2003 Onto-Tools, the toolkit of the modern biologist: Onto-Express, Onto-Compare, Onto-Design and Onto-Translate. Nucleic Acids Res 31:37753781[Abstract/Free Full Text]
- Luque JM, Morante-Oria J, Fairen A 2003 Localization of ApoER2, VLDLR and Dab1 in radial glia: groundwork for a new model of reelin action during cortical development. Brain Res Dev Brain Res 140:195203[CrossRef][Medline]
- Manzano J, Morte B, Scanlan TS, Bernal J 2003 Differential effects of triiodothyronine and the thyroid hormone receptor ß-specific agonist GC-1 on thyroid hormone target genes in the brain. Endocrinology 144:54805487[Abstract/Free Full Text]
- Davies W, Isles AR, Wilkinson LS 2005 Imprinted gene expression in the brain. Neurosci Biobehav Rev 29:421430[CrossRef][Medline]
- Kim SW, Ho SC, Hong SJ, Kim KM, So EC, Christoffolete M, Harney JW 2005 A novel mechanism of thyroid hormone-dependent negative regulation by thyroid hormone receptor, nuclear receptor corepressor (NCoR), and GAGA-binding factor on the rat cD44 promoter. J Biol Chem 280:1454514555[Abstract/Free Full Text]
- Ishizuka T, Lazar MA 2003 The N-CoR/histone deacetylase 3 complex is required for repression by thyroid hormone receptor. Mol Cell Biol 23:51225131[Abstract/Free Full Text]
- Pei L, Castrillo A, Chen M, Hoffmann A, Tontonoz P 2005 Induction of NR4A orphan nuclear receptor expression in macrophages in response to inflammatory stimuli. J Biol Chem 280:2925629262[Abstract/Free Full Text]
- Park JI, Park HJ, Lee YI, Seo YM, Chun SY 2003 Regulation of NGFI-B expression during the ovulatory process. Mol Cell Endocrinol 202:2529[Medline]
- Zetterstrom RH, Solomin L, Jansson L, Hoffer BJ, Olson L, Perlmann T 1997 Dopamine neuron agenesis in Nurr1-deficient mice. Science 276:248250[Abstract/Free Full Text]
- DeYoung RA, Baker JC, Cado D, Winoto A 2003 The orphan steroid receptor Nur77 family member Nor-1 is essential for early mouse embryogenesis. J Biol Chem 278:4710447109[Abstract/Free Full Text]
- Suzuki S, Suzuki N, Mirtsos C, Horacek T, Lye E, Noh SK, Ho A, Bouchard D, Mak TW, Yeh WC 2003 Nur77 as a survival factor in tumor necrosis factor signaling. Proc Natl Acad Sci USA 100:82768280[Abstract/Free Full Text]
- Wilson AJ, Arango D, Mariadason JM, Heerdt BG, Augenlicht LH 2003 TR3/Nur77 in colon cancer cell apoptosis. Cancer Res 63:54015407[Abstract/Free Full Text]
- Rajpal A, Cho YA, Yelent B, Koza-Taylor PH, Li D, Chen E, Whang M, Kang C, Turi TG, Winoto A 2003 Transcriptional activation of known and novel apoptotic pathways by Nur77 orphan steroid receptor. EMBO J 22:65266536[CrossRef][Medline]
- Kim SO, Ono K, Tobias PS, Han J 2003 Orphan nuclear receptor Nur77 is involved in caspase-independent macrophage cell death. J Exp Med 197:14411452[Abstract/Free Full Text]
- Lin B, Kolluri SK, Lin F, Liu W, Han YH, Cao X, Dawson MI, Reed JC, Zhang XK 2004 Conversion of Bcl-2 from protector to killer by interaction with nuclear orphan receptor Nur77/TR3. Cell 116:527540[CrossRef][Medline]
- Yeo MG, Yoo YG, Choi HS, Pak YK, Lee MO 2005 Negative cross-talk between Nur77 and small heterodimer partner and its role in apoptotic cell death of hepatoma cells. Mol Endocrinol 19:950963[Abstract/Free Full Text]
- Lee MO, Kang HJ, Cho H, Shin EC, Park JH, Kim SJ 2001 Hepatitis B virus X protein induced expression of the Nur77 gene. Biochem Biophys Res Commun 288:11621168[CrossRef][Medline]
- Wang X, Bhattacharyya D, Dennewitz MB, Kalinichenko VV, Zhou Y, Lepe R, Costa RH 2003 Rapid hepatocyte nuclear translocation of the Forkhead Box M1B (FoxM1B) transcription factor caused a transient increase in size of regenerating transgenic hepatocytes. Gene Expr 11:149162[Medline]
- Kudo T, Nakayama E, Suzuki S, Akiyama M, Shibata S 2004 Cholesterol diet enhances daily rhythm of Pai-1 mRNA in the mouse liver. Am J Physiol Endocrinol Metab 287:E644E651
- Gallo G, de Marchis M, Voci A, Fugassa E 1991 Expression of hepatic mRNAs for insulin-like growth factors-I and -II during the development of hypothyroid rats. J Endocrinol 131:367372[Abstract/Free Full Text]
- Murugesan P, Muthusamy T, Balasubramanian K, Arunakaran J 2005 Studies on the protective role of vitamin C and E against polychlorinated biphenyl (Aroclor 1254)-induced oxidative damage in Leydig cells. Free Radic Res 39:12591272[CrossRef][Medline]
- Dong J, Yin H, Liu W, Wang P, Jiang Y, Chen J 2005 Congenital iodine deficiency and hypothyroidism impair LTP and decrease c-fos and c-jun expression in rat hippocampus. Neurotoxicology 26:417426[CrossRef][Medline]
- Rabie A, Ferraz C, Clavel MC, Legrand C 1988 Gelsolin immunoreactivity and development of the tectorial membrane in the cochlea of normal and hypothyroid rats. Cell Tissue Res 254:241245[Medline]
- Vallejo CG, Seguido AM, Testillano PS, Risueno MC 2005 Thyroid hormone regulates tubulin expression in mammalian liver. Effects of deleting thyroid hormone receptor-
or -ß. Am J Physiol Endocrinol Metab 289:E87E94 - Shibusawa N, Hollenberg AN, Wondisford FE 2003 Thyroid hormone receptor DNA binding is required for both positive and negative gene regulation. J Biol Chem 278:732738[Abstract/Free Full Text]
- Shen X, Li QL, Brent GA, Friedman TC 2005 Regulation of regional expression in rat brain PC2 by thyroid hormone/characterization of novel negative thyroid hormone response elements in the PC2 promoter. Am J Physiol Endocrinol Metab 288:E236E245
- Shen X, Li QL, Brent GA, Friedman TC 2004 Thyroid hormone regulation of prohormone convertase 1 (PC1): regional expression in rat brain and in vitro characterization of negative thyroid hormone response elements. J Mol Endocrinol 33:2133[Abstract]
- Crone DE, Kim HS, Spindler SR 1990
and ß thyroid hormone receptors bind immediately adjacent to the rat growth hormone gene TATA box in a negatively hormone-responsive promoter region. J Biol Chem 265:1085110856[Abstract/Free Full Text] - Bigler J, Eisenman RN 1995 Novel location and function of a thyroid hormone response element. EMBO J 14:57105723[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
D. Diez, C. Grijota-Martinez, P. Agretti, G. De Marco, M. Tonacchera, A. Pinchera, G. Morreale de Escobar, J. Bernal, and B. Morte
Thyroid Hormone Action in the Adult Brain: Gene Expression Profiling of the Effects of Single and Multiple Doses of Triiodo-L-Thyronine in the Rat Striatum
Endocrinology,
August 1, 2008;
149(8):
3989 - 4000.
[Abstract]
[Full Text]
[PDF]
|
 |
|