help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2007-0373
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
148/9/4150    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xiao, X. Q.
Right arrow Articles by Grove, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xiao, X. Q.
Right arrow Articles by Grove, K. L.
Endocrinology Vol. 148, No. 9 4150-4159
Copyright © 2007 by The Endocrine Society

Excess Weight Gain during the Early Postnatal Period Is Associated with Permanent Reprogramming of Brown Adipose Tissue Adaptive Thermogenesis

Xiao Qiu Xiao, Sarah M. Williams, Bernadette E. Grayson, Maria M. Glavas, Michael A. Cowley, M. Susan Smith and Kevin L. Grove

Division of Neuroscience (X.Q.X., S.M.W., B.E.G., M.M.G., M.A.C., M.S.S., K.L.G.), Oregon National Primate Research Center, and Department of Physiology and Pharmacology (M.S.S.), Oregon Health & Science University, Beaverton, Oregon 97006

Address all correspondence and requests for reprints to: Dr. Kevin L. Grove Division of Neuroscience, Oregon National Primate Research Center, Oregon Health & Science University, 505 Northwest 185th Avenue, Beaverton, Oregon 97006. E-mail: grovek{at}ohsu.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Excess weight gain during the early postnatal period increases the risk of persistent obesity into adulthood and impacts on the subsequent risk for metabolic and cardiovascular diseases. The current study investigated the long-term effect of early excess weight gain, through reduced nursing litter size, on body weight regulation and its relation to brown adipose tissue (BAT) thermogenesis. Animals raised in a small litter (SL, three pups per litter) were compared with those raised in a normal litter size (NL, eight pups per litter). BAT from young adult NL and SL rats, maintained under either ambient or cold conditions, were used for gene expression, morphological, and functional analysis. Compared with NL, SL rats showed excess weight gain, and adult SL animals had a reduced thermogenic capacity as displayed by lower levels of uncoupling protein 1 (UCP1). When exposed to cold, BAT from SL rats was less active and demonstrated reduced responsiveness to cold. Furthermore, reduction in transcript abundance of several lipid lipases and transcriptional regulators was observed in SL rats either at ambient temperature or under cold conditions. Finally, the expression of sympathetic ß3-adrenergic receptor and the response to the sympathetic receptor agonist isoproterenol were decreased in SL rats. Overall, these observations provide the first evidence that postnatal excess weight gain results in abnormalities in BAT thermogenesis and sympathetic outflow, which likely increases susceptibility to obesity in adulthood.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
OBESITY IS CONSIDERED a worldwide health concern, being a major contributor to the increased occurrence of coronary heart disease and type 2 diabetes (1). Multiple organs have been shown to be involved in the development and progression of obesity. In the rodent, one of the key structures involved in the regulation of body weight is the interscapular brown adipose tissue (BAT), the major thermogenic center. BAT is composed of primarily brown adipocytes that are characterized by multilocular lipid droplets, a large number of mitochondria, dense innervation by sympathetic nerves, and abundant uncoupling protein 1 (UCP1) (2). Defective BAT thermogenesis has been observed in several animal models of genetic obesity (ob/ob and db/db) (3, 4), and transgenic mice with a specific ablation of BAT develop obesity in the absence of hyperphagia (5). On the other hand, mice overexpressing UCP1 are obesity resistant (6). Furthermore, mice lacking all three ß-adrenergic receptors (Adrb1, -2, and -3), the major mediators of the sympathetic nervous system (SNS) input into BAT, have a reduced metabolic rate and are severely obese when fed a high-energy diet (7). Clinical evidence shows that polymorphisms in UCP1, lipoprotein lipase (LPL), and the Adrb3 are associated with development of certain metabolic complications of obesity and might have additive effects when combined (8, 9). These data clearly demonstrate a possible link between energy balance, BAT, and obesity.

Although genetic factors can explain the etiology of severe obesity, the recent increase in the occurrence of childhood and adolescent obesity cannot be explained by a genetic shift but rather are due to changes in nutrition and physical exercise (10). Numerous studies have demonstrated that both in utero and early postnatal environments can influence body weight and energy homeostasis into adulthood. This influence has been demonstrated in both human clinical studies as well as in rodent models (11, 12, 13, 14, 15, 16, 17, 18). Rodent studies have shown that animals raised in a small litter (SL) have an accelerated body weight gain before weaning, which is associated with permanent modulation of body weight, adiposity, and hypothalamic circuits that control food intake and energy balance in adulthood (13, 14, 15, 16, 17, 18). Increased milk intake in each individual pup in SL rearing at least in part, contributes to the alteration in metabolic phenotype even though other possibilities such as maternal behavior, activity of pups, and nutrient extraction cannot be excluded (19, 20). However, it is still unknown how these environmental cues lead to a permanent alteration in the regulation of metabolism and adiposity and which metabolic factors might be involved in this regulation. Moreover, detailed studies examining long-term changes in energy metabolism of rodents overfed specifically during the postnatal period are still lacking. There are some reports that rats raised in SL may develop permanent hyperphagia (14, 17), whereas other authors observed no obvious difference in food intake in adult offspring when compared with those raised in a normal litter (NL) (18). On the other hand, animals raised in SL demonstrated impaired sympathetic activities in heart, kidney, and BAT as measured by [3H]norepinephrine turnover (21). These studies prompted us to hypothesize that altered energy expenditure may be involved in the increased body weight and adiposity in these SL-rearing animals. To address these issues, we investigated whether altered BAT thermogenesis contributes to the maintenance of the adult overweight phenotype induced by SL rearing.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and diet
Male offspring from Sprague Dawley rats were used. Pregnant rats (Simonsen, Gilroy, CA) were individually housed with a 12-h light, 12-h dark photoperiod (lights on at 0700 h) at 21–22 C. The day of delivery was considered as d 0 postpartum (P0), and litters were adjusted to eight pups on P2. On P5, litter sizes in some animals were adjusted to three pups (SL). Pups raised in litters of eight pups served as controls (NL). Lactating rats were allowed to suckle their pups undisturbed except for cage cleaning and weighing on P4, P11, P16, and P21. After weaning (P23), pups from both groups were housed three per cage with free access to standard rat chow and water. In some studies, pups from NL and SL were killed on P16 and P21, and all other animals were killed between 1200 and 1500 h by decapitation on P60. Trunk blood was obtained, and interscapular BAT was quickly removed, dissected free of connective tissues, and used for ex vivo lipolytic assays, RNA and protein extraction, or histological study. Animals used in the experiment were from at least 10 (SL) and six (NL) different litters. All animal procedures were approved by the Oregon National Primate Research Center Institutional Animal Care and Use Committee.

Cold exposure
Eight NL or SL rats fed with standard rat chow were used in the acute cold exposure test at P60. Before cold exposure, NL or SL rats aged 7–8 wk were individually caged for 1 wk and transferred to precooled cages supplied with a minimum of wood shavings at 4 C for 6 h. At the end of exposure, animals were exposed to CO2 and killed by decapitation between 1200 and 1500 h. NL or SL rats maintained at room temperature (21–22 C, RT) were used as controls. Trunk blood and dissected tissues were collected for RNA and protein and histological study as described above.

Histological examinations
A portion of BAT from both NL and SL animals (n = 4) was placed in 4% paraformaldehyde and fixed for about 24 h at 4 C and then paraffin embedded. Sections, 5 µm thick, were then prepared using a microtome and placed on Superfrost Plus slides (Fisher Scientific, Pittsburgh, PA). Slides were then stained with hematoxylin and eosin, according to standard laboratory protocols. Sections were examined using light microscopy.

Ex vivo lipolytic assays
Freshly removed interscapular BAT from P60 NL and SL rats were weighed and then finely minced with ultrathin razor blades. BAT fragments were washed three times by gentle inversion followed by centrifugation at 20 x g for 1 min in a solution containing 20 mM HEPES (pH 7.4), 120 mM NaCl, 1.3 mM CaCl2, 1.2 mM KH2PO4, 4.8 mM KCl, 0.6 mM MgSO4, and 1% BSA. The tissue fragments were suspended in 1 ml of the above buffer (50–100 mg tissue/ml) and incubated at 37 C in the absence or presence of 10 µM isoproterenol for 90 min. Incubation buffer was collected for the assay of glycerol and free fatty acid (FFA) release.

Hormone and biochemical assays
Trunk blood samples were clotted on ice and centrifuged for 20 min at 2000 x g, and serum was stored at –20 C until use. Serum leptin and insulin levels were assayed using rat leptin and insulin RIA kits (Linco Research, St. Charles, MO). On the day of RIA, samples were thawed, and 100 µl serum was added to RIA tubes. Standard concentrations ranged between 0.5–50 ng/ml for leptin and 0.1–10.0 ng/ml for insulin, within the limit of linearity. All samples were examined in the same assay, with an intraassay coefficient of variance of 7%. The colorimetric FFA assay was used to quantify the total nonesterified FFA in serum and incubation medium according to the manufacturer’s instructions (Wako Chemicals, Richmond, VA). The intraassay coefficient of variance of this assay was 5.5%. Blood glucose was measured by the One Touch Ultra blood glucose monitoring system (LifeScan, Milpitas, CA). Serum triglyceride and incubation buffer glycerol levels were measured by using the serum triglyceride determination kit (Sigma-Aldrich, St. Louis, MO), with which triglyceride and glycerol levels were appraised with a standard curve generated from samples of known glycerol content.

RNA isolation and real-time PCR
BAT RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and purified using an affinity resin column (QIAGEN, Valencia, CA). Real-time PCR was used to quantify mRNA levels of UCP1, LPL, hormone-sensitive lipase (HSL), fatty acid synthase (FAS), stearoyl-coenzyme A desaturase 2 (SCD2), peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}), CCAAT/enhancer-binding protein {alpha} (C/EBP{alpha}), PPAR{gamma} coactivator 1{alpha} (PGC-1{alpha}), ß1- and ß3-adrenergic receptors (Adrb1 and Adrb3) as in our previous report (22). Inventoried primers and probes (Applied Biosystems, Foster City, CA) for LPL (Rn00688368_m1), HSL (Rn00689227_g1), SCD2 (Rn00821391_g1), FAS (Rn01645294_g1), PPAR{gamma} (Rn01492271_m1), C/EBP1{alpha} (Rn00560963_s1), and Adrb1 (Rn00824536_s1) were used, and 18S RNA was used as internal control. Other primers and probes were designed using the Primer Express software from Applied Biosystems. The sequences are as follows: UCP1 forward TCCCTCAGGATTGGCCTCTAC, reverse GTCATCAAGCCAGCCGAGAT, and probe, CGCCTGCCTCTTTGGGAAGCAA; Adrb3 forward CCGCAGCTGACTTGGTAGTG, reverse CCACAGTTCGCAACCAGTTTC, and probe CTGACTGGCCATTGGCCCTTGG; and PGC-1{alpha} forward AGAGCGCCGTGTGATTTACG, reverse CGGTGCATTCCTCAATTTCA, and probe GACCTGACACAACGCGGACAGAAC.

Protein preparation and Western blot
Frozen BAT was sliced and thawed in RIPA buffer containing protease inhibitor cocktail (Santa Cruz Biotechnology, Santa Cruz, CA). Tissues were further disrupted and homogenized and then incubated on ice for 30 min. The tissue lysate was then centrifuged at 10,000 x g for 10 min at 4 C. The supernatant was centrifuged again, and the resulting supernatant is the total cell lysate. The protein concentration was determined using the Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, CA). Samples containing 20 µg total protein were mixed with SDS loading buffer, incubated at 90 C for 5 min, electrophoresed on 12% PAGE Gold Precast Gels (Cambrex Bio Science, Rockland, ME), and then transferred to PVDF membranes (Bio-Rad Laboratories). After transfer, membranes were blocked with blocking buffer (Pierce Chemical, Rockford, IL) for 1 h at RT and incubated with polyclonal anti-UCP1 (1:1000) and anti-ß-actin (1:1000) (Santa Cruz Biotechnology). After washing, the membranes were further incubated with horseradish peroxidase-conjugated secondary antibody (1:10,000; Jackson ImmunoResearch Laboratories, West Grove, PA). Immunoreactive products were detected using enhanced chemiluminescence (Pierce) and exposed to X-OMAT sheet film (Eastman Kodak, Rochester, NY).

Statistical analysis
Data are expressed as mean ± SEM. When both litter size (NL and SL) and temperature (RT and 4 C) or drug (basal and isoproterenol) were considered, two-way ANOVA and Bonferroni post tests were used to determine significant differences. In some experiments, Student’s t test was used to determine significant differences. For all analyses, statistical significance was assigned at the level of P values lower than 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SL rearing has long-term effects on body weight
Under ambient conditions, serum biochemical markers and hormone levels did not differ significantly between NL and SL (Table 1Go). Beginning with P16, SL animals were significantly heavier than NL, and the body weight difference was maintained until weaning (Fig. 1AGo) and into young adulthood (P60, Fig. 1BGo). These results agree with previous reports (13, 14, 15, 16, 17, 18). The daily average food intake in the last week (P53–P60) in SL rats was only slightly higher than NL (Fig. 1CGo), indicating hyperphagia. However, when normalized to body weight, the difference was not significant (Fig. 1DGo). This is in agreement with previous reports (14, 17, 18).


View this table:
[in this window]
[in a new window]

 
TABLE 1. Serum biochemical and hormone changes in NL and SL rats

 

Figure 1
View larger version (37K):
[in this window]
[in a new window]

 
FIG. 1. Changes in body weight and food intake in NL and SL rats. Body weight was measured at P4, P11, P16, P21 (A), and P60 (B). Daily food intake was recorded from P53–P60 and expressed as either average daily food intake (C) or normalized to their body weight at P60 (D). n = 8–12; *, P < 0.05 vs. NL at the same age (Student’s t test).

 
Brown adipose adaptive thermogenesis is reduced in SL rats
Acute exposure of normal animals to 4 C (cold exposure) is a well-established method investigating functional activity of BAT-mediated nonshivering thermogenesis. BAT mass did not significantly differ between NL and SL (0.277 vs. 0.244 g, NL vs. SL, P = 0.2940, Student’s t test), indicating no obvious BAT dystrophy. Figure 2Go shows histological changes in NL and SL rats maintained either at 21–22 C (RT) or at 4 C for 6 h (4D). At RT, no noticeable difference was found between NL and SL BAT (Fig. 2Go, A and B). Brown adipocytes are typically multilocular, with the bulk of the cell being occupied by numerous circular lipid droplets with various sizes, which appeared as vacant or unstained areas in both NL and SL animals. However, acute cold exposure induced a dramatic reduction in the size and number of lipid droplets in the BAT of NL rats, whereas in SL BAT, large circular lipid droplets were still plentiful, indicative of reduced thermogenic response to cold stress (Fig. 2Go, C and D).


Figure 2
View larger version (163K):
[in this window]
[in a new window]

 
FIG. 2. Changes in interscapular BAT morphology of adult NL and SL rats at RT or under cold conditions. Tissues were fixed with 4% paraformaldehyde, and photomicrographs of hematoxylin-eosin staining are NL (A) and SL (B) at RT (21–22 C) and NL (C) and SL (D) at 4 C for 6 h (4D). Note the decrease in size and number of lipid droplets in NL but not SL animals in response to cold exposure.

 
Impaired nonshivering thermogenic response in SL animals was further confirmed by gene expression of several critical elements for thermogenesis. UCP1-driven uncoupling is necessary for maximizing metabolic rate and closely associated BAT heat production (2). At first, we investigated the dynamic change of UCP1 expression in BAT from NL and SL rats at different ages (Fig. 3AGo). In general, UCP1 mRNA in BAT was elevated in the SL rats before weaning (P21) but was significantly lower in adulthood (P60). At P60, both basal and cold-induced UCP1 mRNA expression showed a remarkable reduction in BAT from SL in comparison with those from NL animals (Fig. 3BGo), and the same change tendency was found for UCP1 protein (Fig. 3CGo), indicating a reduced BAT nonshivering thermogenesis in SL animals. In contrast, UCP3, another isoform of UCPs present in BAT, remained relatively stable, and neither SL nor cold exposure significantly altered its expression (data not shown).


Figure 3
View larger version (33K):
[in this window]
[in a new window]

 
FIG. 3. A, Changes in BAT UCP1 in NL and SL rats. Dynamic changes of UCP1 in NL and SL rats. UCP1 mRNA was assayed by real-time RT-PCR at P16, P21, and P60, and the UCP1 level at different postnatal ages was compared with the value of P60 NL. n =5–7; *, P < 0.05 vs. NL at the same age (Student’s t test). B and C, Cold-induced changes of UCP1 mRNA (B) and protein (C) in NL and SL rats. At P60, NL and SL rats were maintained at room temperature (21–22 C, NL/RT and SL/RT) or 4 C for 6 h (NL/4D and SL/4D). UCP1 mRNA and protein were assayed by real-time RT-PCR and Western blot. Columns with differing superscripts (a, b, or c) indicate values that are significantly different from each other (two-way ANOVA and Bonferroni post tests; n = 5–8). Representative Western bands of UCP1 and ß-actin were from four individual rats.

 
Adult SL rats have disturbed BAT lipid metabolism
The major metabolic fuels for BAT thermogenesis are FFAs, which are provided either by LPL-mediated uptake from circulating triglycerides or by HSL-mediated lipolysis of triglycerides stored in the lipid droplets. In addition, FFAs are direct activators of the uncoupling activity of UCP1 in the mitochondria (2). LPL protein and activity in BAT have been shown to be rapidly and specifically stimulated in response to cold exposure (23). Figure 4AGo shows that at RT, LPL mRNA expression was significantly lower in SL animals in comparison with NL, indicating reduced uptake of FFAs from circulation for heat production. In both NL and SL animals, 6 h cold exposure caused a small but nonsignificant increase in LPL mRNA, suggesting the rapid increase in LPL protein and activity induced by acute cold exposure in previous studies was independent of transcriptional operation (23). Acute cold exposure induced a 4-fold increase in HSL mRNA in NL rats, in agreement with previous reports (2, 24), whereas HSL induction was absent in SL rats under cold exposure (Fig. 4BGo).


Figure 4
View larger version (33K):
[in this window]
[in a new window]

 
FIG. 4. Changes in transcripts of key enzymes related to BAT lipid metabolism in adult NL and SL rats. At P60, NL and SL rats were maintained at RT (21–22 C, NL/RT and SL/RT) or 4 C for 6 h (NL/4D and SL/4D). LPL (A), HSL (B), FAS (C), and SCD2 (D) mRNA levels were assayed by real-time RT-PCR. Columns with differing superscripts (a, b, or c) indicate values that are significantly different from each other (two-way ANOVA and Bonferroni post tests; n = 5–8).

 
Maximal thermogenesis in rodent BAT appears to rely on the maintenance of adequate lipid storage, a process closely associated with de novo lipogenesis in differentiated brown adipocytes. This is supported by the robust de novo lipogenesis and increased lipogenic enzyme observed in BAT from cold-acclimated animals (25). FAS and SCD2 are two key enzymes involved in synthesis of fatty acid and conversion into monounsaturated fatty acids. As shown in Fig. 4Go, C and D, SL animals exhibited lower expression of both FAS and SCD2 compared with NL at RT. In contrast to cold-acclimated animals, in our acute cold exposure model, a rapid decrease in FAS (Fig. 4CGo) and SCD2 (Fig. 4DGo) as well as two other lipogenic enzymes, SCD1 and type 2 acyl-CoA:diacylglycerol acyltransferase (DGAT2) (data not shown), was observed in both NL and SL rats. This suggests that different mechanisms are involved in the adaptation to short-term vs. long-term cold exposure (25, 26).

Adult SL rats have impaired expression of transcriptional factors controlling BAT thermogenic capacity
There are several nuclear transcriptional factors and coactivators involved in UCP1 expression and maintenance of mature brown adipocytes by controlling their precursor cell proliferation and differentiation. PPAR{gamma}, C/EBP{alpha}, and PGC-1{alpha} are of particular importance (2, 27, 28, 29). PPAR{gamma} and C/EBP{alpha} are present in both BAT and white adipose tissue, and they are required for the acquisition of thermogenic capability, adipogenesis, and mitochondriogenesis in BAT (27, 28, 30). Both PPAR{gamma} and C/EBP{alpha} were decreased in adult SL compared with NL rats (Fig. 5Go, A and B), suggesting a low activation of BAT thermogenesis. Acute cold exposure appeared to inhibit PPAR{gamma} and C/EBP{alpha} expression (Fig. 5Go, A and B), which was more obvious in NL animals. This is in agreement with previous reports (25, 28). PGC-1{alpha} is an upstream signal molecule that has been shown to be associated with multiple biological responses related to energy homeostasis, thermal regulation, and nutrient metabolism and plays a central integrative role in mitochondrial biogenesis and adaptive thermogenesis (29). As shown in Fig. 5CGo, PGC-1{alpha} mRNA was similarly low in BAT of adult NL and SL rats maintained at RT, indicating both PGC-1{alpha}-dependent and -independent mechanisms are operating on UCP1 expression. However, when animals were put into a cold condition, PGC-1a mRNA was up-regulated 14-fold in NL whereas only a 5-fold induction was found for PGC-1{alpha} in SL.


Figure 5
View larger version (28K):
[in this window]
[in a new window]

 
FIG. 5. Changes in transcripts of transcriptional factors/coactivators in adult NL and SL rats. At P60, NL and SL rats were maintained at RT (21–22 C, NL/RT and SL/RT) or 4 C for 6 h (NL/4D and SL/4D). PPAR{gamma} (A), C/EBP1{alpha} (B), and PGC-1{alpha} (C) mRNA levels were assayed by real-time RT-PCR. Columns with differing superscripts (a, b, or c) indicate values that are significantly different from each other (two-way ANOVA and Bonferroni post tests; n = 5–8).

 
Sympathetic regulation was impaired in adult SL BAT
Adrb1 and Adrb3 are the primary adrenergic receptors involved in the regulation of sympathetic outflow to BAT (31, 32). Figure 6AGo shows that Adrb3 was significantly reduced in SL rats, and a similar trend was found for Adrb1 (Fig. 6BGo), suggesting the reduction in adaptive thermogenesis may possibly be related to sympathetic ß-adrenergic receptors. To our surprise, cold exposure for 6 h induced a remarkable down-regulation of Adrb3 in both NL and SL rats (Fig. 6AGo); however, the Adrb1 mRNA was relatively resistant to the cold treatment (Fig. 6BGo).


Figure 6
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 6. Changes in Adrb expression in adult NL and SL rats. At P60, NL and SL rats were maintained at room temperature (21–22 C, NL/RT and SL/RT) or 4 C for 6 h (NL/4D and SL/4D). Adrb3 (A), and Adrb1 (B) mRNA levels were assayed by real-time RT-PCR. Columns with differing superscripts (a, b, or c) indicate values that are significantly different from each other (two-way ANOVA and Bonferroni post tests; n = 5–8).

 
Functional analysis was performed by incubating BAT pieces from NL and SL in the absence or presence of the Adrb agonist isoproterenol (Fig. 7Go). Basal glycerol release from SL BAT was 50% higher than NL (Fig. 7AGo), and the same tendency was found for FFA release (Fig. 7BGo). Compared with basal release, 10 µM isoproterenol induced a 3.7-fold increase in glycerol and a 3-fold increase in FFA release in NL BAT, whereas only a 1.4-fold increase in glycerol release and a 1.4-fold increase in FFA release were observed in SL rats, suggesting SL animals display a decreased sensitivity to this sympathetic agonist.


Figure 7
View larger version (44K):
[in this window]
[in a new window]

 
FIG. 7. Changes in BAT sympathetic response of NL and SL. At P60, NL and SL rats were maintained in the ambient environment. Immediately after being killed, small pieces of BAT were incubated with PBS (basal) or 10 µM isoproterenol for 90 min, and incubation buffers were collected for glycerol and FFA tests. A, Glycerol release; B, FFA release. Columns with differing superscripts (a, b, or c) indicate values that are significantly different from each other (two-way ANOVA and Bonferroni post tests; n = 4).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It is clear that excess weight gain during the early postnatal period, largely due to overnutrition, can significantly alter body weight in adulthood, but factors responsible for the development of abnormalities remain unclear. Intense attention has been focused on food intake itself as well as the hypothalamic mechanisms that may be involved (14, 15, 16, 17). In contrast, little is known about metabolic adaptations induced by postnatal excess weight gain in peripheral metabolic tissues. The results of the present study show that male offspring of rats raised in small litters in early postnatal life develop an overweight phenotype. In addition, in agreement with previous reports (13, 14, 15, 16, 17, 18), these animals maintain the overweight phenotype into adulthood even after being placed in identical conditions from the time of weaning (P23). More importantly, our studies provide the first evidence that early postnatal overnutrition leads to permanent changes in BAT thermogenesis through the SNS-mediated mechanism.

In BAT, nonshivering thermogenesis, a process by which energy is dissipated as heat, is mainly mediated through a change of UCP1 expression. In rodents and other small mammals, BAT thermogenesis is a significant contributor to overall energy expenditure (2, 33, 34, 35). Changes in BAT function have been shown to be tightly controlled by the SNS, mediated through several subtypes of postsynaptic adrenergic receptors (36, 37). Impaired UCP activity and thermogenic capability are common characteristics for several genetic obese models (2, 3, 4, 38, 39). In the present study, multiple strategies were used in the determination of BAT morphological, functional, and biochemical changes as well as transcriptional changes of several critical components involved in thermogenesis in this mild overweight model through reducing litter size in the early postnatal period. On one hand, UCP1 expression in BAT was elevated in preweaning SL animals, suggesting increased energy expenditure, which was similar to that reported for adult diet-induced obesity models (2, 40). The high level of UCP1 expression in young SL animals most likely reflects an adaptation in response to a higher intake of caloric and metabolizable energy and might represent an attempt to control weight gain by consuming the excess energy through increased thermogenesis rather than accumulation as fat. Therefore, at the early stage of SL animals, high energy intake mainly accounts for the rapid growth and body weight gain even though BAT mediated thermogenesis and energy expenditure is also stimulated. However, excessive stimulation of energy expenditure at an early age of life may result in desensitization or reprogramming of regulatory pathways governing thermogenesis, which may contribute to the subsequent impairment in energy expenditure in adulthood. This has been confirmed by the following evidence in the present studies. Histologically, adult SL rats demonstrated impaired BAT thermogenic capacity when challenged by an acute cold exposure. In addition, both basal and cold-induced UCP1 expression was reduced in SL rats, supporting the predominant role of UCP1 in BAT nonshivering thermogenesis. SL animals showed a reduced basal LPL or cold-induced LPL and HSL expression, and furthermore, transcripts of several key lipogenic enzymes were decreased in SL rats. The reduction in LPL, HSL, and lipogenic enzymes suggests that the supplying of a fuel source for heat production is also defective in SL animals. Finally, transcript abundance of nuclear transcriptional factors or coactivators, such as PPAR{gamma}, C/EBP{alpha}, and PGC-1{alpha}, was lowered either at ambient temperature or under cold conditions in SL rats. The reduced levels of these transcriptional factors and coactivators indicate impairments in proliferation of adipocyte precursor cells, differentiation of preadipocyte into adipocyte, mitochondrial biogenesis, and transcriptional control of UCP1 expression in SL rats (2, 27, 28, 29, 30). In summary, results from our present studies suggest that multiple events are associated with impaired adaptive thermogenesis in SL rats. The deficiency may play a role in maintaining the overweight phenotype in SL animals after the overfeeding manipulation is terminated and all animals are maintained under identical ad libitum feeding conditions.

BAT UCP1 expression and adaptive thermogenesis are under the tight control of the autonomic nervous system and several hormonal factors. Neuroanatomic and physiological evidence has accumulated in support of the direct innervation of BAT by the SNS, and the activity of the SNS is increased by cold exposure and food intake (2, 7, 31, 32, 41, 42). The sympathetic postganglionic neurotransmitter norepinephrine, upon binding to adrenergic receptors, can either acutely activate BAT heat production or chronically enhance the capacity for thermogenesis through BAT recruitment, including increased brown adipocyte proliferation and differentiation via Adrb-cAMP-protein kinase A pathways (2, 7, 43, 44). The regulatory sites responsible for norepinephrine stimulus of transcription in the UCP1 gene include multiple putative cAMP-regulatory elements (CREs) as well as their binding protein (CREB). It has been suggested that cAMP directly regulates the expression of UCP1 through the interaction of CREB with putative CREs in the 5'-flanking region of the UCP1 gene (45). In the current study, Adrb3, and possibly Adrb1, receptors, which are responsible for mature brown adipocyte differentiation and preadipocyte proliferation, respectively (43), displayed dysregulation in adult SL rats, supporting the notion of a reduced capacity in BAT heat production. In further support of impaired SNS regulation in SL rats, BAT from SL animals demonstrated a reduced response to Adrb agonist-induced lipolytic rate ex vivo. In accordance with this, rearing animals in SL resulted in the impairment of norepinephrine turnover in several peripheral tissues including BAT when these animals were fed a sucrose diet in adulthood (21). Interestingly, we observed a significant down-regulation of Adrb3 in both NL and SL rats under cold conditions. Adrb3 mRNA might be increased at an early phase of cold exposure (within 1 h) and then rapidly dropped even well below the level observed at ambient temperature (25, 46). Down-regulated Adrb3 mRNA under cold conditions was absent when animals were SNS-denervated in BAT pads, and sympathetic agonists mimicked this effect (46, 47), suggesting reduced Adrb3 under cold conditions may be attributable to the inhibitory mechanism of SNS.

This study raises another question as to the upstream abnormalities that lead to changes in BAT function. One possibility is that the early chronic overnutrition may cause a reprogramming of the central circuitry that regulates sympathetic outflow. Neuropeptide Y (NPY) and melanocortin circuits from the arcuate nucleus of the hypothalamus, which are known to regulate sympathetic outflow, develop during the second and third postnatal week (48, 49). Overnutrition during this period could impact development of the circuit and permanently alter basal and stress-induced sympathetic tone. Leptin has been shown to be a critical factor in the development of hypothalamic feeding circuitry (49), and SL animals show a dramatic hyperleptinemia during the second and third postnatal week (14, 15). Furthermore, increased NPY expression and concentration have been reported in the hypothalamus from SL animals (15), and more importantly, neurons from the SL arcuate or ventromedial nuclei of the hypothalamus were completely unresponsive to the anorexigenic hormones leptin and insulin when compared with those neurons from NL animals, suggesting a hypothalamic resistance to leptin and insulin (50, 51). Increased NPY and leptin/insulin resistance provide a hypothalamic mechanism in reducing energy expenditure in adult SL animals (52, 53, 54).

In conclusion, the present results demonstrate that early postnatal nutritional manipulation through altering litter size can result in long-term abnormalities in body weight homeostasis. Postnatal overnutrition is associated with reduced BAT thermogenesis in adulthood, not only through decreasing UCP1 expression but also by impaired maintenance and supply of metabolic fuels for BAT heat production, and thereby inhibits energy expenditure. These abnormalities are attributable to the impairment in sympathetic activities in BAT, presumably through a reprogramming of the hypothalamic metabolic circuitry. In addition, our data reinforce the hypothesis that reduced sympathetic activities in BAT are one of the primary lesions in these preobese rats, which may play a key role in the development of obesity. Further studies are needed to characterize the alteration in the hypothalamic control of sympathetic outflow and to determine how these SL animals would respond if challenged with changes in caloric diets (i.e. high fat or caloric density) during adulthood and whether they would defend these new body weights or demonstrate hypersensitivity to diet changes.


    Footnotes
 
This work was supported by National Institutes of Health Grants DK-60685, HD-14643, and RR-00163.

Disclosure Statement: The authors have nothing to disclose.

First Published Online May 24, 2007

Abbreviations: Adrb, ß-Adrenergic receptor; BAT, brown adipose tissue; C/EBP{alpha}, CCAAT/enhancer-binding protein {alpha}; CRE, cAMP-regulatory element; CREB, CRE-binding protein; FAS, fatty acid synthase; FFA, free fatty acid; HSL, hormone-sensitive lipase; LPL, lipoprotein lipase; NL, normal litter; NPY, neuropeptide Y; P0, postnatal d 0; PGC-1{alpha}, PPAR{gamma} coactivator 1{alpha}; PPAR{gamma}, peroxisome proliferator-activated receptor {gamma}; RT, room temperature; SL, small litter; SCD2, stearoyl-coenzyme A desaturase 2; SNS, sympathetic nervous system; UCP1, uncoupling protein 1.

Received March 20, 2007.

Accepted for publication May 16, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Wyatt SB, Winters KP, Dubbert PM 2006 Overweight and obesity: prevalence, consequences, and causes of a growing public health problem. Am J Med Sci 331:166–174[CrossRef][Medline]
  2. Cannon B, Nedergaard J 2004 Brown adipose tissue: function and physiological significance. Physiol Rev 84:277–359[Abstract/Free Full Text]
  3. Commins SP, Watson PM, Padgett MA, Dudley A, Argyropoulos G, Gettys TW 1999 Induction of uncoupling protein expression in brown and white adipose tissue by leptin. Endocrinology 140:292–300[Abstract/Free Full Text]
  4. Masaki T, Yoshimatsu H, Chiba S, Sakata T 2000 Impaired response of UCP family to cold exposure in diabetic (db/db) mice. Am J Physiol Regul Integr Comp Physiol 279:R1305–R1309
  5. Lowell BB, S-Susulic V, Hamann A, Lawitts JA, Himms-Hagen J, Boyer BB, Kozak LP, Flier JS 1993 Development of obesity in transgenic mice after genetic ablation of brown adipose tissue. Nature 366:740–742[CrossRef][Medline]
  6. Kopecky J, Clarke G, Enerback S, Spiegelman B, Kozak LP 1995 Expression of the mitochondrial uncoupling protein gene from the aP2 gene promoter prevents genetic obesity. J Clin Invest 96:2914–2923[Medline]
  7. Bachman ES, Dhillon H, Zhang CY, Cinti S, Bianco AC, Kobilka BK, Lowell BB 2002 ßAR signaling required for diet-induced thermogenesis and obesity resistance. Science 297:843–845[Abstract/Free Full Text]
  8. Valve R, Heikkinen S, Rissanen A, Laakso M, Uusitupa M 1998 Synergistic effect of polymorphisms in uncoupling protein 1 and ß3-adrenergic receptor genes on basal metabolic rate in obese Finns. Diabetologia 41:357–361[CrossRef][Medline]
  9. Proenza AM, Poissonnet CM, Ozata M, Ozen S, Guran S, Palou A, Strosberg AD 2000 Association of sets of alleles of genes encoding ß3-adrenoreceptor, uncoupling protein 1 and lipoprotein lipase with increased risk of metabolic complications in obesity. Int J Obes Relat Metab Disord 24:93–100[CrossRef][Medline]
  10. Goran MI, Treuth MS 2001 Energy expenditure, physical activity, and obesity in children. Pediatr Clin North Am 48:931–953[CrossRef][Medline]
  11. Strauss RS 1997 Effects of the intrauterine environment on childhood growth. Br Med Bull 53:81–95[Abstract/Free Full Text]
  12. Martorell R, Stein AD, Schroeder DG 2001 Early nutrition and later adiposity. J Nutr 131:874S–880S
  13. Faust IM, Johnson PR, Hirsch J 1980 Long-term effects of early nutritional experience on the development of obesity in the rat. J Nutr 110:2027–2034[Abstract/Free Full Text]
  14. Plagemann A, Harder T, Rake A, Voits M, Fink H, Rohde W, Dorner G 1999 Perinatal elevation of hypothalamic insulin, acquired malformation of hypothalamic galaninergic neurons, and syndrome x-like alterations in adulthood of neonatally overfed rats. Brain Res 836:146–155[CrossRef][Medline]
  15. Plagemann A, Harder T, Rake A, Waas T, Melchior K, Ziska T, Rohde W, Dorner G 1999 Observations on the orexigenic hypothalamic neuropeptide Y-system in neonatally overfed weanling rats. J Neuroendocrinol 11:541–546[CrossRef][Medline]
  16. Davidowa H, Li Y, Plagemann A 2003 Altered responses to orexigenic (AGRP, MCH) and anorexigenic ({alpha}-MSH, CART) neuropeptides of paraventricular hypothalamic neurons in early postnatally overfed rats. Eur J Neurosci 18:613–621[CrossRef][Medline]
  17. Boullu-Ciocca S, Dutour A, Guillaume V, Achard V, Oliver C, Grino M 2005 Postnatal diet-induced obesity in rats upregulates systemic and adipose tissue glucocorticoid metabolism during development and in adulthood: its relationship with the metabolic syndrome. Diabetes 54:197–203[Abstract/Free Full Text]
  18. Mozes S, Sefcikova Z, Lenhardt L, Racek L 2004 Obesity and changes of alkaline phosphatase activity in the small intestine of 40- and 80-day-old rats subjected to early postnatal overfeeding or monosodium glutamate. Physiol Res 53:177–186[Medline]
  19. Fiorotto ML, Burrin DG, Perez M, Reeds PJ 1991 Intake and use of milk nutrients by rat pups suckled in small, medium, or large litters. Am J Physiol 260:R1104–R1113
  20. Mozes S, Sefcikova Z, Lenhardt L 2006 Functional changes of the small intestine in over- and undernourished suckling rats support the development of obesity risk on high-energy diet in later life. Physiol Res 56:183–192[Medline]
  21. Young JB 2002 Effects of litter size on sympathetic activity in young adult rats. Am J Physiol Regul Integr Comp Physiol 282:R1113–R1121
  22. Xiao XQ, Grove KL, Grayson BE, Smith MS 2004 Inhibition of uncoupling protein expression during lactation: role of leptin. Endocrinology 145:830–838[Abstract/Free Full Text]
  23. Klingenspor M, Ebbinghaus C, Hulshorst G, Stohr S, Spiegelhalter F, Haas K, Heldmaier G 1996 Multiple regulatory steps are involved in the control of lipoprotein lipase activity in brown adipose tissue. J Lipid Res 37:1685–1695[Abstract]
  24. Holm C, Fredrikson G, Cannon B, Belfrage P 1987 Hormone-sensitive lipase in brown adipose tissue: identification and effect of cold exposure. Biosci Rep 7:897–904[CrossRef][Medline]
  25. Yu XX, Lewin DA, Forrest W, Adams SH 2002 Cold elicits the simultaneous induction of fatty acid synthesis and ß-oxidation in murine brown adipose tissue: prediction from differential gene expression and confirmation in vivo. FASEB J 16:155–168[Abstract/Free Full Text]
  26. Daikoku T, Shinohara Y, Shima A, Yamazaki N, Terada H 2000 Specific elevation of transcript levels of particular protein subtypes induced in brown adipose tissue by cold exposure. Biochim Biophys Acta 1457:263–272[Medline]
  27. Wang ND, Finegold MJ, Bradley A, Ou CN, Abdelsayed SV, Wilde MD, Taylor LR, Wilson DR, Darlington GJ 1995 Impaired energy homeostasis in C/EBP{alpha} knockout mice. Science 269:1108–1112[Abstract/Free Full Text]
  28. Guardiola-Diaz HM, Rehnmark S, Usuda N, Albrektsen T, Feltkamp D, Gustafsson JA, Alexson SE 1999 Rat peroxisome proliferator-activated receptors and brown adipose tissue function during cold acclimatization. J Biol Chem 274:23368–23377[Abstract/Free Full Text]
  29. Puigserver P, Spiegelman BM 2003 Peroxisome proliferator-activated receptor-{gamma} coactivator 1{alpha} (PGC-1{alpha}): transcriptional coactivator and metabolic regulator. Endocr Rev 24:78–90[Abstract/Free Full Text]
  30. Nedergaard J, Petrovic N, Lindgren EM, Jacobsson A, Cannon B 2005 PPAR{gamma} in the control of brown adipocyte differentiation. Biochim Biophys Acta 1740:293–304[Medline]
  31. Bengtsson T, Cannon B, Nedergaard J 2000 Differential adrenergic regulation of the gene expression of the ß-adrenoceptor subtypes ß1, ß2 and ß3 in brown adipocytes. Biochem J 347(Pt 3):643–651
  32. Grujic D, Susulic VS, Harper ME, Himms-Hagen J, Cunningham BA, Corkey BE, Lowell BB 1997 ß3-Adrenergic receptors on white and brown adipocytes mediate ß3-selective agonist-induced effects on energy expenditure, insulin secretion, and food intake. A study using transgenic and gene knockout mice. J Biol Chem 272:17686–17693[Abstract/Free Full Text]
  33. Nedergaard J, Golozoubova V, Matthias A, Asadi A, Jacobsson A, Cannon B 2001 UCP1: the only protein able to mediate adaptive non-shivering thermogenesis and metabolic inefficiency. Biochim Biophys Acta 1504:82–106[Medline]
  34. Lowell BB, Spiegelman BM 2000 Towards a molecular understanding of adaptive thermogenesis. Nature 404:652–660[Medline]
  35. Argyropoulos G, Harper ME 2002 Uncoupling proteins and thermoregulation. J Appl Physiol 92:2187–2198[Abstract/Free Full Text]
  36. Kozak UC, Held W, Kreutter D, Kozak LP 1992 Adrenergic regulation of the mitochondrial uncoupling protein gene in brown fat tumor cells. Mol Endocrinol 6:763–772[Abstract]
  37. Rohlfs EM, Daniel KW, Premont RT, Kozak LP, Collins S 1995 Regulation of the uncoupling protein gene (Ucp) by ß1, ß2, and ß3-adrenergic receptor subtypes in immortalized brown adipose cell lines. J Biol Chem 270:10723–10732[Abstract/Free Full Text]
  38. Trayhurn P, Jones PM, McGuckin MM, Goodbody AE 1982 Effects of overfeeding on energy balance and brown fat thermogenesis in obese (ob/ob) mice. Nature 295:323–325[CrossRef][Medline]
  39. Jurgens HS, Schurmann A, Kluge R, Ortmann S, Klaus S, Joost HG, Tschop MH 2006 Hyperphagia, lower body temperature, and reduced running wheel activity precede development of morbid obesity in New Zealand obese mice. Physiol Genomics 25:234–241[Abstract/Free Full Text]
  40. Petzke KJ, Friedrich M, Metges CC, Klaus S 2005 Long-term dietary high protein intake up-regulates tissue specific gene expression of uncoupling proteins 1 and 2 in rats. Eur J Nutr 44:414–421[CrossRef][Medline]
  41. Bamshad M, Song CK, Bartness TJ 1999 CNS origins of the sympathetic nervous system outflow to brown adipose tissue. Am J Physiol 276:R1569–R1578
  42. Nakamura K, Morrison SF 2007 Central efferent pathways mediating skin cooling-evoked sympathetic thermogenesis in brown adipose tissue. Am J Physiol Regul Integr Comp Physiol 292:R127–R136
  43. Bronnikov G, Houstek J, Nedergaard J 1992 ß-Adrenergic, cAMP-mediated stimulation of proliferation of brown fat cells in primary culture. Mediation via ß1 but not via ß3 adrenoceptors. J Biol Chem 267:2006–2013[Abstract/Free Full Text]
  44. Cao W, Daniel KW, Robidoux J, Puigserver P, Medvedev AV, Bai X, Floering LM, Spiegelman BM, Collins S 2004 p38 mitogen-activated protein kinase is the central regulator of cyclic AMP-dependent transcription of the brown fat uncoupling protein 1 gene. Mol Cell Biol 24:3057–3067[Abstract/Free Full Text]
  45. Rim JS, Kozak LP 2002 Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene. J Biol Chem 277:34589–34600[Abstract/Free Full Text]
  46. Granneman JG, Lahners KN 1992 Differential adrenergic regulation of ß1- and ß3-adrenoreceptor messenger ribonucleic acids in adipose tissues. Endocrinology 130:109–114[Abstract]
  47. Revelli JP, Muzzin P, Giacobino JP 1992 Modulation in vivo of ß-adrenergic-receptor subtypes in rat brown adipose tissue by the thermogenic agonist Ro 16-8714. Biochem J 286 (Pt 3):743–746
  48. Grove KL, Grayson BE, Glavas MM, Xiao XQ, Smith MS 2005 Development of metabolic systems. Physiol Behav 86:646–660[CrossRef][Medline]
  49. Bouret SG, Draper SJ, Simerly RB 2004 Trophic action of leptin on hypothalamic neurons that regulate feeding. Science 304:108–110[Abstract/Free Full Text]
  50. Davidowa H, Plagemann A 2000 Decreased inhibition by leptin of hypothalamic arcuate neurons in neonatally overfed young rats. Neuroreport 11:2795–2798[Medline]
  51. Davidowa H, Plagemann A 2001 Inhibition by insulin of hypothalamic VMN neurons in rats overweight due to postnatal overfeeding. Neuroreport 12:3201–3204[CrossRef][Medline]
  52. Egawa M, Yoshimatsu H, Bray GA 1991 Neuropeptide Y suppresses sympathetic activity to interscapular brown adipose tissue in rats. Am J Physiol 260:R328–R334
  53. Muller C, Voirol MJ, Stefanoni N, Surmely JF, Jequier E, Gaillard RC, Tappy L 1997 Effect of chronic intracerebroventricular infusion of insulin on brown adipose tissue activity in fed and fasted rats. Int J Obes Relat Metab Disord 21:562–566[CrossRef][Medline]
  54. Hausberg M, Morgan DA, Mitchell JL, Sivitz WI, Mark AL, Haynes WG 2002 Leptin potentiates thermogenic sympathetic responses to hypothermia: a receptor-mediated effect. Diabetes 51:2434–2440[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
C.-D. Walker
A Suckling Feast: Not So Hot After All
Endocrinology, September 1, 2007; 148(9): 4147 - 4149.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
148/9/4150    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xiao, X. Q.
Right arrow Articles by Grove, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xiao, X. Q.
Right arrow Articles by Grove, K. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals