| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Molecular and Structural Biochemistry, North Carolina State University, Raleigh, North Carolina 27695-7622
Address all correspondence and requests for reprints to: Dr. William L. Miller, Department of Molecular and Structural Biochemistry, Box 7622, North Carolina State University, Raleigh, North Carolina 27695-7622. E-mail: wlmiller{at}ncsu.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
34% normal males) (4). In an attempt to learn more about the molecular mechanism(s) used by activin at the gene level, studies have recently focused on transcriptional regulation of the FSH ß-subunit (FSHB), which is rate limiting for overall FSH production. Ovine FSHB promoter/reporter constructs (oFSHBLuc; 4.7 kb of the ovine FSHB promoter plus intron 1 attached to the luciferase gene) are expressed in LßT2 transformed gonadotropes in ways that permit identification of promoter elements associated with induction by activin. Because Smads are recognized activin-activated transcription factors, putative Smad binding elements (SBEs) were sought and found in the proximal promoter of ovine FSHB. Destruction of the putative SBE at –162 bp (AGAC) is especially effective in blocking activin induction of reporter genes driven by the ovine FSHB promoter (5).
Similar studies in our laboratory, reported here, had discovered sequences adjacent to the –162-bp consensus Smad binding site that were also important for ovine FSHB expression in LßT2 cells in culture (6). This DNA sequence was recently identified by computer analysis to be a Runx1 binding site (7). This correlation is significant because Runx family members are known to bind the same sequence and interact with Smads through their Runt homology domains (8, 9). However, the correlation does not prove that any Runx family member binds this sequence. In fact, the DNA sequence of interest also resembles binding sites for forkhead proteins such as FAST-1 (FoxH1), a well-characterized DNA binding partner of Smads 2 and 3 that mediates many actions of TGFß1 and activin (9, 10). Therefore, it is possible that forkhead transcription factors may, in fact, act through the putative Runx1 binding site to partner with Smads for the induction of FSHB in gonadotropes. The important point is that the sequence of interest in this report is associated with transcription factors known to partner with Smads.
To date, no laboratory using methods such as EMSA has been able to demonstrate that activin promotes the association of any protein to either the putative Runx1 or SBE binding site. Therefore, both binding sites remain "putative" and will be referred to this way herein because their abilities to bind these proteins have not been established. In addition, the importance of these sites has been established only in LßT2 cells. Thus, it is important to show the physiological relevance of this promoter region for FSHB expression and activin induction in vivo. The studies described here were designed to demonstrate the importance of this novel sequence in vitro and also in transgenic mice in vivo.
| Materials and Methods |
|---|
|
|
|---|
Universal RIA for FSH (pan-FSH RIA)
Sheep and mouse FSH were measured using a pan-FSH RIA distributed by the National Institute of Diabetes and Digestive and Kidney Diseases using a double-antibody method as previously reported (11). Purified mouse FSH (AFP-5308D) was used as tracer and standard for the mouse assay, and 95% pure ovine FSH standard was used for the sheep assay. Intraassay variation for each RIA was less than 10%, and assay slopes were more than one.
Plasmid constructs
Our wt-oFSHBLuc, reported in 2001 (11), was used in this study to transiently transfect LßT2 cells and also to produce all the other constructs in this study. This wild-type construct contains 4.7-kb ovine FSHB promoter plus intron 1 driving luciferase expression. The constructs used in Fig. 2
were made from wt-oFSHBLuc by producing point mutations that created novel restriction sites: constructs 1, 4, 5, 6, 9, 10, 11, and 12 contained distinguishing Bgl2 sites; construct 2 had a novel Mlu1 site; construct 3 had an Xho1 site; and construct 8 had a new EcoR1 site. All plasmids were sequenced and shown to contain the sequences depicted in Fig. 2
(SeqWright, Houston, TX). Construct 3 contained a mutation that destroyed the putative Runx1 enhancer located between –171 and –163 bp of the ovine FSHB promoter. This construct was transiently expressed in LßT2 cells and also was used as a transgene in mice. The transgene made from construct No. 3 was named mut-oFSHBLuc in this report.
|
All the transgenes used or referred to in this study were cut from their parent plasmid by digestion with BamH1/KpnI, which left less than 100-bp plasmid sequence on each end of the transgene. As with all previous transgenes produced in this laboratory [wt-oFSHBLuc (11) and mut-oFSHBLuc-
AP1 (12)], wtLj-oFSHBLuc and mut-oFSHBLuc reported here were expressed in every founder line that carried the respective transgene.
Animal care: sheep and transgenic mice
Ewes and transgenic mice were maintained and studied with the approval and oversight of the Institutional Animal Care and Use Committee at the University of North Carolina Chapel Hill or North Carolina State University. Mice containing wild-type (wtLj-oFSHBLuc) or mutant (mut-oFSHBLuc) transgenes were produced in B6SJL mice as described earlier (11), but at the transgenic mouse facility of the University of North Carolina Chapel Hill. Mice were bred and cared for at the Biological Resource Facility of North Carolina State University. Retired breeder ewes were kept at a North Carolina State University farm. Testing mice for the presence of a transgene and measuring luciferase activity in tissues was performed as previously reported (11, 12).
Cell cultures
Primary cells from ewe pituitaries were dispersed and cultured in 24-multiwell tissue culture plates with 200,000 cells per well, as described previously (13). Primary cell cultures from mouse pituitaries were also prepared as described (11, 12) and incubated in 96-well tissue culture plates at 30,000–60,000 cells per well in media 199 plus 10% charcoal-treated sheep serum. Cells were allowed to attach and adjust to culture conditions for at least 1 d before treatment. Purified gonadotropes were obtained from 8-wk-old crossbred male mice hemizygous for wt-oFSHB-H2Kk (14) and mut-oFSHBLuc. Purification was as described (14), except the biotin anti-H-2Kk antibody (BD PharMingen, San Diego, CA) was doubled to increase gonadotrope yield to approximately 16,000 per pituitary (>90% recovery of 95% pure gonadotropes).
Luciferase data in Fig. 5
were obtained from cultures treated on the afternoon of d 2 with or without 250 ng/ml follistatin for 16 h. Media containing follistatin were removed on the morning of d 3, cultures were washed once with fresh media, and then incubated in medium 199 with 1% serum instead of 10% serum (to restrain autocrine/paracrine production of activin) and the following hormones: follistatin (250 ng/ml), activin (50 ng/ml), GnRH (1 nM), or activin plus GnRH. After 6 h, cells were assayed for luciferase activity.
|
Transformed gonadotropes (LßT2 cells) were cultured at 37 C in DMEM (Life Technologies, Inc., Gaithersburg, MD) containing 10% FBS (HyClone Laboratories, Inc., Logan, UT) and plated at a density of 30,000 cells per well in 96-well culture plates. Cells were transfected 24 h later in triplicate or quadruplicate with 50 ng plasmid as described (16). Briefly, 50 ng wild-type or mutant ovine FSHB plasmids were transfected into each well. Cells were also cotransfected with 5 ng/well pRL-TK, a plasmid used to express Renilla as an internal standard for transient expression assays (Promega Corp., Madison, WI). Transfections were performed with Fugene 6 (Roche, Indianapolis, IN) using 165 ng/well. Plasmids and Fugene 6 were incubated in serum-free DMEM for 15 min at RT, and then 50 µl was added to each well. After 24 h, cells were treated with or without 50 ng/ml activin for 22 h and then assayed for luciferase activity.
Induction of transgenes during the reproductive cycle
Female mice (4 months old) were housed in cages containing male bedding for 2 wk before testing to promote estrous activity. Littermates (six to eight) were paired with each other for these studies with equal numbers being assigned to either diestrus or estrus groups; with odd-numbered litters, the extra mouse was assigned to the estrus group. Reproductive stages were determined using an Estrous Cycle Monitor (ECM) (Model EC40; Fine Science Tools, Foster City, CA), followed by cytological inspection of vaginal exfoliative cells as reported earlier (11, 12). Diestrus was characterized by an ECM reading of 2.5–3.5 and a preponderance of small round leukocytes. Estrus was characterized by an ECM reading of 9–11 and the presence of large nucleated cells plus some leukocytes. After determining the reproductive status of each mouse (between 0900 and 1100 h), pituitaries were immediately removed, homogenized, and assayed for luciferase activity and protein content as described earlier (11, 12). Data from littermates were compared to determine "fold-induction at estrus."
Firefly and Renilla luciferase assays
Firefly luciferase was measured to detect expression of the wtLj-oFSHBLuc or mut-oFSHBLuc transgenes in mouse pituitary cultures or mouse tissues. For primary pituitary cultures, cells were lysed in 96-well plates with 50 µl Passive Lysis solution (Promega Corp.), followed by analyzing 35 µl with a Luciferase Assay System (Promega Corp.). Luminescence for data in Table 1
and Fig. 3
was obtained using a Mono-light 2000 as previously reported (11, 12, 16), and data are reported as relative light units (RLUs). LßT2 cells (Figs. 2
, 4
, and 5
) were lysed with 25 µl Passive Lysis Buffer (Promega Corp.), and 10 µl was assayed for luciferase activity using an automated 1420 Victor-Light micro plate luminometer (PerkinElmer, Waltham, MA). The Victor-Light luminometer was five times more sensitive than the Monolight luminometer, but all experiments in this study were done with either one or the other, and no comparisons were necessary between instruments.
|
|
|
1 mg wet weight) and nonpituitary tissue (
30 mg) were homogenized in 100 µl Passive Lysis buffer, and 20 µl of each sample was assayed in duplicate. Protein concentrations were determined using bicinchoninic acid (Pierce Chemical Co., Rockford, IL).
Renilla luciferase expression was used as an internal standard when the activities of mutant ovine FSHßLuc constructs were compared in LßT2 cells. The Renilla construct (pRL-TK; 5 ng/well) was cotransfected with 50 ng/well of ovine FSHßLuc construct (Fig. 2
). Both Firefly and Renilla luciferase activities were sequentially measured in the same samples using the Dual-Luciferase Assay System (Promega Corp.). For the data in Fig. 2
, LßT2 cells in 96-well plates were lysed with 25 µl Passive Lysis solution, followed by analysis of 10 µl lysate.
Quantifying transgene copy number per cell
Transgene copy number was quantified in transgenic mouse lines using real-time PCR performed in an iCycler (Bio-Rad, Inc., Hercules, CA) with TaqMan technology. The luciferase gene was quantified, and 11 luciferase standards were prepared (0.016–17 pg/µl) using our pGL3-based original wild-type ovine FSHBLuc plasmid (10,345 bp) (11). This plasmid was quantified using a Qubit Fluorometer (Invitrogen, Eugene, OR) following their recommended protocol and Quant-iT dsDNA BR assay kit (Invitrogen). Samples were then diluted in distilled water containing 10 µg/ml salmon sperm DNA as carrier (Invitrogen). Two microliters of DNA were assayed per sample starting at 95 C for 3 min, and then for 40 complete cycles (95 C for 30 sec, 55 C for 30 sec, and 72 C for 30 sec). There was a final extension step of 72 C for 3 min. Threshold cycle values were determined with Bio-Rad software and plotted vs. log of plasmid DNA, and ultimately vs. log of copy number based on the amount of chromosomal DNA assayed per sample (20 ng). The standard curve had a threshold cycle axis with values from 19–30 and an x-axis from 0.1–3.0 genomic copies per cell (r2 = 0.999). The forward oligonucleotide was 5'-GAACTGTGTGTGAGAGGTCCTATG-3', the reverse oligonucleotide was 5'-GCTATGTCTCCAGAATGTAGC-3', and the FAM probe was 5'ACCAACGCCTTGATTGACAAG3'. All oligonucleotides were complementary to sequences within the luciferase portion of the transgene.
Statistical analysis
Statistical calculations were performed using Prism version 4 (GraphPad software, Inc., San Diego, CA). The Students t test was used when comparing two means. When more than two means were compared, one-way ANOVA was used with Tukeys multiple comparison test. Data are reported as means ± SEM throughout the paper.
| Results |
|---|
|
|
|---|
14% compared with control) was probably secreted before follistatin became fully effective against activin action.
|
Low expression of mut-oFSHBLuc (construct 3 in Fig. 2
) in transgenic mice
Figure 3
shows the specific activities of luciferase expression in male pituitaries from 10 transgenic mouse lines that expressed mut-oFSHBLuc in a hemizygous manner. Luciferase expression for all founder lines in Fig. 3
(except M248 and M231) averaged 9.0 x 103 ± 3 x 103 RLU/mg protein. Expression for M248 and M231 was 34 x 103 ± 2 x 103 RLU/mg protein and 99 x 103 ± 8 x 103RLU/mg protein, respectively. Because several transgenes can insert into a single chromosomal locus, the number of transgenes present in each cell for each transgenic line was quantified. All mice shown in Fig. 3
contained 12–23 copies of the transgene per cell except M231, which contained 283 copies per cell (data not shown). Two transgenic lines were excluded because they contained
3000 copies of the transgene, although these two lines did not express luciferase significantly differently from the average low expression of 9 x 103 RLU/mg protein.
Pituitary expression of the wild-type transgene, wtLj-oFSHBLuc, was 13,100 x 103 ± 120 x 103 RLU/mg protein, which is nearly 1500 times greater than the average of all mut-oFSHBLuc lines in Fig. 3
, excluding M248 and M231. The wild-type mice expressing wtLj-oFSHBLuc contained only two transgene copies per cell. Finally, it should be noted that even the highest expressing mutant line (M231) did not express mut-oFSHBLuc at a level higher than 0.7% of the wild-type construct, wtLj-oFSHBLuc.
Tissue-specific expression of mut-oFSHBLuc in transgenic mice
Table 1
shows luciferase expression in the pituitaries, livers, gonads (testis and ovaries), and forebrain of mice from four founder lines harboring mut-oFSHBLuc. Luciferase activities were also determined for the spleen and lung in two of these lines (M248 and M157). In essentially all cases, expression of the transgene in nonpituitary tissue was
3% of that found in pituitary tissue, except for the forebrain region, where expression averaged 16% of that found in the pituitary.
Our laboratory previously showed that the wt-oFSHBLuc transgene is expressed almost exclusively in pituitary gonadotropes, which comprise only 3–5% the male mouse pituitary (14). To determine gonadotrope-specific expression of mut-oFSHBLuc, only gonadotropes were isolated from male transgenic mice (M248 line only), and their expression was compared with that of unpurified dispersed pituitary cells in the presence of 50 ng/ml activin (same conditions as for wild-type in Ref. 14). In three independent experiments, the gonadotrope fraction showed 23 ± 3-fold more luciferase activity than unpurified dispersed cells. These data are consistent with gonadotropes containing all the activity for mut-oFSHBLuc. Therefore, specific activities in the pituitary column of Table 1
could be justifiably multiplied by 23-fold to represent only gonadotrope tissue because gonadotropes accounted for only 4.3% (1/23rd) of pituitary tissue on average. Using these new calculations, gonadotrope-specific expression was 644:1 (liver), 805:1 (gonads), 6440:1 (spleen), 2147:1 (lung), and 86:1 (brain) for male mice from the M248 transgenic line.
Expression of mut-oFSHBLuc did not increase at estrus
The data in Fig. 4
show that expression of wtLj-oFSHBLuc was increased at the time of estrus by 3- to 25-fold, with an average value of 10.4 ± 6.8. This widely variant value was similar to that found for 10 of the wild-type constructs previously reported (10.2 ± 2) (11, 12). The data in Fig. 4
show that no increase in expression occurred for mut-oFSHBLuc during estrus compared with diestrus. The mean ratio ± SEM for mut-oFSHBLuc was 0.7 ± 0.2, which indicates no increase in expression at estrus.
Activin did not induce mut-oFSHBLuc in primary pituitary cultures
The data in Fig. 5A
(WT Mouse FSH) are similar to those in Fig. 1
, except that mouse pituitary cultures were used instead of ovine pituitary cultures. Follistatin (250 ng/ml) decreased FSH secretion by an average of 71%, indicating that follistatin-sensitive factors, presumably activins, were stimulating the majority of endogenous FSH expression/secretion in mouse pituitary cultures. FSH was measured by RIA. Data in Fig. 5B
(WT-Luc) show similar inhibition by follistatin of the wtLj-oFSHBLuc transgene, which is known to be induced by activin and inhibited by follistatin. Data in Fig. 5
, C and D, show relatively low expression of mut-oFSHBLuc in pituitary cultures from M231 or M248 transgenic mouse lines. Expression was not inhibited by follistatin, suggesting that they are not induced by activin.
Finally, the data in Fig. 5
, C and D, show that neither activin A nor GnRH individually induced expression of mut-oFSHBLuc in primary pituitary cultures previously treated with follistatin for 16 h (i.e. deprived of activin-like paracrine stimulation). The combined effects of both activin and GnRH significantly increased expression of mut-oFSHBLuc by approximately 90% within the 6-h treatment period.
| Discussion |
|---|
|
|
|---|
Figure 1
of this study reinforces the aforementioned concept, especially for sheep because follistatin (225 or 675 ng/ml) suppressed FSH expression by 95 or 99%, respectively, in primary ewe pituitary cultures. It was considered important to show this level of inhibition for ovine FSH because it was the ovine FSHB gene studied here. It is not fully known what factors are produced in static cultures of mixed pituitary cells to stimulate expression of FSH, but evidence suggests that highly potent activin B (2) and less potent bone morphogenetic proteins (16) are made in gonadotropes to induce FSH in an autocrine manner. A recent report indicates that activin A and bone morphogenetic protein 2 can synergistically stimulate FSHB transcription (18). Stimulation from autocrine sources implies that high levels of follistatin would be necessary to rapidly intercept autocrine inducers just as they leave the plasma membrane to bind their cognate receptors. These high levels of follistatin can only be achieved in vitro. In this study high levels of follistatin were used to inactivate activins or other TGFß family members, which blocked 99% FSH expression in primary ewe pituitary cultures.
It could be argued that such supraphysiological levels of follistatin inhibit FSH expression through a nonspecific toxic mechanism. However, there are no reports showing that follistatin at 250 ng/ml is toxic to gonadotropes, and this concentration has been used routinely to block FSH expression in LßT2 cells (19). Furthermore, follistatin produced a normal saturation-type inhibition curve (IC50 =
20 ng/ml; Fig. 1
). The dose-response curve for follistatin-mediated inhibition that was constructed from Fig. 1
(data not shown) contained no discontinuities to suggest the presence of nonspecific toxic effects. In addition, we showed that the effects of all concentrations of follistatin were fully reversed within 24 h after follistatin withdrawal. Nevertheless, all levels of follistatin used in this study were supraphysiological, and it is possible that some effects were due to rapidly reversible toxicity.
The data in Fig. 3
show that changing four nucleotides in 4741 bp of the ovine FSHB promoter decreased luciferase expression in vivo to an average of 9 x 103 RLU/mg protein from 13,100 x 103 RLU/mg protein for wtLj-oFSHBLuc. In addition, low expression of the mutant transgene should be compared with previously reported data from 10 wild-type transgenes (16,100 x 103 RLU/mg protein) (11, 12). Therefore, this small mutation caused a 99.93% reduction in luciferase expression. Because this mutation caused no change in basal expression of mut-oFSHBLuc in LßT2 cells (Fig. 2
), there was no evidence to link any of this decrease to a change in basal expression, which suggested that the entire decrease was due to a complete and absolute withdrawal of activin like stimulation. These data are consistent with the results shown in Fig. 1
, in which follistatin inhibited culture-mediated induction of FSH by 95–99%.
The almost absolute blockade of FSHB expression caused by mutating the –169 to –165-bp site seems so large, however, that it raises a question about this site being involved in basal expression as well as activin induction. It could even be possible that the mutation itself created an inhibitory site on the FSHB promoter that artificially decreased expression. However, the Consite computer program (7) did not associate any protein (activator or inhibitor) with the mutated site. Furthermore, Runt or forkhead family members have never been associated with basal expression before. Nevertheless, it is possible that this particular site participates in both basal and activin-stimulated FSHB expression. This could explain the inhibition caused by Smad3 small interfering RNAs at both basal and activin-induced levels at the putative SBE site (20). An analysis of the proteins that bind this sequence and the putative SBE site juxtaposed to it will be needed to reveal the full nature and importance of these sites.
Mutating sequences from –169 to –165 bp (the putative Runx1 binding site) prevented mut-oFSHBLuc from being induced during the estrous surge. This induction during estrus was observed for wtLj-oFSHBLuc and all other wild-type transgenes studied to date in our laboratory (11, 12). For example, the increase in luciferase activity at estrus for wtLj-oFSHBLuc was 10 ± 7-fold (range 3–24), which was similar to that previously reported for seven similar wild-type transgenic lines (10 ± 2-fold increase with a range from 3–19). This increase mimicked that of endogenous mouse FSH (21, 22, 23), which is associated with the recruitment of follicles for development during subsequent reproductive cycles (24, 25). Studies in rats have concluded that activin B drives this FSH surge at estrus (26, 27, 28). If mutating the putative Runx1site destroyed basal expression of FSHB, the data in Fig. 4
simply reflect the fact that induction cannot occur in a gene that is transcriptionally inactive. However, if basal expression remained unchanged, the data presented here support the idea that activin, working through the –169 to –165 bp site, helps create the secondary FSH surge.
The putative Runx1 binding site was discovered experimentally while studying deletion and point mutants of ovine FSHBLuc constructs in LßT2 cells (Fig. 2
). Computer analysis of transcription binding sites, an imprecise science still in its infancy, identified the region from –171 to –163 bp as a likely Runx1 binding site (81%; score = 6.0) (7). This was useful information because Runx1 is known to interact specifically and strongly with Smad3 to promote the proper growth and differentiation of hematopoietic cells (8). This linkage suggested that ovine FSHB might be induced by activin working through a similar complex containing a Runt family member plus Smad3. Furthermore, the putative Runx1 binding site is highly conserved for sheep, human, pig, buffalo, and cow (29). There is one nucleotide change in the pig FSHB promoter, but this natural mutation creates an even better Runx1 binding site according to the Consite analysis.
Interestingly, the single mutation in the pig FSHB promoter also creates a putative binding site for FREAC-4, a forkhead protein that may also interact with Smads, although this has not been proven for this particular forkhead protein at this specific site. Another interesting finding is that mutating GC to TA at positions –168 and –167 bp created a putative forkhead-1 binding site. This construct significantly increased responsiveness to activin (48-fold induction), while barely altering basal expression in LßT2 cells (Su, P., unpublished data). In addition, a single mutation from T to C at position –164 bp created a palindromic Smad binding site that permitted activin to induce this construct 38-fold in LßT2 cells, but basal expression was increased approximately 20-fold (Su, P., unpublished data). Therefore, depending on the nature of DNA sequences and protein factors surrounding the putative Runx1/SBE binding sites, this promoter region might accommodate several forkhead-related proteins known to interact with Smads and might even act as a palindromic SBE element like the one found in rodent promoters for FSHB at –266 bp (29). As noted previously, further analysis of the proteins that bind this region will be required to determine the true nature of transcription factor interactions that help drive activin-mediated induction, and possibly basal expression, of the ovine FSHB gene.
It might appear that identifying the transcription factors that bind to sequences between –171 and –158 bp on the ovine FSHB promoter would be relatively easy using EMSAs, but this perception would be incorrect. No laboratory has yet demonstrated activin-induced binding of any protein to either the putative SBE or its adjacent site identified here. The entire 24-h time course of activin induction has been analyzed without success (data from our laboratory). There is one report of a protein-DNA complex with this promoter region, but this interaction was not induced by activin (5). Nevertheless, the in vitro and in vivo data in this report about the putative Runx1 binding site plus data from others (SBE site) indicate that the ovine FSHB promoter region from –171 to –158 bp is critical for FSHB expression in sheep and presumably in humans and other mammals that contain this highly conserved promoter sequence.
Cell-specific expression is important for every gene. It is possible in many cases for proximal enhancers to play a significant role in cell-specific expression and that appears to be partly true for the putative Runx1 site. Pituitary specific expression for mut-oFSHBLuc appears to be 66% less than for wt-oFSHBLuc (11) or wtLj-oFSHBLuc. Expression of wt-oFSHBLuc (11) or wtLj-oFSHBLuc (unpublished data from our laboratory) is less than 1% pituitary expression in the liver, gonads, spleen, or lung, but expression of mut-oFSHBLuc was approximately 3% pituitary expression in the liver and gonads; however, expression in the spleen and lung were still
1% compared with pituitary expression. For the liver and gonads this represents a 66% decline in gonadotrope-specific expression suggesting that the putative Runx1 site has some effect on cell-specific expression. Nevertheless, data from purified gonadotropes expressing mut-oFSHBLuc show that gonadotrope-specific expression is still favored 644:1 (see Results) when comparing gonadotrope expression to expression in either the liver or gonads. Pituitary specific expression is even higher when considering the spleen (6440:1) or lung (2147:1). Expression of ovine FSHBLuc constructs in brain tissue is another matter entirely. The original wild-type construct (wt-oFSHBLuc) was often expressed in brain tissue at high levels (pituitary-brain = 100:1, 100:30 100:270) (11). The mutant transgene, mut-oFSHBLuc, was also expressed at significant levels in the brain (pituitary-brain = 100:8 or 100:22). In this regard, expression of mut-oFSHBLuc appeared even more specific compared with the original wild-type transgenes with regard to brain tissue. These data comparing pituitary and brain expression are difficult to comprehend and have not been helpful in understanding cell-specific expression of the ovine FSHB gene. The overall results indicate that the putative Runx1 site has some influence over gonadotrope-specific expression, at least in the liver and gonads, but it seems to play only a minor role overall.
Finally, GnRH and activin often interact at a molecular level to alter FSHB expression, but these interactions are not well understood. Our laboratory previously reported that isolating primary gonadotropes from activin for 17 h (follistatin treatment) permits subsequent treatment with activin and GnRH to synergistically induce wt-oFSHBLuc during a 4-h period (12). Moreover, recent studies with the mouse FSHB promoter show that GnRH and activin can cooperate synergistically when critical AP-1 and Smad binding sites are multimerized (30).
The data in Fig. 5
show that GnRH and activin can synergistically increase expression of mut-oFSHBLuc, but this occurred in a construct that lacked the putative Runx1 site and was, presumably, incapable of responding to activin directly (Figs. 2–4![]()
![]()
). These data suggest that GnRH and activin cooperated either through the one remaining Smad binding site or in a general way that did not involve specific interactions on the ovine FSHB promoter. Recent evidence indicates that activin dramatically alters the responsiveness of LßT2 gonadotropes to GnRH in a global sense (31), so it is possible that global effects of GnRH and activin caused the synergistic induction of mut-oFSHBLuc shown in Fig. 5
. These data are not meant to imply that activin and GnRH do not cooperate with each other through signaling pathways that complement each other directly at the ovine FSHB promoter, but it does indicate there are ways for activin and GnRH to cooperate through global actions in gonadotropes.
In summary, this study presents data that are consistent with the concept that 99.9% of ovine FSHB expression in vivo depends on sequences between –171 and –165 bp on the promoter of ovine FSHB promoter/reporter gene mutants in LßT2 gonadotropes. It is shown here that this element was essential in vivo and was required for the estrous surge of FSH in mice. It seems to have had little effect on pituitary specific expression. Finally, it was shown that activin and GnRH cooperatively increased FSHB expression, even in the absence of a functional activin response element on the ovine FSHB promoter.
| Acknowledgments |
|---|
| Footnotes |
|---|
Disclosure Statement: The authors have nothing to declare.
First Published Online June 21, 2007
Abbreviations: ECM, Estrous Cycle Monitor; FSHB, FSH ß-subunit; RLU, relative light unit; SBE, Smad binding element.
Received December 8, 2006.
Accepted for publication June 1, 2007.
| References |
|---|
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |