help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2007-0774
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takahashi, N.
Right arrow Articles by Ishizuka, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takahashi, N.
Right arrow Articles by Ishizuka, B.
Endocrinology Vol. 149, No. 1 253-260
Copyright © 2008 by The Endocrine Society

Human Chorionic Gonadotropin Induces Nestin Expression in Endothelial Cells of the Ovary via Vascular Endothelial Growth Factor Signaling

Noriyuki Takahashi, Masanori T. Itoh and Bunpei Ishizuka

Departments of Obstetrics and Gynecology (N.T., B.I.) and Anatomy (M.T.I.), St. Marianna University School of Medicine, Sugao, Miyamae-ku, Kawasaki 216-8511, Japan

Address all correspondence and requests for reprints to: Noriyuki Takahashi, Ph.D. Department of Obstetrics and Gynecology, St. Marianna University School of Medicine, Sugao, Miyamae-ku, Kawasaki 216-8511, Japan. E-mail: n-tkhs{at}marianna-u.ac.jp.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The intermediate filament protein nestin was originally found to be expressed in neuronal progenitor cells, but recent studies have shown that other cell types, including endocrine and vascular endothelial cells, express nestin. In the present study, we examined the expression and localization of nestin in the ovaries of developing, peripubertal, and adult rats. RT-PCR and Western blot analyses revealed that nestin mRNA and proteins were expressed in adult rat ovaries. Immunohistochemical analyses using adult rat ovaries showed that nestin was mainly localized to capillary endothelial cells of theca interna in follicles with more than two layers of granulosa cells and that its expression increased with follicle growth. Ontogenetically, ovarian nestin expression started at the peripubertal period when the first gonadotropin surge occurs. To test the possibility that gonadotropins induce nestin expression, prepubertal (postnatal d 21) rats were sc injected with equine chorionic gonadotropin (eCG) and/or human chorionic gonadotropin (hCG). A single injection of hCG, but not eCG, was sufficient to induce nestin expression in follicles, mainly in capillary endothelial cells of theca interna. Furthermore, pretreatment with an inhibitor of vascular endothelial growth factor receptor prevented the induction of the nestin expression by hCG. These findings demonstrate that the endogenous LH surge induces nestin expression in capillary endothelial cells of theca interna via the vascular endothelial growth factor signaling pathway. Nestin may be involved in angiogenesis in growing follicles, which is followed by follicle maturation and subsequent ovulation.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
NESTIN IS A CLASS VI intermediate filament protein and is predominantly expressed in neural and muscle stem/progenitor cells (1, 2, 3, 4). Recent studies have shown that nestin is expressed in other cell types throughout the lifetime of the organism (5); its expression is detected in progenitors of endocrine cells in the pancreas (6, 7, 8) and testis (9, 10, 11) as well as in endothelial cells of blood vessels (12, 13, 14). In testis, nestin is expressed in pericytes and vascular smooth muscle cells around seminiferous tubules, progenitors of Leydig cells (10), Sertoli cells of developing embryo (9), and testicular neoplasia and tumors (11).

Although nestin expression has been demonstrated in the endothelial cells of blood vessels intruding among granulosa-luteal cells of the ovary (15), little is known about the expression of nestin in the ovary. Considering the sites of expression in the testis, nestin may be expressed in other ovarian sites such as thecal and interstitial cells, which produce androgens. Furthermore, the factors and mechanisms controlling nestin expression remain unknown. Therefore, in the present study, we examined the expression and localization of nestin in the rat ovary. Our results revealed that nestin was mainly expressed in capillary endothelial cells of theca interna in follicles with more than two layers of granulosa cells and that the nestin expression ontogenetically started at the peripubertal period. Furthermore, we found that human chorionic gonadotropin (hCG), but not equine chorionic gonadotropin (eCG), induced the ovarian expression of nestin via the vascular endothelial growth factor (VEGF) signaling pathway.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Chemicals
All chemicals used in experiments were purchased from Sigma Chemical Co. (St. Louis, MO) or from Kanto Pure Chemical Industries (Tokyo, Japan), unless otherwise noted.

Animals
Female Wistar-Imamichi rats were used in the following four ontogenetic stages: embryonic d 19 (E19; n = 8 from three different mothers), postnatal d 21 (P21) as prepuberty (40.4 ± 0.97 g body weight, mean ± SEM, n = 12), onset of puberty as indicated by vaginal opening (P29; 79.8 ± 1.56 g, n = 8), and adult (10–12 wk old, 250.5 ± 3.3 g, n = 16). The stage of the estrous cycle was determined in the adult rats by the vaginal cytology. Tissues were dissected immediately after decapitation of the animals. For RT-PCR and Western blot analyses, the tissues were stored at –80 C. The testes and brains were used as positive controls. For histological analyses, ovaries were embedded in paraffin or Tissue-Tek OCT compound (Sakura Finetek, Tokyo, Japan), and 6-µm serial sections were prepared.

To examine the effect of gonadotropins on ovarian nestin expression, P21 animals (n = 5 per group) were sc injected with 1) saline, 2) 10 IU eCG followed 48 h later with 10 IU hCG, 3) 10 or 20 IU hCG only, or 4) 10 IU eCG only. At 5 or 48 h after the final injection, the rats were decapitated, and the ovaries were excised and processed for immunohistochemical analyses. In addition, P21 female rats (n = 5 per group) were sc injected daily for three consecutive days with SU5416 or MAZ51 (1 or 10 mg/kg body weight·d). SU5416 is an inhibitor of VEGF receptor (VEGFR) 1 and 2 (16, 17), and MAZ51 is an inhibitor of VEGFR 3 (18). At 0, 2, or 4 d after the final injection of SU5416 or MAZ51, 10 IU hCG was administered. At 5 h after hCG injection, the ovaries were sampled and processed for immunohistochemical analyses. All experimental protocols were approved by the St. Marianna University School of Medicine Animal Care and Use Committee.

RT-PCR
Total RNAs (1 µg) obtained from each tissue were reverse-transcribed with an oligo-dT primer, and a partial sequence for nestin gene (GenBank accession no. NM 012987) was amplified using an RNA PCR kit (TaKaRa, Shiga, Japan) with primers 5'-4802TTTGAGGACCTAGGGACTGAGGC4824-3' (sense) and 5'-5159CCAGAAGGCTCAGCACTGTCCTG5181-3' (antisense). To check the integrity of the RNA from each sample, RT-PCR was performed using the following primers for β-actin (GenBank accession no. NM 031144): sense, 5'-103GACAACGGTCCGGCATGTGCCA124-3', and antisense, 5'-268TCAGGATGCCTCTCTTGCTCTG247-3'. The PCR products were separated by electrophoresis on an agarose gel containing ethidium bromide and then detected by UV irradiation. Thereafter, the products were purified and subcloned into pT7 blue-T vector (Novagen, Madison, WI) for sequencing analysis.

Western blotting
Tissues were homogenized in PBS and then centrifuged. Proteins in the supernatant were precipitated by adding trichloroacetic acid. Proteins (50 µg) were resolved by SDS-PAGE. Proteins on the gel were electroblotted onto a polyvinylidene difluoride membrane using a semi-dry apparatus. The membrane was incubated overnight at room temperature with a mouse monoclonal antibody raised against rat nestin, clone Rat-401 (BD Pharmingen, Erembodegen, Belgium) at a dilution of 1:1000 with PBS. The immunoreactive proteins were then detected using alkaline phosphatase-conjugated antibody against mouse IgG (Chemicon, Temecula, CA).

In situ hybridization
Ovarian sections were soaked in 0.2 M triethanolamine with gradually added acetic anhydride (final 0.5%) for acetylation. Then the sections were prehybridized with 50% formamide in SSC (150 mM sodium chloride and 15 mM sodium citrate, pH 7.0) at 45 C for 30 min. PCR product generated by RT-PCR was purified and used as a template DNA for further amplification of the region containing site-directed promoter sequences in 5'- and 3'-termini. The primer sequences used in the PCR were as follows: T7-nestin sense, 5'-TAATACGACTCACTATAGGGTTTGAGGACCTAGGGACTGAGGC-3', and T3-nestin antisense, 5'-AATTAACCCTCACTAAAGGGCCAGAAGGCTCAGCACTGTCCTG-3'. Fluorescein-labeled cRNA probes were obtained using a DIG Northern Starter Kit and Fluorescein RNA Labeling Mix (Roche, Mannheim, Germany). Sections were hybridized overnight at 45 C with RNA probes dissolved in hybridization solution [1x Denhardt’s solution, 10% dextran sulfate, 50% formamide, 10 mM Tris-HCl (pH 7.6), 600 mM NaCl, 1 mM EDTA, 0.25% SDS, and 200 µg/ml herring sperm DNA]. After washing, the sections were immunostained with antinestin antibody (see Immunohistochemistry below), mounted with ProLong Gold antifade reagent with 4',6-diamidino-2-phenylindole (Invitrogen, Carlsbad, CA), and viewed using a Zeiss LSM510 confocal microscope.

Immunohistochemistry
Ovarian sections were incubated overnight at room temperature with antinestin antibody (1:1000 at dilution), and the immunoreactivities were detected by development of 3,3'-diaminobenzidine using a Histofine Simple stain rat MAX-PO kit (Nichirei, Tokyo, Japan), followed by counterstaining with Mayer’s hematoxylin or hematoxylin-polychrome EA-50. To examine the characteristics of nestin-positive cells, double-immunofluorescence staining was performed using antinestin antibody and antibodies against cytochrome P450 side-chain cleavage enzyme type 11A1 (P450scc; Fitzgerald, Concord, MA; 1:200), β-tubulin type 3 (TUBB3; Chemicon; 1:200), smooth muscle cell marker {alpha}-actin (SMA; Abcam, Cambridge, UK; 1:500), or endothelial cell marker CD31 (Chemicon; 1:50). Alexa 488 antimouse IgG and Alexa 594 antirabbit IgG (Invitrogen; 1:400 in both) were used as secondary antibodies. Nuclei were counterstained with bisbenzimide Hoechst 33258 (0.5 µg/ml in PBS). No staining was apparent when the primary antibodies were omitted. The developmental stages of the follicles were determined as described previously (19).

Follicle count
Follicle count was made as described previously (20). One ovary was obtained from each animal. Nestin-positive or -negative follicles were counted in the 10th, 30th, and 50th sections (intervals of approximately 500 µm) from each serially sectioned ovary. Only preantral and antral follicles (stage ≥ 3) with more than two layers of granulosa cells were counted because smaller primordial and primary follicles were nestin-negative. Based on the cumulative counts for each ovary, the ratio of nestin-immunopositive follicles was determined. The data are expressed as mean ± SEM. Differences between the groups were analyzed by a nonparametric ANOVA (Kruskal-Wallis H test) followed by Dunn’s post hoc comparison using the Statview program (SAS Institute Inc., Cary, NC).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Nestin is expressed in theca interna of the adult rat ovary
In the ovary of adult rats, nestin mRNA was detected by RT-PCR (Fig. 1AGo). Nestin mRNA was also detected in the testis and brain, which were used as positive controls. RT-PCR analysis of the different components of the ovary revealed that nestin mRNA was present in the thecal and interstitial region and corpora lutea but not in the granulosa cell layers (Fig. 1BGo). Western blot analysis showed that major immunopositive bands with molecular masses of approximately 220, 170, and 90 kDa and less were detected in the ovary as well as testis and brain (Fig. 1CGo). In situ hybridization further showed that nestin mRNA was mainly expressed in theca interna of follicles of adult rat ovary (Fig. 1Go, D and F), where nestin protein was also detected (Fig. 1Go, E and F).


Figure 1
View larger version (41K):
[in this window]
[in a new window]

  		FIG. 1. Nestin mRNA and protein are expressed in theca interna of the adult rat ovary. A, RT-PCR for whole tissues from a 10-wk-old female rat in proestrus or a male rat. B, Brain; C, procedural control in which RT was omitted; O, ovary; T, testis. Single bands for nestin (380 bp, upper panel) and β-actin (166 bp, lower panel) were amplified in these tissues. B, RT-PCR for ovarian components. Granulosa cell layers (G), thecal and interstitial region (T/I), and corpora lutea (CL) were separated from ovary of a 10-wk-old female rat in proestrus. Single bands for nestin were amplified in the thecal and interstitial region and corpora lutea but not in the granulosa cell layers. C, Western blotting. The mobilities of the molecular size standards are shown on right. B, Brain; O, ovary; T, testis. Tissues were obtained from a 10-wk-old female rat in diestrus or a male rat. The antinestin antibody recognized proteins with molecular masses of approximately 220, 170, and 90 kDa and less in the ovary as well as in the testis and brain. D and E, In situ hybridization (D) and immunohistochemistry (E) in an identical ovarian section from a 10-wk-old female rat in proestrus. F, A merged view of D and E with nuclei stained by 4',6-diamidino-2-phenylindole (blue). Micrographs show granulosa cell layers (G) and theca interna (TI) of a small antral follicle. Nestin mRNA (green) and protein (red) were detected in theca interna but not in the granulosa cell layers. Objective magnification, x40. Results presented in A–C are representative of three independent experiments. Images shown in D–F are representative of results from five adult female rats.

 
Endothelial cells of blood vessels are the main sites of nestin expression in the adult rat ovary
We further examined the localization of nestin in the adult rat ovaries by immunohistochemistry. Nestin was mainly detected in the inner part of theca interna of growing follicles (stage ≥ 3) with more than two layers of granulosa cells (Fig. 2Go, A–E). In particular, nestin was localized in the microvasculature of theca interna. However, primordial (stage 1) and small primary (stage 2) follicles, which lack a thecal cell layer, were negative for nestin (Fig. 2AGo). As follicles grew, the number of nestin-expressing cells in theca interna increased, and these cells were stained more intensely (Fig. 2Go, A–C). In large antral follicles just before ovulation, capillary cells that intruded into the granulosa cell layers were strongly immunopositive for nestin (Fig. 2EGo). Nestin was also detected in the microvasculature of corpora lutea (Fig. 2Go, F and G) as reported previously (15).


Figure 2
View larger version (103K):
[in this window]
[in a new window]

  		FIG. 2. Nestin expression in ovarian follicles of the adult rat increases progressively throughout folliculogenesis. A–E, Nestin immunoreactivity was undetectable in primordial (stage 1) and primary (stage 2) follicles (arrowhead and arrow, respectively), whereas its immunoreactivity was detected in theca interna of follicles (stage ≥ 3) with more than two layers of granulosa cells. As shown in C, dense immunoreactivity for nestin was detected in theca interna of the antral follicle. D, A magnified image of the granulosa and thecal cell layers in C. Most of the nestin-positive signals (dark brown) were adjacent to erythrocytes (magenta). E, Nestin-expressing cells intruded into the granulosa cell layers in preovulatory large antral follicle. G, Granulosa cell layers; TI, theca interna. F, Nestin immunoreactivity in corpus luteum was scattered. G, Higher magnification of F. In A, B, and E, sections were counterstained with Mayer’s hematoxylin. In C, D, F, and G, sections were counterstained with hematoxylin and polychrome EA50. Bars, 100 µm. Images are representative of the results from 16 adult (10 wk old) rats.

 
As described above, we found that the inner part of theca interna, which localizes just outside of basal lamina, expresses nestin. Theca interna is known to contain steroidogenic cells (21). To determine whether the nestin-positive cells are steroidogenic, the ovarian sections obtained from the adult rats were double immunostained for nestin and P450scc. P450scc catalyzes the first step in the steroidogenic pathway and is the rate-limiting enzyme in steroidogenesis in the thecal and interstitial cells of ovary (22). The immunoreactivities of nestin and P450scc did not overlap (Fig. 3Go, A–C), indicating that nestin-positive cells in the ovary are not steroidogenic. Furthermore, to determine whether the nestin-positive cells are neurons, we performed immunohistochemical analysis for TUBB3, a neuronal marker (23, 24). The anti-TUBB3 antibody specifically immunostained axons in the interstitial region of the ovary, but they were different from the nestin-immunopositive cells (data not shown). This result confirmed that nestin-positive cells in the ovary were not neurons.


Figure 3
View larger version (40K):
[in this window]
[in a new window]

  		FIG. 3. Endothelial cells of blood vessels are the main sites of nestin expression in the adult rat ovary. A–C, Double immunostaining for nestin and P450scc. In the thecal region of antral follicle, nestin (green fluorescence) and P450scc (red) were detected. However, as shown in C, which is a merged view of A and B, the signals did not overlap. D–F, Double immunostaining for nestin and CD31. A merged view of D and E is shown in F. In theca interna, nestin (green) and CD31 (red) were colocalized in identical cells. G–I, Double immunostaining for nestin and SMA. A merged view of G and H is shown in I. In the artery of theca interna, nestin (green) and SMA (red) immunoreactivities did not overlap; specifically, nestin was located in a more inner part of artery. In C, F, and I, nuclei were counterstained with Hoechst 33258 (blue). Objective magnification, x20 (A–C) and x40 (D–I). Images are representative of the results obtained from 16 adult (10 wk old) rats.

 
Nestin was localized in the microvasculature of theca interna. The localization of nestin suggests that it is expressed in endothelial cells of blood vessels. However, we cannot rule out the possibility that vascular smooth muscle cells may express nestin. To test whether nestin is expressed in vascular endothelial cells or vascular smooth muscle cells, ovaries were double immunostained for nestin and the endothelial cell marker CD31 (25) or the smooth muscle cell marker SMA (26). As shown in Fig. 3Go, D–F, nestin and CD31 colocalized in the same cells, whereas the signals for nestin and SMA did not overlap (Fig. 3Go, G–I); nestin immunoreactivity was located in a more inner part of blood vessels than SMA. Thus, these results confirmed that vascular endothelial cells, but not vascular smooth muscle cells, expressed nestin.

hCG induces the expression of nestin in vascular endothelial cells of theca interna via the VEGF signaling pathway
To determine the developmental stage when the ovarian nestin expression starts, we performed immunohistochemical analysis on ovarian sections from E19, P21, and P29 rats. Nestin was not detected in the ovaries from E19 and P21 rats (Fig. 4Go, A and B), although growing follicles with more than two layers of granulosa cells were observed in the ovaries of P21 rats (Fig. 4BGo). In contrast, nestin was clearly detected in theca interna of follicles with multiple layers of granulosa cells at the onset of puberty (P29) (Fig. 4CGo). It is known that the first gonadotropin surge occurs at peripuberty (27). Thus, we investigated the effect of gonadotropins on ovarian nestin expression in prepubertal female rats. The combination of 10 IU eCG and 10 IU hCG injections increased nestin expression in endothelial cells of theca interna (Fig. 5AGo and Table 1Go). A single injection of 10 IU hCG also induced nestin expression within 5 h (Fig. 5BGo and Table 1Go). Furthermore, administration of 20 IU hCG caused a large increase in nestin expression (Fig. 5CGo). A single injection of eCG, in contrast, did not induce ovarian nestin expression, but it did induce follicular growth (Fig. 5DGo and Table 1Go). These results show that hCG induces nestin expression in vascular endothelial cells of theca interna. It has been suggested that hCG promotes angiogenesis in the ovary (28). Nestin has been also suggested to participate in angiogenesis in several tissues such as the brain and pancreas (12, 13). Furthermore, VEGF enhances vascular development in the ovary (29, 30). Thus, we next investigated the possibility that hCG induces nestin expression in vascular endothelial cells of theca interna via the VEGF signaling pathway. Prepubertal (P21) female rats were injected daily for 3 d with inhibitors of VEGFRs, SU5416 or MAZ51, followed with hCG. The enhancement of nestin expression in the ovaries by hCG was interrupted by injections of 1 or 10 mg/kg body weight·d SU5416 (Fig. 6BGo and Table 1Go). This effect was observed 0, 2, and 4 d after the final injection of SU5416. On the other hand, treatment with MAZ51 seemed to enhance rather than prevent hCG induction of nestin expression (Fig. 6CGo).


Figure 4
View larger version (88K):
[in this window]
[in a new window]

  		FIG. 4. Ovarian nestin expression begins in the peripubertal period. Immunohistochemistry for nestin was performed on ovarian sections obtained from E19 (A), P21 (B), and P29 (C) rats (n = 8 or 12 per group). Nestin was not detected in the ovaries at E19 and P21, whereas at the onset of puberty (P29), nestin was detected in theca interna. Bars, 100 µm.

 

Figure 5
View larger version (148K):
[in this window]
[in a new window]

  		FIG. 5. hCG induces nestin expression in theca interna. P21 female rats (n = 5 per group) were injected with eCG and/or hCG. The ovarian sections were immunostained for nestin. A, Combined injections of 10 IU eCG and 10 IU hCG induced nestin expression in theca interna; B, a single injection of 10 IU hCG also induced the nestin expression at 5 h; C, injection of 20 IU hCG enhanced nestin expression; D, a single injection of 10 IU eCG promoted the formation of antral follicle, but nestin was not detected. Bars, 100 µm.

 

View this table:
[in this window]
[in a new window]

  		TABLE 1. The effects of gonadotropin and VEGFR inhibitor treatments on nestin expression in ovarian follicles

 

Figure 6
View larger version (91K):
[in this window]
[in a new window]

  		FIG. 6. Pretreatment with an inhibitor for VEGFR 1 and 2 prevents hCG induction of nestin expression in the ovary. P21 female rats (n = 5 per group) were daily injected for 3 d with 10 mg/kg body weight·d VEGFR inhibitor (SU5416 or MAZ51) or with vehicle only. Shortly after the final injection of SU5416 or MAZ51, 10 IU hCG was administered. The ovaries were sampled 5 h after injection of hCG. A, hCG induced ovarian nestin expression; B, pretreatment with SU5416 completely abolished hCG induction of ovarian nestin expression; C, MAZ51 seemed to enhance rather than inhibit nestin expression. Bars, 100 µm.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The intermediate filament protein nestin was originally identified as a marker for neural progenitor cells during the early developmental stages of the central nervous system (1, 2, 3). It was meanwhile demonstrated that nestin is also expressed in tissues outside the central nervous system (4, 6, 7, 8, 9, 10, 11, 12, 13, 14) and in adult organisms during the regeneration of injured tissue (31, 32). The present study revealed that the ovaries of adult rats expressed nestin. Western blotting revealed nestin proteins with several molecular masses in the ovaries as well as in the testes and brains. It has been reported that, of the full-length nestin proteins, the molecular mass of the glycosylated form is 240 kDa and that of the deglycosylated form is 220 and 200 kDa (33, 34). Proteins of lower molecular masses, which were detected by Western blotting for nestin, probably represent fragmented ones, as reported previously (33, 34). Additionally, in situ hybridization and immunohistochemistry revealed that nestin mRNA and protein were localized to an identical region in theca interna of ovarian follicles, supporting that the antinestin antibody used in this study specifically recognizes nestin proteins.

In the adult ovaries, nestin was found in follicles with more than two layers of granulosa cells and was mainly localized to vascular endothelial cells but was not found in steroidogenic cells, neurons, and vascular smooth muscle cells. Similarly, nestin is known to be expressed in vascular endothelial cells of the brain and pancreas (12, 13, 14). It has been suggested that nestin is a marker for angiogenesis, because endothelial cells from newly formed blood capillaries express nestin (15).

In the present study, nestin could not be detected in the ovaries of prepubertal rats, whereas it was detected in the ovaries of adult rats. Thus, ovarian expression of nestin begins in the peripubertal period. A single injection of hCG, which is known to show the effects of LH, into prepubertal female rats induced nestin expression in vascular endothelial cells of theca interna, whereas injection of eCG, which is known to show the effects of FSH, did not affect ovarian nestin expression. During peripuberty, the endogenous LH surge occurs first (27). Therefore, our results demonstrate that the endogenous LH surge, which starts to occur ontogenetically at peripuberty, induces nestin expression in capillary endothelial cells of theca interna.

We found that pretreatment with the VEGFR inhibitor SU5416, but not MAZ51, prevented the enhancement of nestin expression by hCG in vascular endothelial cells of theca interna. SU5416 is an inhibitor for VEGFR 1 and 2 (16, 17), and MAZ51 is an inhibitor for VEGFR 3 (18). The present results demonstrate that VEGFR 1 and/or 2 are involved in nestin induction in vascular endothelial cells of theca interna. VEGF enhances vascular development in ovarian follicles (29, 30). In addition, the previous reports indicated that oocytes are the main sites of VEGF expression in the ovary (35, 36) and suggested that oocytes may express LH/CG receptors (37). We therefore assume that LH stimulates the release of VEGF from oocytes, which leads to nestin expression via activation of VEGFR 1 and/or 2 in vascular endothelial cells of theca interna. However, it is unknown whether VEGF up-regulates the nestin expression in vascular endothelial cells. More studies are needed to elucidate the mechanism by which nestin expression is induced.

The physiological significance of nestin in the ovary remains unknown. Nestin is an intermediate filament protein and is expressed during early developmental stages and during regeneration in several tissues such as the brain, pancreas, and testis. This suggests that nestin is necessary in cells with proliferative activity or in cells that are in a dynamic developmental phase, both of which require a high degree of cytoplasmic plasticity (5, 38). In the present study, we found that nestin was mainly expressed in vascular endothelial cells of theca interna and that nestin expression increased with follicular growth. Just before ovulation, capillaries intruded into the granulosa cell layers of the large antral follicles, and endothelial cells of these newly formed capillaries expressed nestin. hCG has been suggested to promote angiogenesis in the ovary (28), and angiogenesis in the ovarian follicles is necessary for ovulation (39). Therefore, nestin may be involved in angiogenesis in the follicle, which is followed by ovulation.

The ovary in adult animals generally undergoes the dynamic histological changes in response to various factors, including LH, as observed in follicular growth and ovulation (40). Unlike other tissues, the expression of nestin was up-regulated in the ovary of adult animals. The induction of ovarian nestin expression by hCG could participate in the dynamic histological changes in the adult ovary.

In summary, we found that the intermediate filament protein nestin is mainly expressed in capillary endothelial cells of theca interna in growing follicles and that the expression of nestin begins in the peripubertal period. We also demonstrated that the LH surge induces nestin expression in the ovary via the VEGF signaling pathway. Combined with previous studies, our findings suggest that nestin is involved in angiogenesis in the follicle. In addition, nestin may participate in the dynamic histological changes in the adult ovary, such as folliculogenesis and ovulation. More studies are needed to elucidate the function of nestin in the ovary.


   Acknowledgments
 
We are grateful to Hatsumi Hanamura for her excellent technical assistance. We also thank Drs. Hajime Imai, Tetsuro Ogawa, Jun Watanabe, Hisayuki Funahashi, and Seiji Shioda at Department of Anatomy, Showa University School of Medicine, for fruitful discussions.


   Footnotes
 
Disclosure Statement: The authors of this manuscript have nothing to declare.

First Published Online October 4, 2007

Abbreviations: E19, Embryonic d 19; eCG, equine chorionic gonadotropin; hCG, human chorionic gonadotropin; P21, postnatal d 21; P450scc, cytochrome P450 side-chain cleavage enzyme type 11A1; SMA, smooth muscle cell marker {alpha}-actin; TUBB3, β-tubulin type 3; VEGF, vascular endothelial growth factor; VEGFR, VEGF receptor.

Received June 11, 2007.

Accepted for publication September 25, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Frederiksen K, McKay RD 1988 Proliferation and differentiation of rat neuroepithelial precursor cells in vivo. J Neurosci 8:1144–1151[Abstract]
  2. Lendahl U, Zimmerman LB, McKay RD 1990 CNS stem cells express a new class of intermediate filament protein. Cell 60:585–595[CrossRef][Medline]
  3. Hockfield S, McKay RD 1985 Identification of major cell classes in the developing mammalian nervous system. J Neurosci 5:3310–3328[Abstract]
  4. Sejersen T, Lendahl U 1993 Transient expression of the intermediate filament nestin during skeletal muscle development. J Cell Sci 106(Pt 4):1291–1300
  5. Wiese C, Rolletschek A, Kania G, Blyszczuk P, Tarasov KV, Tarasova Y, Wersto RP, Boheler KR, Wobus AM 2004 Nestin expression: a property of multi-lineage progenitor cells? Cell Mol Life Sci 61:2510–2522[CrossRef][Medline]
  6. Zulewski H, Abraham EJ, Gerlach MJ, Daniel PB, Moritz W, Muller B, Vallejo M, Thomas MK, Habener JF 2001 Multipotential nestin-positive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes. Diabetes 50:521–533[Abstract/Free Full Text]
  7. Abraham EJ, Leech CA, Lin JC, Zulewski H, Habener JF 2002 Insulinotropic hormone glucagon-like peptide-1 differentiation of human pancreatic islet-derived progenitor cells into insulin-producing cells. Endocrinology 143:3152–3161[Abstract/Free Full Text]
  8. Huang H, Tang X 2003 Phenotypic determination and characterization of nestin-positive precursors derived from human fetal pancreas. Lab Invest 83:539–547[Medline]
  9. Frojdman K, Pelliniemi LJ, Lendahl U, Virtanen I, Eriksson JE 1997 The intermediate filament protein nestin occurs transiently in differentiating testis of rat and mouse. Differentiation 61:243–249[Medline]
  10. Davidoff MS, Middendorff R, Enikolopov G, Riethmacher D, Holstein AF, Muller D 2004 Progenitor cells of the testosterone-producing Leydig cells revealed. J Cell Biol 167:935–944[Abstract/Free Full Text]
  11. Lobo MV, Arenas MI, Alonso FJ, Gomez G, Bazan E, Paino CL, Fernandez E, Fraile B, Paniagua R, Moyano A, Caso E 2004 Nestin, a neuroectodermal stem cell marker molecule, is expressed in Leydig cells of the human testis and in some specific cell types from human testicular tumours. Cell Tissue Res 316:369–376[CrossRef][Medline]
  12. Mokry J, Nemecek S 1998 Angiogenesis of extra- and intraembryonic blood vessels is associated with expression of nestin in endothelial cells. Folia Biol (Praha) 44:155–161[Medline]
  13. Lardon J, Rooman I, Bouwens L 2002 Nestin expression in pancreatic stellate cells and angiogenic endothelial cells. Histochem Cell Biol 117:535–540[CrossRef][Medline]
  14. Treutelaar MK, Skidmore JM, Dias-Leme CL, Hara M, Zhang L, Simeone D, Martin DM, Burant CF 2003 Nestin-lineage cells contribute to the microvasculature but not endocrine cells of the islet. Diabetes 52:2503–2512[Abstract/Free Full Text]
  15. Mokry J, Cizkova D, Filip S, Ehrmann J, Osterreicher J, Kolar Z, English D 2004 Nestin expression by newly formed human blood vessels. Stem Cells Dev 13:658–664[CrossRef][Medline]
  16. Fong TA, Shawver LK, Sun L, Tang C, App H, Powell TJ, Kim YH, Schreck R, Wang X, Risau W, Ullrich A, Hirth KP, McMahon G 1999 SU5416 is a potent and selective inhibitor of the vascular endothelial growth factor receptor (Flk-1/KDR) that inhibits tyrosine kinase catalysis, tumor vascularization, and growth of multiple tumor types. Cancer Res 59:99–106[Abstract/Free Full Text]
  17. Itokawa T, Nokihara H, Nishioka Y, Sone S, Iwamoto Y, Yamada Y, Cherrington J, McMahon G, Shibuya M, Kuwano M, Ono M 2002 Antiangiogenic effect by SU5416 is partly attributable to inhibition of Flt-1 receptor signaling. Mol Cancer Ther 1:295–302[Abstract/Free Full Text]
  18. Kirkin V, Thiele W, Baumann P, Mazitschek R, Rohde K, Fellbrich G, Weich H, Waltenberger J, Giannis A, Sleeman JP 2004 MAZ51, an indolinone that inhibits endothelial cell and tumor cell growth in vitro, suppresses tumor growth in vivo. Int J Cancer 112:986–993[CrossRef][Medline]
  19. Pedersen T, Peters H 1968 Proposal for a classification of oocytes and follicles in the mouse ovary. J Reprod Fertil 17:555–557[Abstract/Free Full Text]
  20. Hirshfield AN, Midgley Jr AR 1978 Morphometric analysis of follicular development in the rat. Biol Reprod 19:597–605[Abstract]
  21. Gougeon A 2004 Dynamics of human follicular growth: morphologic, dynamic, and functional aspects. In: Leung PCK, Adashi EY, eds. The ovary. 2nd ed. San Diego: Elsevier Academic Press; 25–43
  22. Espey LL 1999 Ovulation. In: Knobil E, Neill JD, eds. Encyclopedia of reproduction. San Diego: Academic Press; 605–614
  23. Caccamo D, Katsetos CD, Herman MM, Frankfurter A, Collins VP, Rubinstein LJ 1989 Immunohistochemistry of a spontaneous murine ovarian teratoma with neuroepithelial differentiation. Neuron-associated β-tubulin as a marker for primitive neuroepithelium. Lab Invest 60:390–398[Medline]
  24. Draberova E, Lukas Z, Ivanyi D, Viklicky V, Draber P 1998 Expression of class III β-tubulin in normal and neoplastic human tissues. Histochem Cell Biol 109:231–239[CrossRef][Medline]
  25. Newman PJ, Berndt MC, Gorski J, White 2nd GC, Lyman S, Paddock C, Muller WA 1990 PECAM-1 (CD31) cloning and relation to adhesion molecules of the immunoglobulin gene superfamily. Science 247:1219–1222[Abstract/Free Full Text]
  26. Franke WW, Schmid E, Vandekerckhove J, Weber K 1980 Permanently proliferating rat vascular smooth muscle cell with maintained expression of smooth muscle characteristics, including actin of the vascular smooth muscle type. J Cell Biol 87:594–600[Abstract/Free Full Text]
  27. Roth JC, Kelch RP, Kaplan SL, Grumbach MM 1972 FSH and LH response to luteinizing hormone-releasing factor in prepubertal and pubertal children, adult males and patients with hypogonadotropic and hypertropic hypogonadism. J Clin Endocrinol Metab 35:926–930[Abstract/Free Full Text]
  28. Wulff C, Dickson SE, Duncan WC, Fraser HM 2001 Angiogenesis in the human corpus luteum: simulated early pregnancy by HCG treatment is associated with both angiogenesis and vessel stabilization. Hum Reprod 16:2515–2524[Abstract/Free Full Text]
  29. Shimizu T, Jiang JY, Iijima K, Miyabayashi K, Ogawa Y, Sasada H, Sato E 2003 Induction of follicular development by direct single injection of vascular endothelial growth factor gene fragments into the ovary of miniature gilts. Biol Reprod 69:1388–1393[Abstract/Free Full Text]
  30. Trousdale RK, Pollak SV, Klein J, Lobel L, Funahashi Y, Feirt N, Lustbader JW 2007 Single-chain bifunctional vascular endothelial growth factor (VEGF)-follicle-stimulating hormone (FSH)-C-terminal peptide (CTP) is superior to the combination therapy of recombinant VEGF plus FSH-CTP in stimulating angiogenesis during ovarian folliculogenesis. Endocrinology 148:1296–1305[Abstract/Free Full Text]
  31. Frisen J, Johansson CB, Torok C, Risling M, Lendahl U 1995 Rapid, widespread, and longlasting induction of nestin contributes to the generation of glial scar tissue after CNS injury. J Cell Biol 131:453–464[Abstract/Free Full Text]
  32. Vaittinen S, Lukka R, Sahlgren C, Hurme T, Rantanen J, Lendahl U, Eriksson JE, Kalimo H 2001 The expression of intermediate filament protein nestin as related to vimentin and desmin in regenerating skeletal muscle. J Neuropathol Exp Neurol 60:588–597[Medline]
  33. Grigelioniene G, Blennow M, Torok C, Fried G, Dahlin I, Lendahl U, Lagercrantz H 1996 Cerebrospinal fluid of newborn infants contains a deglycosylated form of the intermediate filament nestin. Pediatr Res 40:809–814[Medline]
  34. Sahlgren CM, Mikhailov A, Hellman J, Chou YH, Lendahl U, Goldman RD, Eriksson JE 2001 Mitotic reorganization of the intermediate filament protein nestin involves phosphorylation by cdc2 kinase. J Biol Chem 276:16456–16463[Abstract/Free Full Text]
  35. Einspanier R, Schonfelder M, Muller K, Stojkovic M, Kosmann M, Wolf E, Schams D 2002 Expression of the vascular endothelial growth factor and its receptors and effects of VEGF during in vitro maturation of bovine cumulus-oocyte complexes (COC). Mol Reprod Dev 62:29–36[CrossRef][Medline]
  36. Celik-Ozenci C, Akkoyunlu G, Kayisli UA, Arici A, Demir R 2003 Localization of vascular endothelial growth factor in the zona pellucida of developing ovarian follicles in the rat: a possible role in destiny of follicles. Histochem Cell Biol 120:383–390[CrossRef][Medline]
  37. Filicori M, Fazleabas AT, Huhtaniemi I, Licht P, Rao CV, Tesarik J, Zygmunt M 2005 Novel concepts of human chorionic gonadotropin: reproductive system interactions and potential in the management of infertility. Fertil Steril 84:275–284[CrossRef][Medline]
  38. Michalczyk K, Ziman M 2005 Nestin structure and predicted function in cellular cytoskeletal organisation. Histol Histopathol 20:665–671[Medline]
  39. Espey LL, Bellinger AS, Healy JA 2004 Ovulation: an inflammatory cascade of gene expression. In: Leung PCK, Adashi EY, eds. The ovary. 2nd ed. San Diego: Elsevier Academic Press; 145–165
  40. Strauss III JF, Williams CJ 2004 The ovarian life cycle. In: Yen SSC, Jaffe RB, eds. Reproductive endocrinology. 5th ed. Philadelphia: Elsevier Saunders; 213–225



This article has been cited by other articles:


Home page
 Mol. Biol. CellHome page
D.-w. Lee, X. Zhao, Y.-I. Yim, E. Eisenberg, and L. E. Greene
Essential Role of Cyclin-G-associated Kinase (Auxilin-2) in Developing and Mature Mice
Mol. Biol. Cell, July 1, 2008; 19(7): 2766 - 2776.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takahashi, N.
Right arrow Articles by Ishizuka, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takahashi, N.
Right arrow Articles by Ishizuka, B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals