help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2007-0690
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Makeeva, N.
Right arrow Articles by Welsh, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Makeeva, N.
Right arrow Articles by Welsh, N.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Endocrinology Vol. 149, No. 1 302-309
Copyright © 2008 by The Endocrine Society

Transforming Growth Factor-β-Activated Protein Kinase 1-Binding Protein (TAB)-1{alpha}, But Not TAB1β, Mediates Cytokine-Induced p38 Mitogen-Activated Protein Kinase Phosphorylation and Cell Death in Insulin-Producing Cells

Natalia Makeeva, Godfried M. Roomans, Jason W. Myers and Nils Welsh

Department of Medical Cell Biology (N.M., G.M.R., N.W.), Uppsala University, S-75123 Uppsala, Sweden; and Department of Biochemistry (J.W.M.), Stanford University School of Medicine, Stanford, California 94305

Address all correspondence and requests for reprints to: Nils Welsh, Department of Medical Cell Biology, Husargatan 3, S-75123 Uppsala, Sweden. E-mail: nils.welsh{at}mcb.uu.se.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previous studies have indicated that the p38 MAPK participates in signaling events that lead to the death of the insulin-producing β-cell. The aim of the present study was to elucidate the role of the TGF-β-activated protein kinase 1-binding protein 1 (TAB1) in the cytokine-induced activation of p38. Levels of TAB1 mRNA and protein were analyzed by real-time PCR and immunoblotting, and TAB1 expression in mouse and human islet cells was down-regulated using lipofection of diced-small interfering RNA. TAB1 overexpression in β-TC6 cells was achieved by transient transfections followed by fluorescence activated cell sorting. Phosphorylation of p38, c-Jun N-terminal kinase, and ERK was assessed by immunoblotting, and viability was determined using vital staining with bisbenzimide and propidium iodide. We observed that TAB1 is expressed in insulin-producing cells. Cytokine (IL-1β + interferon-{gamma})-stimulated p38 phosphorylation was significantly increased by TAB1{alpha} overexpression, but not TAB1β overexpression, in β-TC6 cells. The TAB1{alpha}-augmented p38 phosphorylation was paralleled by an increased cell death rate. Treatment of islet cells with diced-small interfering RNA specific for TAB1, but not for TGF-β-activated kinase 1, resulted in lowered cytokine-induced p38 phosphorylation and protection against cell death. The cytokine-induced phosphorylation of c-Jun N-terminal kinase and ERK was not affected by changes in TAB1 levels. Finally, TAB1 phosphorylation was decreased by the p38 inhibitor SB203580. We conclude that TAB1{alpha}, but not TAB1β, plays an important role in the activation of p38 in insulin-producing cells and therefore also in cytokine-induced β-cell death.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TYPE 1 (INSULIN DEPENDENT) diabetes is mediated by an autoimmune and inflammatory process characterized by selective destruction of pancreatic β-cells. The intraislet release of proinflammatory cytokines, such as IL-1β, interferon (IFN)-{gamma} and TNF-{alpha}, may be a possible reason for dysfunction of and damage to β-cells in type 1 diabetes (1). It has been proposed that cytokines might contribute to β-cell apoptosis in type 1 diabetes by activating the proapoptotic MAPKs p38 (2) and c-Jun N-terminal kinase (JNK) (3).

The classical MAPK activation pathway consists of three kinase modules. Upstream signals, such as cytokine receptor activation, the inflammatory response to infection, or cell-shape changes, activate a MAPK kinase kinase, which phosphorylates and activates a MAPK kinase (MKK), which in turn phosphorylates the MAPK (4, 5, 6, 7). In addition to the classical pathway for MAPK activation, alternative pathways have been described. For example, it has been shown that p38 MAPK activation can be carried out by not only its upstream MAPK kinase (MKK3/6) but also p38 autophosphorylation (8). p38 autophosphorylation requires interaction of p38 with TGF-β-activated protein kinase 1-binding protein 1 (TAB1) (9). The autoactivation mechanism of p38 has been found to be important in cellular responses to a number of physiologically relevant stimuli (10, 11, 12).

TAB1 is a protein that was initially described as an activator of the MAPKK kinase TGF-β-activated kinase 1 (TAK1) in response to stimulation with TGF-β (12). When expressed together with TAK1, TAB1 interacts with TAK1 and leads to enhancement of TAK1 activation (13, 14, 15, 16, 17). TAK1 is thought to lie upstream of p38, JNK, and inhibitory-{kappa}B kinase in a signaling pathway that is triggered by proinflammatory cytokines or bacterial lipopolysaccharide (16, 18, 19). The C-terminal 68-amino acid portion of TAB1 is sufficient for binding to and activation of TAK1 (17). However, the portion of the TAB1 protein that is responsible for p38 interaction and activation is located closer to the N terminal than the TAK1 binding site (8, 13).

TAB1β is an alternative splicing product of the TAB1 gene. TAB1β and TAB1{alpha}, the latter being the main splicing form, have identical amino acid sequences with the exception of the C terminus. Similar to TAB1{alpha}, TAB1β interacts with p38 and induces p38 autoactivation (9). However, in contrast to TAB1{alpha}, TAB1β does not bind to TAK1 and has no effect on TAK1 activation (9). Specific inhibition of TAB1β expression by RNA interference reduces basal activity of p38 in MDA231 cells and decreases the invasiveness of MDA231 cells, indicating that is TAB1β involved in the regulation of p38 activity in a physiological setting (9). These findings suggest that TAB1{alpha} and TAB1β might play different roles in mediating cytokine-induced p38 autoactivation and cell death in insulin-producing cells.

We recently observed that p38 activation is a necessary event in nitric oxide-induced islet cell death and that this event involves p38 autoactivation (20). To study the mechanism that leads to p38 activation more closely, we presently determined the effects of TAB1{alpha} and TAB1β gain and loss of function in cytokine-exposed, insulin-producing cells. We observed that TAB1{alpha}, but not TAB1β, participates in cytokine-induced p38 activation and cell death.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
The chemicals were obtained from the following sources: [4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl) imidazole] (SB203580) was from Calbiochem (San Diego, CA). Recombinant human IL-1β, recombinant mouse IFN-{gamma} and human IFN-{gamma} were from PeproTech EC Ltd. (London, UK). Polyclonal antibodies against p38 MAPK, stress-activated protein kinase (SAPK)/JNK, phospho-(Thr180/Tyr182) p38, phospho-(Thr183/Tyr185) SAPK/JNK and phospho-(Thr202/Tyr204) p42/p44 were all from Cell Signaling Technology (Beverly, MA). The goat and rabbit TAB1, mouse inducible nitric oxide synthase, ERK-1 (C-16), and the inhibitory-{kappa}B antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Horseradish peroxidase-linked goat antirabbit Ig was from Amersham International (Amersham, Buckinghamshire, UK).

Cell culture
B-TC6 cells at the passage number 20–30 (American Tissue Culture Collection, Manassas, VA) were maintained in D-MEM + 10% (vol/vol) fetal calf serum, benzylpenicilin (100 U/ml), and streptomycin (0.1 mg/ml) at 37 C and 5% CO2. Rat and mouse islets were collagenase isolated from Sprague Dawley rats (local colony at the Biomedical Center) and NMRI mice and cultured in 50 mm nonattachment Sterilin dishes (Bibby Sterilin Ltd., Stone, Staffordshire, UK) in the RPMI 1640 medium containing 11.1 mM glucose + 10% fetal calf serum and antibiotics as given above. Human islets were kindly provided by Dr. Olle Korsgren (Department of Radiology, Oncology, and Clinical Immunology, Uppsala University, Uppsala, Sweden). The islets were cultured in the same medium as described above with the exception that the glucose concentration was lowered to 5.6 mM.

Overexpression of TAB1{alpha} and TAB1β in β-TC6 cells
For transient expression 2–3 x 106 β-TC6 cells, which had been seeded the day before, were transfected with 0.5 µg pEGFP-C1 (CLONTECH, Palo Alto, CA) + 2 µg pcDNA3 TAB1-{alpha}/β, kindly provided by Dr. Jiahuai Han (Scripps Research Institute, La Jolla, CA), using the combination of 9 µl Lipofectamine (Invitrogen, Carlsbad, CA) and 9 µl Lipofectamine Plus (Invitrogen) as described by the manufacturer. Control cells were transfected with 2.5 µg of pEGFP-C1 only. The day after transfection, green fluorescent protein (GFP)-positive cells were sorted using a FACSCalibur flow cytometer (Becton Dickinson, Lincoln Park, NJ). GFP-positive cells were identified by gating a region with high fluorescence channel-1 intensity and normal size (forward scatter). In typical experiments 25–30% of the cells were GFP positive and 500,000–550,000 cells per group were collected. The sorted cells were then replated on coverslips in 24-well plates and cultured for another 24 h.

TAB1 diced (d)-small interfering (si) RNA treatment of human and mouse islet cells
Human or mouse islets, in groups of 100, were trypsinized (0.5%) for 5 min at 37 C and then treated with DNAase I (30 U/ml) for 2 min. The resulting free islet cells were placed in nonattachment plates and transfected with 100 ng d-siRNA directed against human TAB1 or GL3 (control). We recently observed that this procedure results in a 70–80% decrease in islet cell gene expression (21). d-siRNAs directed against the 3'-end of the coding region or 3'-untranslated region of the mouse TAB1 gene (NM_025609) and the 5'-end of the coding region of the Photinus pyralis GL3 luciferase gene (U47296.2; Promega, Madison, WI) were synthesized as previously described (22). In vitro transcription templates for TAB1 were amplified via PCR from NIH3T3 cell cDNA using the following primers: the sense primer, 5'-GCGTAATACGACTCACTATAGGGTTCCTGGTGCTGATGTCAGAGG-3' and antisense primer, 5'-GCGTAATACGACTCACTATAGGGAGCAAAGTCCACATAGGGCTCC-3' were used to amplify a portion of the coding region, and the sense primer, 5'-GCGTAATACGACTCACTATAGGGTTAGTCTAGCCTCAGAGTGCAGCC-3' and the antisense primer, 5'-GCGTAATACGACTCACTATAGGGCTCTGGTACTTCCTTGTCTTGCTCC-3' were used to amplify a the template from the 3'-untranslated region. The in vitro transcription template for GL3 control was amplified with the following sense primer: 5'-GCGTAATACGACTCACTATAGGAACAATTGCTTTTACAGATGC-3'; and antisense, 5'-GCGTAATACGACTCACTATAGGAGGCAGACCAGTAGATCC-3'. T7 phage polymerase promoter is in bold. The d-siRNA was introduced into islet cells during a 2-h incubation period using 4 µl of Lipofectamine 2000 (Invitrogen) in 200 µl of serum-free culture medium (21). The transfection medium was then replaced with full culture medium and the cells were cultured for another 24 h.

RNA isolation and cDNA synthesis
Total RNA was isolated from β-TC6 cells, Jurkat T lymphocytes, and isolated rat and human islets using the Ultra-spec RNA isolation system reagent (Biotecx Laboratories, Houston, TX). Two micrograms of RNA were used for cDNA synthesis. cDNA was synthesized using the Moloney murine leukemia virus reverse transcriptase (Finnzymes, Espoo, Finland) and oligo-dT-primers according to the manufacturer's protocol.

Real-time and RT-PCR
PCR amplification was performed using the Lightcycler instrument (Roche Diagnostics, Mannheim, Germany) and the SYBR green Taq Ready Mix (Sigma-Aldrich, St. Louis, MO) with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers and primers for the different isoforms of TAB1. The forward 5'-3' primers for TAB1{alpha}, TAB1β, and GAPDH were GCTGCAGGAGGAGGAGTGTACC, GCTGCAGGAGGAGGAGTGTACC, and ACCACAGTCCATGCCATCAC, respectively. The corresponding reverse primers were ACGCTCCAGAGGCGGTAAAACTC, CACTGAGGGATGGCTGTCAAATC, and TCCACCACCCTGTTGCTGTA. The cycling parameters were 95 C for 9 min (one cycle); 95 C for 15 sec, 55 C for 10 sec, and 72 C for 12 sec (30 cycles). PCR products were analyzed by 2% agarose gel electrophoresis and ethidium bromide staining to verify that correct PCR products were obtained.

Semiquantitiatve data for TAB1 mRNA expression were calculated using the following formula: 2(crossing point GAPDH – crossing point TAB1). The TAB1 group was then expressed as the percentage of corresponding GL3 group.

Immunoblot analysis
B-TC6 cells (1 x 105) or islet cells were washed in cold PBS and lysed in sodium dodecyl sulfate (SDS)-β-mercaptoethanol sample buffer containing 1 mM phenylmethyl sulfonyl-fluoride. Samples were then sonicated, boiled, separated on 9% SDS-polyacrylamide gels, and electroblotted onto nitrocellulose filters. The filters were incubated with total p38 MAPK, total SAPK/JNK, or total p42/p44 antibodies diluted 1:1000 in PBS supplemented with 2.5% BSA. The filters were also incubated with phospho-specific p38, phospho-specific SAPK/JNK, and phospho-specific p42/44 antibodies diluted 1:1000 in Tris-buffered saline supplemented with 2.5% BSA. In some experiments filters were probed for TAB1 (Santa Cruz). Stripping between the antibodies was performed by incubating for 40 min at 55 C in 2% SDS and 0.1 mM β-mercaptoethanol. Horseradish peroxidase-linked goat antirabbit Ig was used as a second layer. The immunodetection was performed as described for the ECL immunoblotting detection system (Amersham International). The intensities of the bands were quantified by densitometric scanning using Kodak Digital Science ID software (Eastman Kodak, Rochester, NY).

Cell viability of d-siRNA-treated mouse islet cells and transiently transfected β-TC6 cells
Mouse islet cells that had been treated with d-siRNA and β-TC6 cells transiently expressing GFP, TAB1{alpha}, or TAB1β were stained with propidium iodide (20 µg/ml) and bisbenzimide (5 µg/ml) for 15 min at 37 C. After careful washing, islet cells were placed on coverslips and examined by fluorescence microscopy with UV-2B filter and using the Openlab 3.0.4 software (Improvision, Waltham, MA). Total number of cells as well as necrotic and apoptotic nuclei were counted with no knowledge of sample identity. Because necrosis and apoptosis were not differentially regulated in response to cytokines, the two forms of cell death were combined to total cell death.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TAB1 expression in insulin-producing cells
The human TAB1 gene transcript is alternatively spliced, which leads to the formation of a shorter transcript, namely TAB1β (8). To study TAB1 mRNA expression, we used the RT-PCR technique, and the same forward primer was used for both isoforms because they differ only in their 3'ends. We observed that the expected PCR products for TAB1{alpha} and TAB1β (331 and 211 bp long, respectively) were present in Jurkat samples after gel electrophoresis and ethidium bromide staining (Fig. 1AGo, lanes 1, 2, 5, and 6). The 331- and 211-bp bands were verified to be TAB1 specific because Southern blotting of the same gel as shown in Fig. 1AGo gave radioactive bands at the expected positions (Fig. 1BGo). In human islets there was clear expression of the TAB1{alpha} isoform but only a very weak band corresponding to the TAB1β isoform (Fig. 1AGo, lanes 3 and 4). In rat islets we observed the TAB1{alpha} isoform, but not the TAB1β isoform (Fig. 1AGo, lanes 7 and 8, respectively). Indeed, there was no signal in the Southern blot experiment when using TAB1β primers (Fig. 2BGo, lane 8). This finding is not surprising because the TAB1β-specific sequences of the human TAB1 gene are not present in the mouse TAB1 gene and therefore probably also not in rat. Nevertheless, assuming that PCR amplification of the two isoforms is equally efficient, it appears that the TAB1{alpha} isoform is the main form of TAB1 expressed in human and rat islet cells and that lower levels of TAB1β can also be found in the human islet cells.


Figure 1
View larger version (58K):
[in this window]
[in a new window]

 
FIG. 1. Expression of TAB1 isoforms in different types of cells. A, Total RNA was purified from human T lymphocyte Jurkat cells and rat and human islets, and RT-PCR analysis of TAB1{alpha} and TAB1β was performed. Lanes 1, 3, 5, and 7 were with primers specific for TAB1{alpha}; lanes 2, 4, 6, and 8 were with primers for TAB1β. MW, Molecular weight marker. The upper arrowhead points to the 337-bp TAB1{alpha} product and the lower to the 211-bp TAB1β product. B, After ethidium bromide staining and photography, the gel shown in the lower panel was denatured, renatured, and then Southern blotted to a GeneScreen membrane. The membrane was then UV cross-linked and hybridized to 32P-labeled TAB1 cDNA. After stringent washings, the bands were visualized by radiography. The figure is representative of two independent experiments.

 

Figure 2
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 2. A, Overexpression of TAB1 isoforms in the β-TC6 cell line. Western blot analysis of TAB1{alpha} and TAB1β expression in transiently transfected cells was performed. pEGFP-C1 plasmid was used as a control. The β-TC6 cells were transfected with pEGFP-C1 and the indicated plasmids using Lipofectamine and Lipofectamine plus. On the next day, the GFP-positive cells were FACS sorted, replated, stimulated with IL-1β (50 U/ml) and IFN-{gamma} (1000 U/ml) for 30 min, lysed, and analyzed by immunoblotting with antibody recognizing TAB1. The immunoblot is representative of five experiments. B, Expression and down-regulation of endogenous TAB1 in β-TC6 cells. Two days after treatment with GL3 or TAB1-specific d-siRNA, β-TC6 cells (107) were lysed in radioimmunoprecipitation assay buffer and TAB1 was immunoprecipitated (IP) using rabbit TAB1 antibody and protein A Sepharose beads. Immunoprecipitates and total cell lysates were analyzed for TAB1 immunoreactivity, using a goat TAB1 antibody, and mtHSP60 immunoreactivity, as protein loading control. The background IgG signal is marked IgG and the figure is representative of three independent experiments. The intensities of the TAB1 bands, corrected for mtHSP60 contents in the lysates, are given at the bottom of the figure.

 
TAB1 protein expression was assessed in insulin-producing cells using immunoblot analysis. Significant TAB1{alpha} or TAB1β immunoreactivity was detected in neither lysates of wild-type β-TC6 cells (Fig. 2AGo) nor islet cells (results not shown). However, transient expression of TAB1{alpha} and TAB1β in lipofected and fluorescence-activated cell sorter (FACS)-purified β-TC6 cells resulted in clear TAB1 immunoreactivity (Fig. 2AGo). To detect endogenous TAB1 protein in insulin-producing cells, β-TC6 cells were treated with control or TAB1 d-siRNA and 48 h later lysed for immunoprecipitation of TAB1 using a rabbit TAB1 antibody. The immunoprecipitate was then immunoblotted with a goat TAB1 antibody. We observed TAB1 immunoreactivity in the immunoprecipitates at an approximate molecular mass of 52 kDa, which corresponds well to the molecular mass of TAB1{alpha}, and that the TAB1 band was decreased by approximately 40% in cells treated with d-siRNA directed against TAB1 (Fig. 2BGo).

Effect of transient TAB1{alpha}/β overexpression on cytokine-induced p38 phosphorylation and cell death
We next investigated the effect of TAB1{alpha}/β overexpression on cytokine-induced p38 phosphorylation. Both basal and cytokine-stimulated p38 phosphorylation levels were significantly increased by TAB1{alpha} overexpression but not by TAB1β overexpression (Fig. 3AGo). We also analyzed phosphorylation of ERK and JNK, both known phosphorylation substrates in response to IL-1β and IFN-{gamma} stimulation. In line with previous observations, ERK and JNK phosphorylation was increased in response to cytokines (Fig. 3BGo). However, cytokine-induced phosphorylation of JNK and ERK was unaffected by TAB1{alpha} or TAB1β overexpression (Fig. 3BGo). These results indicate that the TAB1{alpha} isoform, but not TAB1β, plays a role in regulation of the p38 phosphorylation in β-TC6 cells.


Figure 3
View larger version (39K):
[in this window]
[in a new window]

 
FIG. 3. A, Effect of transient TAB1{alpha}/β overexpression on cytokine-stimulated p38 phosphorylation. Immunoblot showing p38 phosphorylation in response to IL-1β (50 U/ml) and IFN-{gamma} (1000 U/ml) and TAB1{alpha}/β overexpression. Two days after transfection and 1 d after FACS, the cells were exposed to the cytokines for 30 min, lysed, separated by SDS gel electrophoresis, and analyzed by immunoblotting with phospho-specific antibody recognizing phosphorylated p38 and total p38. The result from immunoblot was quantified by densitometry. Values of phospho-protein bands were related to those of nonphospho-specific protein bands. The results are means ± SEM of five experiments. *, P < 0.05 using two-way repeated-measurement ANOVA followed by the Bonferroni post-ANOVA test. B, The filters shown in A were reblotted with antibodies against phospho-JNK, phospho-ERK, and total ERK. The figure is representative of five independent experiments.

 
To establish whether the TAB1{alpha}/β augmented p38 phosphorylation affects cell death rates, the transiently transfected β-TC6 cells were exposed to cytokines for 24 h and propidium iodide uptake was assessed by flow cytometry. We observed that both basal and cytokine-induced cell death rates were increased in TAB1{alpha}- but not TAB1β-expressing cells (Fig. 4Go). However, it should be noted that it cannot be excluded that some early apoptotic cells were left undetected by the flow cytometry method presently used. Thus, the cell death rates that we observed might slightly underestimate the actual cell death rates.


Figure 4
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 4. Effect of TAB1{alpha}/β overexpression on cytokine-induced cell death in transiently transfected cells. Two days after transfection and 1 d after FACS, β-TC6 cells were exposed to the cytokines IL-1β (50 U/ml) and IFN-{gamma} (1000 U/ml) for 24 h. Cells were then stained with propidium iodide and cell viability was assessed using FACSCalibur flow cytometer. Results are presented as percentage of dead cells of the total cell count. Bars are means ± SEM of four independent experiments. *, P < 0.05 using Student’s paired t test.

 
Effect of TAB1 d-siRNA on human and mouse islet cells
Having observed increased p38 activation and cell death in response to TAB1 genetic gain of function, we next attempted to down-regulate TAB1 by treating human and mouse islet cells with d-siRNA specific for TAB1. Control cells were treated with firefly luciferase (GL3)-specific d-siRNA. To verify that the d-siRNA treatment was successful, human islet cell TAB1 mRNA levels were semiquantified using real-time PCR 2 d after the islet trypsinization and d-siRNA treatment. We observed that the TAB1 d-siRNA treatment decreased the TAB1 to GAPDH mRNA ratio with 72 ± 19% in three separate experiments using islets from three different donors. To establish whether down-regulation of TAB1 affected cytokine-induced MAPK-activation, we analyzed cytokine-induced p38, JNK and ERK phosphorylation in human islet cells treated with TAB1 d-siRNA. In these experiments TAB1 down-regulation resulted in a lowered cytokine-induced phosphorylation of p38 but not JNK2 or ERK (Fig. 5Go). Because the results were normalized to total ERK levels, we cannot exclude that the lower cytokine-induced p38 phosphorylation resulted from a lowering of the total p38 level. However, we have in other experiments not observed a lowering of total p38 in response to TAB1 d-siRNA treatment (results not shown).


Figure 5
View larger version (27K):
[in this window]
[in a new window]

 
FIG. 5. Effect of TAB1 d-siRNA on human islet cell p38, JNK, and ERK phosphorylation. A, Human islets were dispersed into free cells by trypsin treatment. Cell suspensions were then incubated for 2 h with control d-siRNA (GL3) or Tab1 d-siRNA. Forty-eight hours later, IL-1β (50 U/ml) and IFN-{gamma} (1000 U/ml) were added (30 min), and cells were analyzed for MAPK phosphorylation. B, The results from the immunoblots were quantified by densitometry. Values of phopsho-protein bands were related to those of nonphospho-ERK protein bands. The results are means ± SEM for three experiments using islets from different donors. *, P < 0.05 using ANOVA followed by the Bonferroni post-ANOVA test.

 
The TAB1 d-siRNA-induced protection against cytokine-induced p38 activation prompted us to analyze whether lowered levels of TAB1 resulted in attenuation of cytokine-induced islet cell death. Because human islets require prolonged cytokine-exposure (7–9 d) for appearance of increased cell death, we instead analyzed mouse islet cells, which respond to cytokines with increased cell death in only 1–2 d. In three separate experiments an increased number of propidium iodide-positive cells (red) was observed in small clusters of re-aggregated islet cells exposed to cytokines (Fig. 6Go). This is in line with previous studies indicating that rodent islet cells die mainly by necrosis in response to IL-1β and IFN-{gamma} (23). Cell death was approximately 20% in the group transfected with control GL3 d-siRNA, whereas the corresponding value for islets cells transfected with d-siRNA directed against TAB1 was only 8% (Fig. 6BGo). Thus, treatment with TAB1 d-siRNA protected partially against cytokine-induced islet cell death.


Figure 6
View larger version (34K):
[in this window]
[in a new window]

 
FIG. 6. Effect of TAB1 d-siRNA on mouse islet cell viability. A, Mouse islets were dispersed into free cells by trypsin treatment. Cell suspensions were then incubated for 2 h with control d-siRNA (GL3) or Tab1 d-siRNA. The next day IL-1β (50 U/ml) and IFN-{gamma} (1000 U/ml) were added and cells were cultured for another 48 h. Cells were stained for 15 min with 5 µg/ml of Hoechst and 20 µg/ml propidium iodide and photographed in a fluorescence microscope using the UV-2B filter. Representative photographs from three independent experiments are shown. B, Results are presented as percentage dead cells of the total cell count. Bars are means ± SEM of three experiments. *, P < 0.05 using two-way ANOVA and Student’s t test.

 
Down-regulation of TAK1 does not affect p38 phosphorylation
Because SB203580 antagonizes most of the cytokine-induced p38 phosphorylation (2, 20) and because down-regulation of TAB1 decreases p38 activation (Fig. 5Go), it may be that TAK1 is not required for cytokine-induced p38 phosphorylation. To address this hypothesis, we transfected βTC-6 cells with siRNA specific for TAK1 and analyzed MAPK phosphorylation 2 d later. At this time point, TAK1 levels were decreased with approximately 30% in response to the TAK1 siRNA treatment (P < 0.05 using Student’s t test), and the phosphorylation of p38, JNK2 and ERK was unaltered, compared with control-transfected cells (Fig. 7Go). This supports the notion that TAK1 is not required for cytokine-induced p38 phosphorylation.


Figure 7
View larger version (36K):
[in this window]
[in a new window]

 
FIG. 7. Down-regulation of TAK1 does not decrease cytokine-induced p38 phosphorylation. βTC-6 cells were transfected with TAK1 siRNA (Sigma-Aldrich) and 2 d later exposed to cytokines for 30 min. Cell lysates were prepared for immunoblot analysis of TAK1, phospho-p38, phospho-JNK, phospho-ERK, and Total ERK. Bars are means ± SEM of three experiments.

 
SB203580 induces an electrophoretic mobility shift of TAB1{alpha}
Activated p38 is known to phosphorylate TAB1 leading to a lowered activity of TAB1 (24). Thus, the modest effect of TAB1{alpha} overexpression on cytokine-induced p38 phosphorylation (Fig. 3Go) may be explained by activation of this autoinhibitory feedback loop. To investigate this, TAB1{alpha}-overexpressing β-TC6-cells were treated with the p38 inhibitor SB203580. SB203580 is a pyridinyl imidazole compound that, by binding to the ATP-binding site, selectively inhibits the {alpha}- and β-isoforms of p38 (25, 26). This resulted in a partial shift of TAB1{alpha} to a lower molecular weight, presumably nonphosphorylated TAB1{alpha} (Fig. 8Go). The results suggest that the p38/TAB1-negative feedback loop is also functional in insulin-producing cells.


Figure 8
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 8. SB203580 induces a molecular weight shift of the TAB1{alpha} isoform. βTC-6 cells overexpressing TAB1{alpha} or control plasmid were pretreated with SB203580 (10 µM) for 30 min, stimulated with IL-1β (50 U/ml) and IFN-{gamma} (1000 U/ml) for 30 min, lysed, and analyzed by immunoblotting with antibody recognizing TAB1. The immunoblot is representative of three experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We recently reported that p38 activation is a necessary step in cytokine- and nitric oxide-induced rodent β-cell death (20). It appears that the rapid cytokine-induced activation of p38 and JNK is followed by a sustained stimulatory phase in response to inducible nitric oxide synthase-catalyzed production of nitric oxide and that both p38 and JNK promote proapoptotic effects when persistently activated in insulin-producing cells (2, 3, 28). The mechanisms by which p38 is activated in response to cytokine stimulation are, however, not clear. In the present paper, we report that: 1) TAB1{alpha} augmented IL-1β and IFN-{gamma} induced p38 phosphorylation, 2) this was paralleled by a potentiation of cytokine-induced cell death, and 3) and knockdown of TAB1 in human and mouse islet cells results in the opposite effect, i.e. a decreased sensitivity to cytokines. These findings are compatible with the view that p38 plays a proapoptotic role in cytokine-induced β-cell death and that TAB1{alpha} participates in the activation of p38. TAB1 has been characterized as an adaptor/scaffold protein that forms complexes with other components of the IL-1 receptor-signaling pathway. More specifically, TAB1 organizes TAK1, MKK3/6, and p38 into a complex so that TAK1-induced phosphorylation of MKK3/6- and MKK3/6-induced phosphorylation of p38 is facilitated (29). Alternatively, TAB1 is known to promote p38 autophosphorylation without the involvement of TAK1 or MKK3/6 (8). p38 autophosphorylation can be probed by using SB203580, an inhibitor that blocks p38 autophosphorylation but not MKK3/6-induced p38 phosphorylation (8, 9). We previously observed that SB203580 potently antagonized cytokine-induced p38 activation (20). Moreover, we presently observe that a partial down-regulation of TAK1 levels did not affect cytokine-induced p38 phosphorylation. This suggests that TAB1-stimulated p38 autophosphorylation represents the main p38-activating mechanism in response to cytokine stimulation. Sorbitol-mediated p38 activation, however, was not affected by SB203580 (20), indicating that hyperosmolaric stress uses the traditional MKK3/6 pathway rather than the TAB1-induced p38 autophosphorylation pathway.

Recently TAB1β, which is a splicing variant of TAB1{alpha}, was discovered in human cells (9). TAB1β has a C-terminal sequence that lacks the TAK1 interacting domain. Thus, it does not promote TAK1 activation (9). However, similar to TAB1{alpha}, TAB1β interacts with p38 and induces p38 autoactivation. In our experimental setup, however, transient expression of human TAB1β did not affect p38 activation in murine insulin-producing cells. This indicates that human TAB1β neither activates TAK1 nor promotes p38 autophosphorylation when expressed in murine cells. It is possible that the lack of a TAB1β phenotype in the transiently transfected cells resulted from molecular incompatibilities between human TAB1β and murine p38.

SB203580 not only promoted inhibition of p38 autophosphorylation but also induced a molecular weight lowering of TAB1{alpha}, which most likely represents decreased p38-induced phosphorylation of TAB1{alpha}. This is in line with a previous study in which it was demonstrated that p38 mediates feedback control of the MAPK pathways by suppressing the activity of TAB1 (24). It seems that p38-mediated phosphorylation of TAB1 induces a conformational change that suppresses TAB1-mediated TAK1 activation, possibly by attenuating TAK1-autophosphorylation at Thr-187 (30). According this model, elimination of the feedback inhibition of TAB1/TAK1 by SB203580 should enhance the activation of JNK and ERK. Indeed, we observed a further potentiation of cytokine-stimulated JNK and ERK phosphorylation in the presence of SB203580 (results not shown). Similar findings have been reported using anergic CD4+ T cells (31) and RAW macrophages (32) in which SB203580 caused the release of JNK and ERK pathways from negative regulatory effects of p38.

The TAB1-mediated p38 autophosphorylation mechanism seems to be used in situations other than the current cytokine-stimulation context. For example, in the ischemic heart, the interaction of activated AMPK with TAB1 appears to recruit p38 to TAB1 complexes leading to the MKK3-independent activation of p38 (10, 11). In addition, collagen-induced maturation of dendritic cells requires a TRAF6/TAB1/p38 signaling cascade (12).

In summary, our results suggest that TAB1{alpha}. but not TAB1β. plays a role in the cytokine-induced activation of p38 in insulin-producing cells. We also observed a complicated cross talk between p38 and ERK/JNK, possibly involving a p38/TAB1 negative feedback mechanism. Recent findings indicate that p38 promotes β-cell death in response to not only IL-1β and IFN-{gamma} but also TNF-{alpha} (33), endoplasmic reticulum stress (34), lack of osteoprotegerin (35), and islet cryopreservation and thawing (36). It is noteworthy that the TAB1 gene is located at the 13.1 region of chromosome 22, which has been linked to both systemic sclerosis (37) and type 2 diabetes (38, 39). Thus, a closer genetic analysis of the TAB1 region may reveal whether polymorphisms in this specific gene contribute to the inflammatory events leading to systemic sclerosis and type 2 diabetes. In addition, as p38 appears to mediate β-cell apoptosis, and because pharmacological inhibition of p38 has resulted in protection against diabetes of the NOD mouse (40), it is possible that inhibition of the interaction between TAB1 and p38 could prove beneficial in the treatment of type 1 diabetes. Thus, a better understanding of the cytokine-induced events that lead to p38 activation and β-cell apoptosis might improve our understanding of the pathogenesis of not only type 1 diabetes but also other inflammatory diseases including type 2 diabetes (27).


    Footnotes
 
This work was supported in part by Swedish Medical Research Council grants, the Swedish Diabetes Association, the family Ernfors Fund, the Novo-Nordisk Fund, and the European Foundation for the Study of Diabetes.

Disclosure Statement: The authors have nothing to disclose.

First Published Online October 11, 2007

Abbreviations: d, Diced; FACS, fluorescence-activated cell sorter; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; IFN, interferon; JNK, c-Jun terminal kinase; MKK, MAPK kinase; SAPK, stress-activated protein kinase; SDS, sodium dodecyl sulfate; si, small interfering; TAB1, TGF-β-activated protein kinase 1-binding protein 1; TAK1, TGF-β-activated kinase 1.

Received June 5, 2007.

Accepted for publication October 1, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bendtzen K, Mandrup-Poulsen T, Nerup J, Nielsen JH, Dinarello CA, Svenson M 1986 Cytotoxicity of human pI 7 interleukin-1 for pancreatic islets of Langerhans. Science 232:1545–1547[Abstract/Free Full Text]
  2. Saldeen J, Lee JC, Welsh N 2001 Role of p38 mitogen-activated protein kinase (p38 MAPK) in cytokine-induced rat islet cell apoptosis. Biochem Pharmacol 61:1561–1569[CrossRef][Medline]
  3. Ammendrup A, Maillard A, Nielsen K, Aabenhus Andersen N, Serup P, Dragsbaek Madsen O, Mandrup-Poulsen T, Bonny C 2000 The c-Jun amino-terminal kinase pathway is preferentially activated by interleukin-1 and controls apoptosis in differentiating pancreatic β-cells. Diabetes 49:1468–1476[Abstract]
  4. Schaeffer HJ, Weber MJ 1999 Mitogen-activated protein kinases: specific messages from ubiquitous messengers. Mol Cell Biol 19:2435–2444[Free Full Text]
  5. Chang L, Karin M 2001 Mammalian MAP kinase signalling cascades. Nature 410:37–40[CrossRef][Medline]
  6. Davis RJ 2000 Signal transduction by the JNK group of MAP kinases. Cell 103:239–252[CrossRef][Medline]
  7. Dong C, Davis RJ, Flavell RA 2002 Abstract MAP kinases in the immune response. Ann Rev Immunol 20:55–72[CrossRef][Medline]
  8. Ge B, Gram H, Di Padova F, Huang B, New L, Ulevitch RJ, Luo Y, Han J 2002 MAPKK-independent activation of p38{alpha} mediated by TAB1-dependent autophosphorylation of p38{alpha}. Science 295:1291–1294[Abstract/Free Full Text]
  9. Ge B, Xiong X, Jing Q, Mosley JL, Filose A, Bian D, Huang S, Han J 2003 TAB1β (transforming growth factor-β-activated protein kinase 1-binding protein 1β), a novel splicing variant of TAB1 that interacts with p38{alpha} but not TAK1. J Biol Chem 278:2286–2293[Abstract/Free Full Text]
  10. Li J, Miller EJ, Ninomiya-Tsuji J, Russell 3rd RR, Young LH 2005 AMP-activated protein kinase activates p38 mitogen-activated protein kinase by increasing recruitment of p38 MAPK to TAB1 in the ischemic heart. Circ Res 97:872–879[Abstract/Free Full Text]
  11. Tanno M, Bassi R, Gorog DA, Saurin AT, Jiang J, Heads RJ, Martin JL, Davis RJ, Flavell RA, Marber MS 2003 Diverse mechanisms of myocardial p38 mitogen-activated protein kinase activation: evidence for MKK-independent activation by a TAB1-associated mechanism contributing to injury during myocardial ischemia. Circ Res 93:254–261[Abstract/Free Full Text]
  12. Matsuyama W, Faure M, Yoshimura T 2003 Activation of discoidin domain receptor 1 facilitates the maturation of human monocyte-derived dendritic cells through the TNF receptor associated factor 6/TGF-β-activated protein kinase 1 binding protein 1β/p38{alpha}. J Immunol 171:3520–3532[Abstract/Free Full Text]
  13. Shibuya H, Yamaguchi K, Shirakabe K, Tonegawa A, Gotoh Y, Ueno N, Irie K, Nishida E, Matsumoto K 1996 TAB1: an activator of the TAK1 MAPKKK in TGF-β signal transduction. Science 272:1179–1182[Abstract]
  14. Sakurai H, Miyoshi H, Mizukami J, Sugita T 2000 Phosphorylation-dependent activation of TAK1 mitogen-activated protein kinase kinase kinase by TAB1. FEBS Lett 474:141–145[CrossRef][Medline]
  15. Kishimoto K, Matsumoto K, Ninomiya-Tsuji J 2000 TAK1 mitogen-activated protein kinase kinase kinase is activated by autophosphorylation within its activation loop. J Biol Chem 275:7359–7364[Abstract/Free Full Text]
  16. Ninomiya-Tsuji J, Kishimoto K, Hiyama A, Inoue J, Cao Z, Matsumoto K 1999 The kinase TAK1 can activate the NIK-I{kappa}B as well as the MAP kinase cascade in the IL-1 signalling pathway. Nature 398:252–256[CrossRef][Medline]
  17. Ono K, Ohtomo T, Sato S, Sugamata Y, Suzuki M, Hisamoto N, Ninomiya-Tsuji J, Tsuchiya M, Matsumoto K 2001 An evolutionarily conserved motif in the TAB1 C-terminal region is necessary for interaction with and activation of TAK1 MAPKKK. J Biol Chem 276:24396–24400[Abstract/Free Full Text]
  18. Lee SW, Han SI, Kim HH, Lee ZH 2002 TAK1-dependent activation of AP-1 and c-Jun N-terminal kinase by receptor activator of NF-{kappa}B. J Biochem Mol Biol 35:371–376[Medline]
  19. Wang C, Deng L, Hong M, Akkaraju GR, Inoue J, Chen ZJ 2001 TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 412:346–351[CrossRef][Medline]
  20. Makeeva N, Myers JW, Welsh N 2006 Role of MKK3 and p38 MAPK in cytokine-induced death of insulin-producing cells. Biochem J 393:129–139[CrossRef][Medline]
  21. Hagerkvist R, Mokhtari D, Myers JW, Tengholm A, Welsh N 2005 siRNA produced by recombinant dicer mediates efficient gene silencing in islet cells. Ann NY Acad Sci 1040:114–122[CrossRef][Medline]
  22. Myers JW, Ferrell Jr JE 2005 Silencing gene expression with dicer-generated siRNA pools in RNA silencing: methods and protocols. Carmichael G, ed. Totowa, NJ: Humana Press
  23. Welsh N 2000 Assessment of apoptosis and necrosis in isolated islets of Langerhans: methodological considerations and improvements. Research Trends: Curr Top Biochem Res 3:189–200
  24. Cheung PC, Campbell DG, Nebreda AR, Cohen P 2003 Feedback control of the protein kinase TAK1 by SAPK2a/p38{alpha}. EMBO J 22:5793–5805[CrossRef][Medline]
  25. Cuenda A, Rouse J, Doza YN, Meier R, Cohen P, Gallagher TF, Young PR, Lee JC 1995 SB 203580 is a specific inhibitor of a MAP kinase homologue which is stimulated by cellular stresses and interleukin-1. FEBS Lett 364:229–233[CrossRef][Medline]
  26. Tong L, Pav S, White DM, Rogers S, Crane KM, Cywin CL, Brown ML, Pargellis CA 1997 A highly specific inhibitor of human p38 MAP kinase binds in the ATP pocket. Nat Struct Biol 4:311–316[CrossRef][Medline]
  27. Maedler K, Sergeev P, Ris F, Oberholzer J, Joller-Jemelka HI, Spinas GA, Kaiser N, Halban PA, Donath MY 2002 Glucose-induced β cell production of IL-1β contributes to glucotoxicity in human pancreatic islets. J Clin Invest 110:851–860[CrossRef][Medline]
  28. Storling J, Binzer J, Andersson AK, Zullig RA, Tonnesen M, Lehmann R, Spinas GA, Sandler S, Billestrup N, Mandrup-Poulsen T 2005 Nitric oxide contributes to cytokine-induced apoptosis in pancreatic β cells via potentiation of JNK activity and inhibition of Akt. Diabetologia 48:2039–2050[CrossRef][Medline]
  29. Jiang Z, Ninomiya-Tsuji J, Qian Y, Matsumoto K, Li X 2002 Interleukin-1 (IL-1) receptor-associated kinase-dependent IL-1-induced signaling complexes phosphorylate TAK1 and TAB2 at the plasma membrane and activate TAK1 in the cytosol. Mol Cell Biol 22:7158–7167[Abstract/Free Full Text]
  30. Singhirunnusorn P, Suzuki S, Kawasaki N, Saiki I, Sakurai H 2005 Critical roles of threonine 187 phosphorylation in cellular stress-induced rapid and transient activation of transforming growth factor-β-activated kinase 1 (TAK1) in a signaling complex containing TAK1-binding protein TAB1 and TAB2. J Biol Chem 280:7359–7368[Abstract/Free Full Text]
  31. Ohkusu-Tsukada K, Tominaga N, Udono H, Yui K 2004 Regulation of the maintenance of peripheral T-cell anergy by TAB1-mediated p38{alpha} activation. Mol Cell Biol 24:6957–6966[Abstract/Free Full Text]
  32. Hall JP, Davis RJ 2002 Inhibition of the p38 pathway upregulates macrophage JNK and ERK activities, and the ERK, JNK, and p38 MAP kinase pathways are reprogrammed during differentiation of the murine myeloid M1 cell line. J Cell Biochem 86:1–11[CrossRef][Medline]
  33. Tobiasch E, Gunther L, Bach FH 2001 Heme oxygenase-1 protects pancreatic β cells from apoptosis caused by various stimuli. J Investig Med 49:566–571[Medline]
  34. Yang G, Yang W, Wu L, Wang R 2007 H2S, endoplasmic reticulum stress, and apoptosis of insulin-secreting β cells. J Biol Chem 282:16567–16576[Abstract/Free Full Text]
  35. Omori K, Valiente L, Orr C, Rawson J, Ferreri K, Todorov I, Al-Abdullah IH, Medicherla S, Potter AA, Schreiner GF, Kandeel F, Mullen Y 2007 Improvement of human islet cryopreservation by a p38 MAPK inhibitor. Am J Transplant 7:1224–1232[CrossRef][Medline]
  36. Schrader J, Rennekamp W, Niebergall U, Schoppet M, Jahr H, Brendel MD, Horsch D, Hofbauer LC 2007 Cytokine-induced osteoprotegerin expression protects pancreatic β cells through p38 mitogen-activated protein kinase signalling against cell death. Diabetologia 50:1243–1247[CrossRef][Medline]
  37. Zhou X, Tan FK, Wang N, Xiong M, Maghidman S, Reveille JD, Milewicz DM, Chakraborty R, Arnett FC 2003 Genome-wide association study for regions of systemic sclerosis susceptibility in a Choctaw Indian population with high disease prevalence. Arthritis Rheum 48:2585–2592[CrossRef][Medline]
  38. Ghosh S, Watanabe RM, Valle TT, Hauser ER, Magnuson VL, Langerfeld CD, Ally DS, Mohlke KL, Silander K, Kohtamaki K, Chines P, Balow Jr J, Birznieks G, Chang J, Eldridge W, Erdos MR, Karanjawala ZE, Knapp JI, Kudelko K, Martin C, Morales-Mena A, Musick A, Musick T, Pfahl C, Porter R, Rayman JB 2000 The Finland-United States investigation of noninsulin-dependent diabetes mellitus genetics (FUSION) study. I. An autosomal genome scan for genes that predispose to type 2 diabetes. Am J Hum Genet 67:174–185
  39. Hegele RA, Sun F, Harris SB, Anderson C, Hanley AJ, Zinman B 1999 Genome-wide scanning for type 2 diabetes susceptibility in Canadian Oji-Cree, using 190 microsatellite markers. J Hum Genet 44:10–14[CrossRef][Medline]
  40. Ando H, Kurita S, Takamura T 2004 The specific p38 mitogen-activated protein kinase pathway inhibitor FR167653 keeps insulitis benign in nonobese diabetic mice. Life Sci 74:1817–1827[CrossRef][Medline]



This article has been cited by other articles:


Home page
DiabetesHome page
D. Mokhtari, J. W. Myers, and N. Welsh
MAPK Kinase Kinase-1 Is Essential for Cytokine-Induced c-Jun NH2-Terminal Kinase and Nuclear Factor-{kappa}B Activation in Human Pancreatic Islet Cells
Diabetes, July 1, 2008; 57(7): 1896 - 1904.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Makeeva, N.
Right arrow Articles by Welsh, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Makeeva, N.
Right arrow Articles by Welsh, N.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals