Endocrinology, doi:10.1210/en.2007-0618
Endocrinology Vol. 149, No. 1 84-92
Copyright © 2008 by The Endocrine Society
The Flavonoid Quercetin Regulates Growth and Gene Expression in Rat FRTL-5 Thyroid Cells
Cesidio Giuliani,
Yoshihiko Noguchi,
Norikazu Harii,
Giorgio Napolitano,
Dante Tatone,
Ines Bucci,
Mauro Piantelli,
Fabrizio Monaco and
Leonard D. Kohn
Department of Medicine and Sciences of Aging (C.G., G.N., I.B., F.M.), Unit of Endocrinology, and Department of Oncology and Neurosciences (D.T., M.P.), University "G. DAnnunzio" and Aging Research Center, Centro Scienze dellInvecchiamento, "Gabriele DAnnunzio" University Foundation, 66013 Chieti, Italy; and Edison Biotechnology Institute and Department of Biomedical Sciences (Y.N., N.H., L.D.K.), College of Osteopathic Medicine, Ohio University, Athens, Ohio 45701
Address all correspondence and requests for reprints to: Dr. Cesidio Giuliani, Unit of Endocrinology, Centro Scienze dellInvecchiamento, Fondazione Universita "Gabriele DAnnunzio" Campus Universitario, via Colle dellAra, 66013 Chieti, Italy. E-mail: cgiulian{at}unich.it.
 |
Abstract
|
|---|
Quercetin is the most consumed flavonoid present in fruits and vegetables. There has been increased interest in the possible health benefits of quercetin and other flavonoids. Because it is reported that these compounds have some antithyroid properties, we were interested whether, and by what mechanism, quercetin might regulate thyroid cell growth and function. In this report we show that quercetin inhibits thyroid cell growth in association with inhibition of insulin-modulated phosphatidylinositol 3-kinase-Akt kinase activity. Furthermore, quercetin decreases TSH-modulated RNA levels of the thyroid-restricted gene sodium/iodide symporter (NIS). We associated down-regulation of NIS RNA levels with inhibition of iodide uptake at comparable quercetin concentrations and could show that the inhibitory effect of quercetin on NIS RNA levels and iodide uptake is reproduced by inhibitors of the phospholipase-A2/lipoxygenase pathway. The specific inhibitor of protein kinase A, H89, only partially inhibited TSH-increased NIS expression and did not reproduce the quercetin effect. The quercetin studies thus reveal that the phospholipase-A2/lipoxygenase pathway appears to play an important role in TSH regulation of NIS gene expression, whereas quercetin inhibition of growth appears to involve an effect on insulin/IGF-I-Akt signaling. The data raise the possibility that quercetin may be a novel disruptor of thyroid function, which has potential effects on, or use in, the therapy of thyroid diseases.
 |
Introduction
|
|---|
QUERCETIN (3, 3', 4', 5, 7-pentahydroxyflavone) is one of the most widely distributed and abundant flavonoids present in fruits and vegetables, such as onions, apples, berries, legumes, tea, and grapes (1, 2, 3). The daily intake of flavonoids varies widely in the literature; however, in the Western world, an average intake between 20 and 35 mg/d has been estimated and up to 1 g/d has been reported (2, 3). Flavonoids are not only present in the normal diet, but they are also commercially available as dietary and antiaging supplements. For example, they are the major component of products used in natural medicine such as Ginkgo biloba (4, 5).
Several studies have shown that quercetin and other flavonoids possess many therapeutically relevant properties such as: 1) induction of apoptosis in tumor cells; 2) antiviral, antioxidant, antiinflammatory, and antiproliferative activities; and 3) cytoprotective effects (6, 7, 8, 9, 10). Intake of flavonoids, particularly quercetin has been associated with a decreased risk of coronary heart disease and cancer (7, 10, 11, 12). For these reasons, interest in the possible health benefits of flavonoids has recently increased.
Although many in vitro and epidemiological data support an overall health benefit from the intake of flavonoids, there are some cautionary reports in the literature that raise concerns about the potential toxic effects of excessive flavonoid intake (5, 13). With respect to the thyroid, flavonoids have been reported to inhibit iodide uptake, exert a thiourea-like antithyroid action inhibiting thyroperoxidase (TPO) enzyme activity, inhibit type I and type II 5'-deiodinase as well as 5-deiodinase activity (14, 15, 16, 17, 18), and displace T4 from serum transthyretin in rats (17, 18, 19). Although an excessive intake of flavonoids has been associated with goiter, there is evidence that some flavonoids can inhibit growth or induce apoptosis of human thyroid cancer cell in vitro, leading to the suggestion they might be used as therapeutic agents in the management of thyroid cancer (20, 21). One of the same studies showed, however, that some flavonoids can inhibit iodide uptake and sodium/iodide symporter (NIS) gene expression in a thyroid tumor cell line stably transfected with the hNIS gene (21), i.e. they might simultaneously inhibit efficacy of radioiodine therapy.
Given these cautionary, but sometimes contradictory, data concerning effects of flavonoids on the thyroid, we were interested to determine the effect of flavonoids on the growth and function of thyroid cells whose growth and function is under normal hormonal control. Quercetin is the most consumed flavonoid and represent as much as 70% of the flavonoids ingested (1, 2, 3, 4). Moreover, quercetin is used as antioxidant in the treatment of inflammatory diseases and has been tested in several clinical trials (4, 22, 23, 24, 25, 26, 27). FRTL-5 rat thyroid cells in continuous culture are a widely used nontransformed cell line whose growth and function is hormonally sensitive and similar to that in vivo (28, 29, 30, 31, 32, 33, 34); we thus used this in vitro model to evaluate the effect of quercetin on thyroid growth and function.
In this report, we show that quercetin inhibits growth in FRTL-5 thyroid cells in a concentration- and time-dependent manner, and we associate the inhibition of insulin-regulated Akt kinase activity as a possible mechanism involved. Furthermore, we show that quercetin decreases the expression of TSH regulated NIS gene expression and I– transport in FRTL-5 cells. This action appears to be specific because other genes, such as β-actin or the MHC-I, are not affected or slightly increased, respectively.
These data show the molecular mechanism of the antithyroid effect of quercetin on cell growth and function in vitro in a hormonally controlled, functioning thyroid cell line that behaves normally and does not have properties of a transformed cell. They amplify our knowledge of the action of this compound on thyroid cells as a disruptor of thyroid growth and function but also raise the possibility of its potential use as an antithyroid drug in hyperfunctioning states.
 |
Materials and Methods
|
|---|
Materials
Quercetin was from Sigma-Aldrich Chemical Co. (St. Louis, MO). Wortmannin, LY294002, hrTGFβ-1, indomethacin, 5,8,11,14-eicosatetranoic acid (ETYA), nordihydroguaiaretic acid (NDGA), baicalein, and MK-886 were from Calbiochem-EMD Biosciences, Inc. (San Diego, CA). Calf serum was a heat-treated, mycoplasma-free product from Life Technologies, Inc. Invitrogen Corp. (Carlsbad, CA). [
-32P]dCTP and carrier-free Na125I were from Amersham-GE Healthcare (Piscataway, NJ). Primary antibodies anti-TGF-β1 (sc-146) and anti-phosphorylated mothers against decapentaplegic (Smad)-7 (sc-11392), and the related horseradish peroxidase (HRP)-conjugated antirabbit secondary antibody were from Santa Cruz Biotechnology Inc (Santa Cruz, CA). Primary antibodies anti-phospho-Akt (Ser473) and anti-phospho-p70S6 kinase (Thr421/Ser424) and the related HRP-conjugated antirabbit secondary antibody were from Cell Signaling Technology Inc. (Danvers, MA). The source of all other materials was the Sigma-Aldrich, unless otherwise specified.
Cells
The F1 subclone of FRTL-5 rat thyroid cells (Interthyr Research Foundation, Athens, OH) was grown in a medium (6H5%) consisting of Coons modified Hams F-12 supplemented with 5% calf serum, 2 mM glutamine, 1 mM nonessential amino acids, and a mixture of six hormones: bovine TSH (1 x 10–10 M), insulin (10 µg/ml), cortisol (0.4 ng/ml), transferrin (5 µg/ml), glycyl-L-histidyl-L-lysine acetate (10 ng/ml), and somatostatin (10 ng/ml). Cells were diploid, between their fifth and 25th passage and had all the functional properties previously detailed (28, 29, 30, 31, 32, 33, 34). Fresh medium was added every 2–3 d, and cells were passaged every 7 d. In individual experiments, cells were shifted to five-hormone medium (5H) with no TSH and containing 5% calf serum or to 4H0.2% medium (medium with no TSH, no insulin, and only 0.2% calf serum). In all experiments with quercetin, the medium was changed every 24 h adding fresh medium with quercetin.
Quercetin was taken from an absolute ethanol stock solution; thus, control cells were treated with the same amount of vehicle. The final ethanol concentration did not exceed 0.5% (vol/vol), in either control or treated samples.
Evaluation of cell growth
Cells were inoculated at a density of 2 x 104/well in 24-well culture plates. After overnight incubation in 6H5% medium to allow for cell attachment, the medium was removed and replaced with 6H5% medium with 10 µM quercetin or the same amount of vehicle (0.5% ethanol). Every 24 h the medium was removed and fresh medium with quercetin or vehicle control was added. Cell proliferation was assayed after 24, 48, and 72 h. Cells were detached using collagenase-trypsin mixture (30) and stained with 0.4% of trypan blue. Viable cell number was measured with a hemocytometer. Quadruplicate counts of triplicate cultures were performed.
Thymidine incorporation
FRTL-5 cells were plated in 24-well plates and maintained in 6H5% medium until 50% confluent. Cells were then treated with various concentration of quercetin for 24, 48, and 72 h. [3H]thymidine (3 µCi/ml) was added to each well 24 h before the termination of each experiment. Labeling was stopped by aspirating the medium, washing the cells twice with cold PBS, and incubating them with ice-cold 10% trichloroacetic acid for 10 min. Trichloroacetic acid-precipitated materials were solubilized with diphenylamine reagent, and cell-associated radioactivity was measured in a liquid scintillation spectrometer. Total DNA was measured by incubating acid-precipitated materials to normalize for cell number. Results are presented as counts per minute of [3H]thymidine incorporated per microgram of DNA in 24 h.
Construction of Smad-luciferase (Luc) trans-reporting vector
Synthetic oligonucleotides containing 5x Smad consensus binding element (SBE; GTCTAGAC x 5), and a DNA fragment containing the adenovirus E1b TATA (TGGAGACTCTAGAGGGTATAATG) element were inserted, respectively, into the MluI site and MluI-BglII sites of PGL-3 basic vector (Promega Corp., Madison, WI). The construct we thereby constructed and named pSmad-Luc had a 5' site for Mlu I followed by five SBE sites, the E1b TATA element, and a BglII site.
Transfection and luciferase assay
Cells were transiently transfected with the pSmad-Luc chimera using a diethylaminoethyl-dextran procedure (35). Cells grown to 60% confluency in 6H5% medium were cotransfected with 20 µg of pSmad-Luc DNA and 2 µg of pRL-TK vector (Promega) as internal control to measure the efficiency of transfection. Cells were then cultured in 6H5% medium for 24 h and then treated with quercetin, wortmannin, or TGF-β1 for 24 h. Dual luciferase assays were performed using the dual-luciferase reporter system (Promega) following manufacturer instructions and a LUMAT LB 9507 luminometer (EG & G Berthold, Bundoora, Australia).
Preparation of whole-cell extracts and Western blotting
To prepare whole-cell lysates, cells were collected, washed with ice-cold PBS, and resuspended in ice-cold lysis buffer [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM Na2-EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM Na4P2O7, 1 mM β-glycerophosphate, 1 mM Na3VO4, 1 µg/ml leupeptin, 1 mM phenylmethylsulfonylfluoride]. Cells were incubated on ice for 15 min before being vortexed. After centrifugation to remove cellular debris, the cell lysates was subjected to 10% SDS-PAGE, and the separated proteins were transferred to a nitrocellulose membrane by electrophoretic blotting. After transfer, the membrane was incubated with primary antibodies following the manufacturers instructions. Membranes were subsequently washed and incubated with HRP-conjugated antirabbit secondary antibody following the manufacturers instructions. Proteins were detected with SuperSignal West Pico chemiluminescent substrate (Pierce Biotechnology, Rockford, IL)
Akt kinase assay
Akt kinase activity was measured using an Akt kinase assay kit (Cell Signaling Technology). In brief, after treatment 1 ml ice-cold 1x cell lysis buffer plus 1 mM phenylmethylsulfonylfluoride was added to each dish and incubated at –70 C for 10 min. Four hundred microliters of cell lysate were resuspended with 40 µl of immobilized Akt antibody slurry and incubated with gentle rocking for 3 h at 4 C. After centrifugation the pellet was suspended with 200 µM ATP and 1 µg glycogen synthase kinase (GSK)-3 fusion protein and incubated for 30 min at 30 C. The reaction was terminated with 15 µl 4x SDS + 2.5 µl 1 M dithiothreitol. After centrifugation the supernatant was boiled for 5 min and subjected to 10% SDS-PAGE and Western blotting. After transfer, the membrane was incubated with primary antibody overnight at 4 C, washed, and incubated with HRP-conjugated antirabbit secondary antibody (1:2000) for 2 h at room temperature with gentle agitation. Proteins were detected with SuperSignal West Pico chemiluminescent substrate (Pierce Biotechnology).
RNA isolation and Northern analyses
FRTL-5 cells grown to 60% confluency in 6H5% medium were then maintained in 5H5% medium (without TSH) for 6 d, shifted in 6H5% medium for 24 h, and finally treated with quercetin or control vehicle for the indicated times. RNA was prepared using a RNeasy minikit (QIAGEN Inc., Valencia, CA); 20 µg of the different RNA samples were run on denatured agarose gels, capillary blotted on Nytran membranes (Schleicher & Schuell-Whatman, Florrham Park, NJ), UV cross-linked, and subjected to hybridization using QuickHyb hybridization solution (Stratagene, La Jolla, CA) following manufacturer protocol. Probes were labeled with [
-32P]dCTP using a Ladderman labeling kit (Takara Mirus Bio, Madison, WI). NIS was a full-length rat cDNA; thyroglobulin, TSH receptor, TPO, and β-actin probes were described previously (36, 37). Quantitation was performed using a BAS 1500 bioimaging analyzer (Fuji Medical Systems USA, Inc., Stamford, CT).
Measurement of 125I– uptake
Uptake of 125I– by FRTL-5 cells was measured as previously described (38). Briefly, cells were seeded in 12-well plates, grown to 60% confluency in 6H5%, and shifted to 5H5% medium (without TSH) for 6 d, at which time TSH (1 mU/ml) was added ± quercetin, NDGA, or control vehicle for 48 h. After treatment, cells were washed twice with 1 ml HEPES-buffered modified Hanks balanced salt solution (HBSS) [137 mM NaCl, 5.4 mM KCl, 1.3 mM CaCl2, 0.4 mM MgSO4, 0.5 mM Na2HPO4, 0.44 mM KH2PO4, 5.55 mM glucose, and 10 mM HEPES buffer (pH 7.3)] and incubated for 40 min at 37 C in 250 µl of modified HBSS containing 0.5 µCi carrier-free Na125I and 30 µM NaI. Cells were then washed twice with ice-cold modified HBSS. Absolute ethanol, 500 µl, was added to each well for 30 min, and 50 µl of the well content were transferred in scintillation vials and counted in a
-counter. I– uptake was expressed as picomoles per microgram of DNA.
Other assays
Protein concentration was determined using a BCA protein assays kit (Pierce Biotechnology); crystalline BSA was the standard.
Statistical analysis
All experiments were repeated at least three times with different batches of cells. Significance between experimental values was determined by two-way ANOVA and P < 0.05.
 |
Results
|
|---|
Inhibition of FRTL-5 cell growth by quercetin
Quercetin at a concentration of 10–5 M (10 µM) inhibits the growth of FRTL-5 cells (Fig. 1A
). Cells were inoculated at density of 2 x 104/well in 24-well culture plates. After overnight incubation to allow for cell attachment, the medium was removed and replaced with fresh medium containing 10 µM quercetin. After 24, 48, and 72 h, cell proliferation was assayed by trypan blue dye exclusion. A significant reduction of growth (63 ± 8% of control value) is seen after 24 h of treatment; after 48 h the reduction is 39 ± 5% of the control value and reaches 22 ± 7% of the control value after 72 h (Fig. 1A
). Quercetin also inhibits DNA synthesis in FRTL-5 cells, as assessed by thymidine incorporation into DNA. At a concentration of 10 µM, quercetin decreased [3H]thymidine incorporation to 16 ± 5% of control value after 24 h (Fig. 1B
). The effect is concentration dependent; thus, after 24 h of treatment, a significant reduction of thymidine incorporation is seen with 2.5 µM quercetin (65 ± 6% of control uptake) and complete inhibition with 20 µM quercetin (<5 ± 3% of control uptake; Fig. 1B
). The inhibition of [3H]thymidine incorporation into DNA is maximal at 24 h, and no significant further inhibition is seen after 48 and 72 h of treatment (Fig. 1B
).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1. FRTL-5 cell growth inhibition by quercetin. A, Cell proliferation assayed by cell number using trypan blue dye exclusion. FRTL-5 cells were inoculated at a density of 2 x 104/well in 24-well culture plates. After overnight incubation in 6H5% medium, cells were cultured in 6H5% medium with 10 µM quercetin or the same amount of vehicle (0.5% ethanol; time 0 in the graphic). After 24, 48, and 72 h, cell proliferation was assayed by trypan blue dye exclusion. Data points represent the mean of three separate experiments and are expressed as mean ± SD of the number of cells from quadruplicate hemocytometric counts. Vehicle had no effect (data not shown). B, Inhibition of tritiated thymidine incorporation into DNA by quercetin. FRTL-5 cells plated in 24-well plates in 6H5% medium were treated with various concentrations of quercetin for 24, 48, and 72 h. [3H]thymidine was added to each well 24 h before the termination of each experiment. Results are presented as counts per minute of [3H]thymidine incorporated per microgram of DNA in 24 h. The data represent the mean ± SD of three different experiments performed in triplicate.
|
|
Signal pathways involved in FRTL-5 cells growth inhibition by quercetin
It has been reported that one of the mechanisms by which quercetin suppress growth in cancer cells is through an increase of TGF-β1 activity (39, 40). This increase is time dependent (starting after 4 h of treatment and reaching a maximum after 24 h) and occurs at a posttranscriptional level. TGF-β1 inhibits cell proliferation in different thyroid cell culture systems through phosphorylation of Smad proteins and their translocation to the nucleus in which they bind to an SBE (41, 42, 43). To verify whether TGF-β1 signal modulation is involved in the quercetin effect on FRTL-5 growth, we transfected these cells with a luciferase reporter construct containing five Smad binding elements. Twenty-four hours after transfection, cells were treated with quercetin (10 µM), wortmannin (250 nM), or TGF-β1 (5 nM) for 24 h. No increase of luciferase activity was seen with quercetin or wortmannin treatment, whereas TGF-β1 increased it more than 60-fold (Fig. 2A
). Moreover, quercetin treatment (10 µM for 24 h) did not induce an increase of TGF-β1 protein in FRTL-5 cells or modify the activity of the endogenous inhibitor of the TGF-β pathway: Smad-7, as measured by Western blotting analysis (Fig. 2B
) These data show that in thyroid cells, the growth-inhibitory effect of quercetin does not involve an activation of the TGF-β1/Smad pathway.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2. The growth-inhibitory effect of quercetin does not involve an activation of the TGF-β1/Smad pathway. A, Effects of quercetin, wortmannin, and TGF-β1 on the promoter activity of a pSmad-Luciferase construct transfected into FRTL-5 cells. Cells grown to 60% confluency in 6H5% medium were transiently transfected, as described in Materials and Methods, with the pSmad-Luc chimera and the pRL-TK vector (as internal control of transfection efficiency). Twenty-four hours after transfection, cells were treated with 10 µM quercetin, 250 nM wortmannin, or 5 nM TGF-β1 for 24 h. The data are expressed as the ratio of the luciferase activity of the two constructs. Cont, Cells treated with the control vehicle (0.5% ethanol); Querc, cells treated with 10 µM quercetin; Wortm, cells treated with 250 nM wortmannin; TGF-β1, cells treated with 5 nM TGF-β1. B, Effects of quercetin on TGF-β1 and Smad-7 expression. Cells were cultured in 6H5% medium ± quercetin or the control vehicle for 24 h. Proteins were extracted from whole cells, and immunoblots were performed as described in Materials and Methods. Representative experiments of data repeated at three independent times are shown.
|
|
Quercetin is an inhibitor of phosphatidylinositol 3-kinase (PI3K) and inhibits Akt phosphorylation (7, 12, 44). It has been demonstrated that the PI3K/Akt pathway has a fundamental role in thyroid cell growth (33, 45, 46). For this reason we evaluated the effect of quercetin on Akt phosphorylation and activity. FRTL-5 cells were grown in 6H5% medium until 60% confluent and then switched to 4H0.2% medium for 6 d to become quiescent. Because it has been shown that in FRTL-5 cells insulin induces Akt phosphorylation and kinase activity within 1 h (33), cells were then cultured for 1 h with 10 µg/ml insulin ± quercetin, wortmannin, LY294002, or the control vehicle. As shown in Fig. 3A
, insulin induces Akt phosphorylation (Fig. 3A
, lane 2 vs. lane 1, upper blot). Similar to a previous study (33), the effect was mimicked by 6H5% medium but not TSH alone (data not shown). Akt phosphorylation is inhibited by quercetin (Fig. 3A
, lane 3 vs. lane 2, upper blot) at the same concentration (10 µM) effective in inhibiting cell proliferation and thymidine incorporation into DNA. As previously reported (33), Akt phosphorylation was also inhibited by the PI3K inhibitors wortmannin (250 nM) (Fig. 3A
, lane 4 vs. 2, upper blot) and LY294002 (50 µM) (lane 5 vs. 2 upper blot). The latter is, in fact, a quercetin derivative that is a specific inhibitor for PI3K (47).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3. Inhibition of Akt phosphorylation and kinase activity by quercetin, wortmannin, and LY294002. A, Inhibition of Akt and p70S6 kinase phosphorylation. FRTL-5 cells were grown in 6H5% medium until 60% confluent and then switched to 4H0.2% medium for 6 d. Cells were then pretreated with quercetin or the PI3K inhibitors, wortmannin and LY294002, for 30 min before the addition of 10 µg/ml insulin ± quercetin, wortmannin, LY294002, or the control vehicle. Phosphorylation of Akt (ser473) and p70S6 kinase (Thr421/Ser424) was detected by Western immunoblotting. B, Inhibition of Akt kinase activity. FRTL-5 cells were grown in 6H5% medium until 60% confluent and then switched to 4H0.2% medium for 6 d. Cells were then pretreated with quercetin or the PI3K inhibitors, wortmannin and LY294002, for 30 min before the addition of the growth medium containing TSH, insulin, and serum (6H5%) ± quercetin, wortmannin, LY294002, or the control vehicle. Phosphorylation of GSK-3 /β was measured by Western immunoblotting using phospho-GSK-3 /β (Ser 21/9) antibody.
|
|
To evaluate the effect of quercetin on a known endogenous target of Akt, we studied the effect on phosphorylation of p70S6 kinase, a Ser/Thr protein kinase known as a downstream Akt effector, which is required for cell growth and G1 cell cycle progression. We observed that insulin activation (phosphorylation) of p70S6 kinase is inhibited by quercetin 10 µM (Fig. 3A
, lane 3 vs. 2, lower blot) and the PI3K inhibitors wortmannin (250 nM) (Fig. 3A
, lane 4 vs. 2, lower blot) and LY294002 (50 µM) (Fig. 3A
, lane 5 vs. 2, lower blot). Again all effects were mimicked when cells were cultured in 6H5% medium (data not shown). The effect of quercetin on Akt activity was further confirmed by an in vitro Akt kinase assay, in which immobilized Akt antibody is used to immunoprecipitate Akt from cell lysates and an in vitro assay is performed using GSK-3
/β fusion protein as substrate. Quiescent FRTL-5 cells in 4H0.2% medium were incubated for 1 h in 6H5% medium containing quercetin, wortmannin, LY294002, or the control vehicle. Cell lysates were immunoprecipitate with immobilized Akt antibody and the complex was incubated with the Akt target GSK-3
/β as described in Materials and Methods. As shown in Fig. 3B
, the addition of 6H5% medium restores Akt kinase activity (Fig. 3B
, lane 2 vs. lane 1). The hormonal activation of Akt kinase is inhibited by quercetin 10 µM (Fig. 3B
, lane 3 vs. lane 2). As previously reported (33), Akt activity was also inhibited by the PI3K inhibitors wortmannin (250 nM) and LY294002 (50 µM) (Fig. 3B
, lanes 4 and 5 vs. 2).
These effects were mimicked when 10 µg/ml insulin was used instead of 6H5% medium (data not shown).
Quercetin and PI3K inhibitors did not have any effect on the feeble basal Akt activity present in quiescent cells (data not shown).
Quercetin down-regulates TSH-increased NIS gene expression in FRTL-5 cells through inhibition of the phospholipase-A2 (PLA2) pathway
The PI3K pathway inhibitors, wortmannin and LY294002, which decrease cell growth, are reported to increase NIS gene expression (48). Because we observed an inhibitory effect of quercetin on PI3K/Akt activity in FRTL-5 cells, we expected that quercetin would also increase NIS gene expression. In contrast, quercetin treatment, 10 µM for 48 h, dramatically decreased NIS RNA expression to 5 ± 3% of control value (Fig. 4A
). The effect was concentration (Fig. 4B
) and time dependent (Fig. 4C
). After 48 h of treatment, a significant decrease of NIS RNA was seen at a concentration of 1 µM (70 ± 4% of control value), with maximal suppression at 10 µM (5 ± 3% of control value; Fig. 4B
). A time-course experiment revealed a significant decrease of NIS RNA after 12 h of treatment with 10 µM quercetin to 55 ± 5% of control value (Fig. 4C
). The inhibition of the PI3K pathway by quercetin was not involved in NIS RNA down-regulation, as evidenced by the fact that the PI3K inhibitors, LY294002 and wortmannin, as already reported (48) and used as controls, increased NIS gene expression (Fig. 5
, lane 8 vs. 5 and lane 7 vs. 5).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4. Effect of quercetin on NIS RNA levels. A, Effect of 10 µM quercetin on NIS RNA levels. FRTL-5 cells grown to 60% confluency were shifted to 5H5% medium (containing no TSH) for 6 d and then cultured again in 6H5% medium for 24 h and finally treated with quercetin or control vehicle for 48 h. After RNA extraction, Northern analysis was performed using NIS and β-actin probes. A representative blot is presented as is the mean NIS/ β-actin ± SD from five independent experiments. Photostimulating luminescence (PSL) values were obtained after analysis and quantitation with BAS 1500 bioimaging analyzer. Cont, Cells treated with the control vehicle (0.5% ethanol); Querc, cells treated with 10 µM quercetin. B, Effect of quercetin on NIS RNA levels as a function of concentration. Cont, Cells treated with the control vehicle (0.5% ethanol); Q1, Q2.5, Q5, Q10, Q20, cells treated, respectively, with 1, 2.5, 5, 10, and 20 µM quercetin. Data are the mean NIS/ β-actin ± SD from three independent experiments. PSL values were obtained after analysis and quantitation with BAS 1500 bioimaging analyzer. C, Quercetin effect, as a function of time on NIS RNA levels. FRTL-5 cells grown to 60% confluency were treated at the same time with quercetin or control vehicle and cells were harvested after 6, 12, 24, 48, and 72 h of treatment. Cont, Cells treated with the control vehicle (0.5% ethanol); Querc, Cells treated with 10 µM quercetin. Data are the mean NIS/C β-actin ± SD from three separate experiments. PSL values were obtained after analysis and quantitation with BAS 1500 bioimaging analyzer. *, Statistical significant decrease (P < 0.05).
|
|

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 5. Effects of quercetin, ETYA, indomethacin, H89, wortmannin, and LY294002 on NIS RNA levels. FRTL-5 cells grown to 60% confluency were shifted to 5H5% medium (containing no TSH) for 6 d and then cultured again in 6H5% medium for 24 h and finally treated with 10 µM quercetin (Querc), 10 µM ETYA, 100 µM indomethacin (Indom), 10 µM H89 (H89), 500 nM wortmannin (Wortm), 50 µM LY294002, or control vehicles, 0.5% ethanol (Cont ETOH), or 0.5% DMSO (Cont DMSO) for 48 h. A representative Northern blot hybridized with rat NIS and β-actin probes is shown. Similar results were obtained in cells kept on the growing medium 6H5%, i.e. chronically stimulated with TSH.
|
|
The signal transduction mechanisms involved in TSH-induced NIS expression are not yet clear (48, 49). The specific inhibitor of protein kinase A (PKA), H89, only partially decreased NIS expression and did not reproduce the quercetin effect (Fig. 5
, lane 6 vs. 5), suggesting, perhaps surprisingly, that inhibition of a critical downstream component of the cAMP signal system was not playing a critical role. However, using ETYA (10 µM for 48 h), an inhibitor of the PLA2 pathway, we saw a down-regulation of NIS RNA similar to that obtained with quercetin (Fig. 5
, lane 3 vs. 1). These data suggested that the PLA2 pathway is involved in TSH induction of the NIS gene. We then performed inhibition experiments to explore further downstream of the signal transduction pathway beyond PLA2. As shown in Fig. 5
(lane 4 vs. 1), indomethacin, an inhibitor of cyclooxygenase and prostaglandin synthesis used as a control, did not have any significant effect on NIS RNA levels, whereas NDGA, a selective inhibitor of the lipoxygenase pathway, at 10 and 5 µM for 48 h, decreased NIS RNA level to 7 ± 3 and 52 ± 4% of control value, respectively (Fig. 6A
). The higher dose of NDGA had a slight toxic effect on cells that was not seen with the lower concentration and was thus not used in subsequent experiments.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 6. Effect of the lipoxygenase inhibitors on NIS RNA levels. A, Effect of NDGA on NIS RNA levels. FRTL-5 cells grown to 60% confluency were shifted to 5H5% medium (containing no TSH) for 6 d and then cultured again in 6H5% medium for 24 h and finally treated with 5 and 10 µM NDGA or control vehicles (ethanol 0.5%) for 48 h. A representative blot is presented as is the mean NIS/β-actin ± SD of three separate experiments. Cont, Cells treated with the control vehicle (ETOH 0.5%). B, Effect of baicalein and MK-886 on NIS RNA levels. FRTL-5 cells grown to 60% confluency were shifted to 5H5% medium (containing no TSH) for 6 d and then cultured again in 6H5% medium for 24 h and finally treated with 20 µM baicalein and 40 µM MK-886 or control vehicles (0.5% ethanol) for 48 h. Data are the mean NIS/β-actin ± SD of three separate experiments. Cont, Cells treated with the control vehicle (0.5% ETOH). *, Statistical significant decrease (P < 0.05).
|
|
These results suggest an involvement of the lipoxygenase pathway in the regulation of NIS gene expression in FRTL-5 thyroid cells.
We then treated the cells with two specific inhibitors of the lipoxygenase pathway: baicalein, a specific inhibitor of the 12-lipoxygenase pathway, and MK-886, a specific inhibitor of the 5-lipoxygenase pathway that prevents the activation of 5-lipoxygenase by binding to 5-lipoxygenase-activating protein. As shown in Fig. 6B
, baicalein at 20 µM for 48 h did not have any significant effect on NIS RNA levels (87.7 ± 7% of control values), whereas MK-886 (40 µM for 48 h) decreased NIS RNA levels to 9.8 ± 8% of control value.
These results suggest that it is the 5-lipoxygenase pathway to be specifically involved in the regulation of the NIS gene.
Quercetin down-regulation of NIS gene expression results in a decrease of I– uptake by FRTL-5 cells
We asked whether the effect of quercetin in NIS RNA level was associated with a decreased activity of I– uptake. FRTL-5 cells were grown in 6H5% medium until 60% confluent and then switched to 5H5% medium (without TSH) for 6 d. This results in a complete loss of the ability of cells to concentrate iodide and in very low levels of NIS RNA (38, 50). Cells were then shifted to medium with TSH (1 mU/ml) and quercetin (10 µM), NDGA (5 µM), or the vehicle control (0.5% ethanol). After 48 h of treatment, I– uptake was measured as described in Materials and Methods. As shown in Fig. 7
, quercetin significantly decreased the TSH induction of I– uptake. NDGA, the selective inhibitor of the lipoxygenase pathway, reproduced the effect of quercetin on I– uptake, suggesting a role of the PLA2/lipoxygenase pathway in the regulation of NIS activity (Fig. 7
).

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 7. Effect of quercetin and NDGA on TSH induction of I– uptake in FRTL-5 cells. Cells were grown in 12-well plates to 60% confluency and shifted in 5H5% medium (without TSH) for 6 d and then TSH (1 mU/ml) was added + quercetin, NDGA, or control vehicle (0.5% ethanol) for 48 h. Values, expressed as picomoles per microgram of DNA, are the mean ± SD of three separate experiments performed in triplicate. Cont, Cells maintained in 5H5% medium (without TSH); TSH, cells with 1 mU/ml TSH + 0.5% ethanol; TSH + Q, cells with 1 mU/ml TSH + 10 µM quercetin; TSH + NDGA, cells with 1 mU/ml TSH + 5 µM NDGA. *, Statistical significant decrease (P < 0.05).
|
|
 |
Discussion
|
|---|
In the present report, we show that quercetin inhibits FRTL-5 cell growth and inhibits function by apparently specifically down-regulating the expression of NIS gene and function.
In the last years, interest has grown about the potential health benefits of flavonoids due to their antioxidant and antiproliferative effects. Epidemiological observations and clinical trials have shown a potential benefit for cancer, cardiovascular, and inflammatory diseases (6, 7, 8, 9, 10). As a consequence there has been an increase in the use of these compounds as therapeutics and a dramatic increase in the consumption of dietary or antiaging supplements containing high concentrations of flavonoids. Tablets containing up to 300 mg of quercetin are freely available in drugstores or through the Internet, without any medical control. This could result in an intake up to 100 times higher than the dietary intake in a normal Western diet (5).
The excessive consumption of flavonoids at a concentration that far exceeds the dose that one usually gets from a typical vegetarian diet has raised concerns about the potential health risk (5, 13). It has been known that quercetin, like other flavonoids, has antithyroid properties (14, 15, 16, 17, 18). The mechanism of the antithyroid effect of flavonoids has been ascribed to inhibition of TPO, thyroid type I deiodinase, and hepatic type I 5' and 5-deiodinase activity (14, 15, 16, 17, 18). Moreover, some flavonoids have an antiproliferative effect on human thyroid cancer cell lines (20, 21) and are reported to modulate NIS expression and iodide uptake in these (21) and the FRTL-5 thyroid cell line (51). We were interested to further investigate the effect of quercetin on thyroid growth, gene expression, and iodide uptake as well as the mechanisms underlying these effects in the latter cell line (FRTL-5), given its relatively normal hormonal responsiveness by comparison with the human thyroid. We studied quercetin among the several kinds of flavonoids because it is the most abundant flavonoid present in foods and dietary supplements and because it is already in use as a therapeutic agent in some inflammatory diseases and has been tested in clinical trials in cancer patients (1, 2, 3, 22, 24, 25, 26, 27, 52). Using FRTL-5 cells as an in vitro model of thyroid cells, which retain all the properties of normal thyroid cells, we observed that quercetin inhibits cell growth and specifically appears to decrease the RNA levels of NIS gene by different mechanisms, despite its ability to inhibit both activities at in a similar concentration-dependent manner.
An inhibitory effect of other flavonoids, but not quercetin, has been reported in tumor thyroid cell lines (20, 21). This, however, is the first report that shows an inhibitory effect of quercetin on the growth of nontransformed thyroid cells. It has been reported that in some type of cancer cells, the antiproliferative effect of quercetin is mediated by TGF-β1. Thus, quercetin induces a release of TGF-β1 that acts in an autocrine manner inhibiting cell growth (39, 40). Because TGF-β1 inhibits growth in several thyroid culture cells including FRTL-5 through phosphorylation of Smad proteins (41, 42, 43), we investigated whether this was the mechanism involved in the quercetin antiproliferative effect. Using FRTL-5 cells transfected with a reporter construct containing five Smad binding elements, we could not see any induction of promoter activity by quercetin, whereas the addition of exogenous TGF-β1 induced a large increase in reporter gene activity. Furthermore, quercetin treatment did not induce an increase of TGF-β1 protein in FRTL-5 cells or modify the activity of the endogenous inhibitor of the TGF-β pathway: Smad-7. These results suggest that the TGF-β1/Smad system is not involved in the quercetin effect on growth in FRTL-5 cells.
Quercetin inhibits PI3K and Akt kinase activity in several cell types (44, 53, 54). It is well known that the PI3K-Akt pathway has a fundamental role in thyroid cell growth (33, 45); moreover, it has been shown that activation of the Akt signaling pathway is an important event in thyroid tumorigenesis (46, 55, 56). In this report we show that quercetin decreases Akt activity in FRTL-5 cells, suggesting this might be the molecular mechanism involved in the antiproliferative effect of quercetin in these cells.
We further show that quercetin inhibits not only thyroid growth but also NIS gene expression and iodide uptake. There is very little knowledge about the effect of flavonoids on iodide uptake and NIS expressions. Schröder-van der Elst et al. (21) reported that most flavonoids decrease iodide uptake in a human follicular thyroid cancer cell line stably transfected with human NIS. In that experimental model (21), quercetin significantly decreased iodide uptake, although no effect was seen on NIS gene expression. In our study, we confirmed the inhibition of iodide uptake by quercetin in a model of a nontransformed thyroid cell line, and we show for the first time a down-regulation of NIS RNA levels by quercetin. Quercetin is a known inhibitor of many enzyme systems involved in cell signal transduction such as PI3K, PKA, protein kinase C, and PLA2 (12, 44, 53). In thyroid cells, NIS expression and iodide uptake are certainly regulated by TSH/cAMP (50), but the signal transduction involved is not yet clear (49, 57). Inhibition of the PI3K pathway by quercetin is not involved in NIS RNA down-regulation because the PI3K inhibitors, LY294002 and wortmannin, as already reported (48), increase NIS gene expression (see also Fig. 5
). The PKA inhibitor H89 only partially decreased NIS expression (48) and did not reproduce the quercetin effect (Fig. 5
).
In the present study, we demonstrate the novel result that the quercetin-induced decrease in TSH-increased NIS RNA levels and iodide uptake are mimicked by inhibitors of the PLA2 and lipoxygenase pathways, ETYA, NDGA, and MK-886. These data suggest that the inhibition of the PLA2/lipoxygenase pathway could be the mechanism by which quercetin decreases NIS gene expression and iodide uptake. The PLA2 and lipoxygenase pathways are integrally involved in the regulation of iodide efflux and thyroglobulin iodination in thyroid cells (58), but to our knowledge there are no data about its involvement in iodide uptake and NIS gene regulation. From the data reported in the present study, we speculate that TSH/cAMP acts through the activation of the PLA2/lipoxygenase pathway to induce iodide uptake and NIS gene expression in thyroid cells. Our hypothesis is that NIS gene regulation by TSH/cAMP is similar to that of the StAR gene in steroidogenic cells by the trophic hormone/cAMP pathway (59). Further experiments are in progress to confirm this hypothesis.
An important point that needs to be emphasized is that the effects of quercetin on FRTL-5 cell growth, function, and gene expression are observed using concentrations that have been detected in human plasma. In fact, plasma levels of approximately 1 µM quercetin are detected after a vegetarian meal rich in flavonoids (1, 4, 60, 61). Because the half-life of quercetin is approximately 25 h, is it possible that a repeated intake of the compound could lead to higher plasma concentrations (4, 61). Moreover, the amount of quercetin in dietary supplements exceeds more than 100 times the dose ingested with a vegetarian diet (5), and in cancer patients treated with quercetin, the serum concentration reached 200–400 µM (26, 62).
The data reported in the present study, although based on in vitro experiments, allow us to hypothesize that an important role of quercetin is as an endocrine disruptor. The role of quercetin as a disruptor of thyroid function has been further confirmed by the observation that quercetin at the same conditions effective on down-regulated NIS gene expression specifically decreased the expressions of other thyroid-restricted genes, TSH receptor, thyroglobulin, and TPO (data not shown; Giuliani, C., G. Napolitano, M. Piantelli, F. Monaco, and L. D. Kohn, manuscript in preparation). Given the increased use of quercetin as dietary supplement and therapeutic agent, the untoward effects on thyroid function should be considered, included a possible inhibition of radioiodine uptake in thyroid cancer patients. In vivo studies are needed to confirm this hypothesis. Nevertheless, in a potential silver lining transcending the role of quercetin as an endocrine disruptor, the present data suggest it may have a potential role as an antithyroid drug in hyperthyroidism. This hypothesis naturally needs to be confirmed by in vivo studies.
In summary, our data show that quercetin inhibits thyroid growth, acting, at least in part, by inhibiting PI3K/Akt activity. Quercetin also down-regulates NIS gene RNA levels and iodide uptake but uses a different mechanism for this. The effect of quercetin on NIS RNA level and iodide uptake is reproduced by inhibitors of the PLA2/lipoxygenase pathways; thus, these data suggest an involvement of this pathway in the regulation of NIS gene and function. These observations broaden our knowledge on the antithyroid properties of quercetin and that it is particularly important because the increased use of quercetin as therapeutic drug and dietary supplements. A broader knowledge of quercetin action on thyroid growth and function may also be useful to identify the potential use of this compound as antithyroid therapy in hyperthyroidism in association with thionhamides or as their alternative.
 |
Acknowledgments
|
|---|
The authors are grateful to Massimo Ruzzi and Christian Mazzocco for their technical assistance.
 |
Footnotes
|
|---|
Disclosure Statement: The authors have nothing to disclose.
First Published Online October 25, 2007
Abbreviations: ETYA, 5,8,11,14-Eicosatetranoic acid; GSK, glycogen synthase kinase; 4H0.2%, medium with no TSH, no insulin, and 0.2% calf serum; 6H5%, medium of Coons modified Hams F-12 supplemented with 5% calf serum, glutamine, nonessential amino acids, and a mixture of six hormones; HBSS, Hanks balanced salt solution; HRP, horseradish peroxidase; Luc, luciferase; NDGA, nordihydroguaiaretic acid; NIS, sodium/iodide symporter; PI3K, phosphatidylinositol 3-kinase; PLA2, phospholipase-A2; SBE, Smad consensus binding element; Smad, phosphorylated mothers against decapentaplegic; TPO, thyroperoxidase.
Received May 9, 2007.
Accepted for publication October 12, 2007.
 |
References
|
|---|
- Erlund I, Freese R, Marniemi J, Hakala P, Alfthan G 2006 Bioavailability of quercetin from berries and the diet. Nutr Cancer 54:13–17[CrossRef][Medline]
- Manach C, Williamson G, Morand C, Scalbert A, Rémésy C 2005 Bioavailability and bioefficacy of polyphenol in humans. I. Review of 97 bioavailability studies. Am J Clin Nutr 81(Suppl 1):230S–242S
- Manach C, Scalbert A, Morand C, Rémésy C, Jiménez L 2004 Polyphenol: food sources and bioavailability. Am J Clin Nutr 79:727–747[Abstract/Free Full Text]
- Williamson G, Manach C 2005 Bioavailability and bioefficacy of polyphenol in humans. II. Review of 93 intervention studies. Am J Clin Nutr 81(Suppl 1):243S–255S
- Mennen LI, Walker R, Bennetau-Pelissero C, Scalbert A 2005 Risks and safety of polyphenol consumption. Am J Clin Nutr 81(Suppl 1):326S–329S
- Caltagirone S, Rossi C, Poggi A, Ranelletti FO, Natali PG, Brunetti M, Aiello FB, Piantelli M 2000 Flavonoids apigenin and quercetin inhibit melanoma growth and metastatic potential. Int J Cancer 87:595–600[CrossRef][Medline]
- Fresco P, Borges F, Diniz C, Marques MPM 2006 New insights on the anticancer properties of dietary polyphenols. Med Res Rev 26:747–766[CrossRef][Medline]
- Piantelli M, Rossi C, Iezzi M, La Sorda R, Iacobelli S, Alberti S, Natali PG 2006 Flavonoids inhibit melanoma lung metastasis by impairing tumor cells endothelium interactions. J Cell Physiol 207:23–29[CrossRef][Medline]
- Ramassamy C 2006 Emerging role of polyphenolic compounds in the treatment of neurodegenerative diseases: a review of their intracellular targets. Eur J Pharmacol 545:51–64[CrossRef][Medline]
- Stoclet J-C, Chataigneau T, Ndiaye M, Oak M-H, Bedoui JE, Chataigneau M, Schini-Kerth VB 2004 Vascular protection by dietary polyphenols. Eur J Pharmacol 500:299–313[CrossRef][Medline]
- Arts ICW, Hollman PCH 2005 Polyphenols and disease risk in epidemiologic studies. Am J Clin Nutr 81(Suppl 1):317S–325S
- Middleton E, Kandaswami C, Theoharides TC 2000 The effects of plant flavonoids on mammalian cells: implications for inflammation, heart disease, and cancer. Pharmacol Rev 52:673–751[Abstract/Free Full Text]
- Galati G, OBrien PJ 2004 Potential toxicity of flavonoids and other dietary phenolics: significance for their chemopreventive and anticancer properties. Free Radic Biol Med 37:287–303[CrossRef][Medline]
- Gaitan E 1993 Antithyroid compounds. In: Monaco F, Satta MA, Shapiro B, Troncone L, eds. Thyroid diseases: clinical fundamental and therapy. Boca Raton, FL: CRC Press
- Divi RL, Doerge DR 1996 Inhibition of thyroid peroxidase by dietary flavonoids. Chem Res Toxicol 9:16–23[CrossRef][Medline]
- Ferreira ACF, Lisboa PC, Oliveira KJ, Lima LP, Barros IA, Carvalho DP 2002 Inhibition of thyroid type 1 deiodinase activity by flavonoids. Food Chem Toxicol 40:913–917[CrossRef][Medline]
- van der Heide D, Kastelijn J, Schröder-van der Elst JP 2003 Flavonoids and thyroid disease. Biofactors 19:113–119[Medline]
- Hamann I, Seidlova-Wuttke D, Wuttke W, Köhrle J 2006 Effects of isoflavonoids and other plant-derived compounds on the hypothalamus-pituitary-thyroid hormone axis. Maturitas 55S:S14–S25
- Schröder-van der Elst JP, van der Heide D, Rokos H, Köhrle J, Morreale de Escobar G 1997 Different tissue distribution, elimination, and kinetics of thyroxine and its conformational analog, the synthetic flavonoid EMD 49209 in the rat. Endocrinology 138:79–84[Abstract/Free Full Text]
- Yin F, Giuliano AE, Van Herle AJ 1999 Growth inhibitory effects of flavonoids in human thyroid cancer cell lines. Thyroid 9:369–376[Medline]
- Schröder-van der Elst JP, van der Heide D, Romijn JA, Smit JWA 2004 Differential effects of natural flavonoids on growth and iodide content in a human Na+/I– symporter-transfected follicular thyroid carcinoma cell line. Eur J Endocrinol 150:557–564[Abstract]
- Katske F, Shokes DA, Sender M, Poliakin R, Gagliano K, Rajfer J 2001 Treatment of interstitial cystitis with a quercetin supplement. Tech Urol 7:44–46[Medline]
- Prior RL 2003 Fruits and vegetables in the prevention of cellular oxidative damage. Am J Clin Nutr 78(Suppl 1):570S–578S
- Shoskes D, Lapierre C, Cruz-Corra M, Murve N, Rosario R, Fromkin B, Braun M, Copley J 2005 Beneficial effects of the bioflavonoids curcumin and quercetin on early function in cadaveric renal transplantation: a randomized placebo controlled trial. Transplantation 80:1156–1159
- Hubbard GP, Wolffram S, Lovegrove JA, Gibbins JM 2005 Ingestion of quercetin inhibits platelet aggregation and essential components of the collagen-stimulated platelet activation pathway in humans. J Thromb Haem 2:2138–2145
- Mulholland PJ, Ferry DR, Anderson D, Hussain SA, Young AM, Cook JE, Hodgkin E, Seymour LW, Kerr DJ 2001 Pre-clinical and clinical study of QC12, a water-soluble, pro-drug of quercetin. Ann Oncol 12:245–248[Abstract/Free Full Text]
- MacRae HS, Mefferd KM 2006 Dietary antioxidant supplementation combined with quercetin improves cycling time trial performance. Int J Sport Nutr Exerc Metab 16:405–419[Medline]
- Ambesi-Impiombato FS 1986 Fast-growing thyroid cell strain. U.S. Patent 4608341
- Kohn LD, Valente WA, Grollman EF, Aloj SM, Vitti P 1986 Clinical determination and/or quantification of thyrotropin and a variety of thyroid stimulatory or inhibitory factors performed in vitro with an improved thyroid cell line FRTL-5. U.S. Patent 4609622
- Kohn LD, Valente WA 1989 FRTL-5 manual: a current guide. In: Ambesi-Impiombato FS, Perrild H, eds. FRTL-5 today. Amsterdam: Excerpta Medica; 243–273
- Bellur S, Tahara K, Saji M, Grollman EF, Kohn LD 1990 Repeatedly passed FRTL-5 rat thyroid cells can develop insulin and insulin-like growth factor-I-sensitive cyclooxygenase and prostaglandin E2 isomerase-like activities together with altered basal and thyrotropin-responsive thymidine incorporation into DNA. Endocrinology 127:1526–1540[Abstract/Free Full Text]
- Saji M, Moriarty J, Ban T, Singer DS, Kohn LD 1992 Major histocompatibility complex class I gene expression in rat thyroid cells is regulated by hormones, methimazole and iodide as well as interferon. J Clin Endocrinol Metab 75:871–878[Abstract]
- Saito J, Kohn AD, Roth RA, Noguchi Y, Tatsumo I, Hirai A, Suzuki K, Kohn LD, Saji M, Ringel MD 2001 Regulation of FRTL-5 thyroid cell growth by phosphatidylinositol (OH) 3 kinase-dependent Akt-mediated signaling. Thyroid 11:339–351[CrossRef][Medline]
- Giuliani C, Saji M, Bucci I, Fiore G, Liberatore M, Singer DS, Monaco F, Kohn LD, Napolitano G 2006 Transcriptional regulation of major histocompatibility complex class I gene by insulin and IGF-I in FRTL-5 thyroid cells. J Endocrinol 189:605–615[Abstract/Free Full Text]
- Lopata MA, Cleveland DW, Sollner-Webb B 1984 High level expression of a chloramphenicol acetyl transferase gene by DEAE-dextran mediated DNA transfections coupled with a dimethylsulfoxide or glycerol shock treatment. Nucleic Acids Res 12:5707–5717[Abstract/Free Full Text]
- Isozaki O, Emoto N, Tsuhima T, Sato Y, Shizume K, Demura H, Akamizu T, Kohn LD 1992 Opposite regulation of deoxyribonucleic acid synthesis and iodide uptake in rat thyroid cells by basic fibroblast growth factor: correlation with opposite regulation of c-fos and thyrotropin receptor gene expression. Endocrinology 131:2723–2732[Abstract/Free Full Text]
- Saji M, Ikujama S, Akamizu T, Kohn LD 1991 Increases in cytosolic Ca++ down regulate thyrotropin receptor gene expression by a mechanism different from the cAMP signal. Biochem Biophys Res Commun 176:94–101[CrossRef][Medline]
- Weiss SJ, Philp NJ, Grollman EF 1984 Iodide transport in a continuous line of cultured cells from rat thyroid. Endocrinology 114:1090–1098[Abstract/Free Full Text]
- Scambia G, Panici PB, Ranelletti FO, Ferrandina G, De Vincenzo R, Piantelli M, Masciullo V, Bonanno G, Isola G, Mancuso S 1994 Quercetin enhances transforming growth factor β1 secretion by human ovarian cancer cells. Int J Cancer 57:211–215[Medline]
- Larocca LM, Teofili L, Sica S, Piantelli M, Maggiano N, Leone G, Ranelletti FO 1995 Quercetin inhibits the growth of leukemic progenitors and induces the expression of transforming growth factor β1 in these cells. Blood 85:3654–3661[Abstract/Free Full Text]
- Franzen A, Piek E, Westermark B, Dijke ten P, Heldin N-E 1999 Expression of transforming growth factor-β1, activin A, and their receptors in thyroid follicle cells: negative regulation of thyrocyte growth and function. Endocrinology 140:4300–4310[Abstract/Free Full Text]
- Nicolussi A, DInzeo S, Santulli M, Colletta G, Coppa A 2003 TGF-β control of rat thyroid follicular cells differentiation. Mol Cell Endocrinol 207:1–11[CrossRef][Medline]
- Feng X-H, Derynck R 2005 Specificity and versatility in TGF-β signaling through Smads. Annu Rev Cell Dev Biol 21:659–693[CrossRef][Medline]
- Gulati N, Laudet B, Zohrabian VM, Murali R, Jhanwar-Uniyal M 2006 The antiproliferative effect of quercetin in cancer cells is mediated via inhibition of the PI3K-Akt/PKB pathway. Anticancer Res 26:1177–1181[Abstract/Free Full Text]
- De Gregorio G, Coppa A, Cosentino C, Ucci S, Messina S, Nicolussi A, DInzeo S, Di Pardo A, Avvedimento EV, Porcellini A 2007 The p85 regulatory subunit of PI3K mediates TSH-cAMP-PKA growth and survival signals. Oncogene 26:2039–2047[CrossRef][Medline]
- Shinohara M, Chung YJ, Saji M, Ringel MD 2007 AKT in thyroid tumorigenesis and progression. Endocrinology 148:942–947[Abstract/Free Full Text]
- Vlahos CJ, Matter WF, Hui KY, Brown RF 1994 A specific inhibitor of phosphatidylinositol 3-kinase, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002). J Biol Chem 269:5241–5248[Abstract/Free Full Text]
- Garcia B, Santisteban P 2002 PI3K is involved in the IGF-I inhibition of TSH-induced sodium/iodide symporter gene expression. Mol Endocrinol 16:342–352[Abstract/Free Full Text]
- Riesco-Eizaguirre G, Santisteban P 2006 A perspective view of sodium iodide symporter research and its clinical implications. Eur J Endocrinol 155:495–512[Abstract/Free Full Text]
- Kogai T, Endo T, Saito T, Miyazaki A, Kawaguchi A, Onaya T 1997 Regulation by thyroid-stimulating hormone of sodium/iodide symporter gene expression and protein levels in FRTL-5 cells. Endocrinology 138:2227–2232[Abstract/Free Full Text]
- Radovi
B, Schmutzler C, Köhrle J 2005 Xanthohumol stimulates iodide uptake in rat thyroid-derived FRTL-5 cells. Mol Nutr Food Res 49:832–836[CrossRef][Medline] - Theoharides TC 2007 Treatment approaches for painful bladder syndrome/interstitial cystitis. Drugs 67:215–235[CrossRef][Medline]
- Williams RJ, Spencer JPE, Rice-Evans C 2004 Flavonoids: antioxidants or signaling molecules? Free Radic Biol Med 36:838–849[CrossRef][Medline]
- Kim Y-H, Lee YJ 2007 TRAIL apoptosis is enhanced by quercetin through Akt dephosphorylation. J Cell Biochem 100:998–1009[CrossRef][Medline]
- Ringel MD, Hayre N, Saito J, Saunier B, Schuppert F, Burch H, Bernet V, Burman KD, Kohn LD, Saji M 2001 Overexpression and overactivation of Akt in thyroid carcinoma. Cancer Res 61:6105–6111[Abstract/Free Full Text]
- Kim CS, Vasko VV, Kato Y, Kruhlak M, Saji M, Cheng SY, Ringel MD 2005 Akt activation promotes metastasis in a mouse model of follicular thyroid carcinoma. Endocrinology 146:4456–4463[Abstract/Free Full Text]
- Harii N, Endo T, Ohmori M, Onaya T 1999 Extracellular adenosine increases Na+/I– symporter gene expression in rat thyroid FRTL-5 cells. Mol Cell Endocrinol 157:31–39[CrossRef][Medline]
- Marcocci C, Luini A, Santisteban P, Grollman EF 1987 Norepinephrine and thyrotropin stimulation of iodide efflux in FRTL-5 thyroid cells involves metabolites of arachidonic acid and is associated with the iodination of thyroglobulin. Endocrinology 120:1127–1133[Abstract/Free Full Text]
- Stocco DM, Wang X, Jo Y, Manna PR 2005 Multiple signaling pathways regulating steroidogenesis and steroidogenic acute regulatory protein expression: more complicated than we thought. Mol Endocrinol 19:2647–2659[Abstract/Free Full Text]
- Paganga G, Rice-Evans CA 1997 The identification of flavonoids as glycosides in human plasma. FEBS Lett 401:78–82[CrossRef][Medline]
- Hollman PCH, Katan MB 1997 Absorption, metabolism and health effects of dietary flavonoids in man. Biomed Pharmacother 51:305–310[CrossRef][Medline]
- Ferry DR, Smith A, Malkhandi J, Fyfe DW, deTakatsw PG, Anderson D, Baker J, Kerr DJ 1996 Phase I clinical trial of the flavonoid quercetin: pharmacokinetics and evidence for in vivo tyrosine kinase inhibition. Clin Cancer Res 2:659–668[Abstract]