help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2007-1093
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, M.
Right arrow Articles by Liu, Y.-X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, M.
Right arrow Articles by Liu, Y.-X.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference
Medline Plus Health Information
*Heat Illness
*Heel Injuries and Disorders
Hazardous Substances DB
*TESTOSTERONE
Endocrinology Vol. 149, No. 10 4871-4882
Copyright © 2008 by The Endocrine Society

Effect of Heat Stress on Expression of Junction-Associated Molecules and Upstream Factors Androgen Receptor and Wilms’ Tumor 1 in Monkey Sertoli Cells

Min Chen1, Huan Cai1, Jun-Ling Yang, Cui-Ling Lu, Tao Liu, Wei Yang, Jian Guo, Xiao-Qian Hu, Cui-Hong Fan, Zhao-Yuan Hu, Fei Gao and Yi-Xun Liu

State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences Beijing 100101, People’s Republic of China

Address all correspondence and requests for reprints to: Yi-Xun Liu, Professor, State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, People’s Republic of China. E-mail: liuyx{at}ioz.ac.cn.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Sertoli cells are important in determining the fate of spermatogenic cells by providing nutrition and structural support via cell junctions. In this study, we sought to examine the effect of 43 C warming on cell junctions in seminiferous epithelium and the expression of junction-associated molecules in Sertoli cells. Electron microscopy showed the appearance of large vacuoles between Sertoli and germ cells and adjacent Sertoli cells, leading to disruption of corresponding cell junctions 24 h after terminating the heat treatment. Using primary Sertoli cells isolated from pubertal monkey testes, we demonstrated that expression of adherens junction-associated molecules, such as N-cadherin and β-catenin, and tight junction-associated molecule zonula occludens protein 1 was significantly reduced in 24–48 h after heat treatment. In contrast, intermediate filament vimentin expression was up-regulated in 6–48 h. Androgen receptor (AR) and Wilms’ tumor gene 1 expression dramatically decreased after heat treatment. Both proteins completely disappeared immediately after terminating heat treatment and began to recover after 6 h. Treatment of the monkey Sertoli cells with an AR antagonist, flutamide, could mimic the heat-induced changes in the expression of junction-associated molecules in Sertoli cells. Furthermore, overexpression of AR in the Sertoli cells up-regulated the expression of N-cadherin, β-catenin, and zonula occludens protein 1 and down-regulated vimentin expression. Their expression after heat treatment could be rescued by the AR overexpression. These results indicate that the decreased AR expression after heat treatment is involved in heat-induced cell junction disruption.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
PHYSIOLOGICAL SCROTAL HYPOTHERMIA, which is about 2–8 C lower than the body temperature, is necessary for normal spermatogenesis in most mammals (1). Artificial cryptorchidism or local testicular heat treatment induced reversible oligospermia or azoospermia in rodents and monkeys via increased germ cell apoptosis (2, 3, 4, 5, 6, 7). The exact molecular mechanisms of heat-induced germ cell apoptosis are not clear.

Spermatogenesis is dependent upon optimal function of Sertoli cells. They are the only somatic cells in seminiferous epithelium. The number of Sertoli cells determines the germ cell number, and each Sertoli cell can interact with about 30–50 different germ cells at each stage of the spermatogenic cycle (8). Germ cells rely heavily on Sertoli cells for structural and nutritional support. First, testosterone and FSH action on spermatogenesis is regulated via Sertoli cells because germ cells do not have androgen and FSH receptors (9); Second, existence of a well-organized system of cell-cell adhesion junctions in epithelium is a prerequisite for spermatogenesis. Adjacent Sertoli cells form tight junctions (TJs) constituting the blood-testis barrier (BTB), providing a specialized and protected environment for germ cell development. Thus germ cells are dependent on Sertoli cells to supply nutrients and growth factors. Successful migration of developing germ cells across seminiferous tubules is dependent on extensive reassembly of TJs, cell-cell actin-based adherens junctions (AJs), and cell-cell intermediate filament-based desmosome-like junctions, which are located in adjacent Sertoli cells and between Sertoli and germ cells. Disruption of these junctions leads to failure of spermatogenesis (10).

Testosterone and its receptor, androgen receptor (AR), are important for Sertoli cell differentiation and maintaining of spermatogenesis. They have also been demonstrated to play a crucial role in regulating formation of junctional complexes in seminiferous tubules. In the hypophysectomized rat, Sertoli cells became binding incompetent, and daily sperm production was reduced. Testosterone replacement within 2 d after the operation could maintain intact junction and spermatogenesis (11). In vivo and in vitro experiments show that testosterone is important for the adhesion of spermatids to Sertoli cells (12, 13, 14). Testosterone is also essential for TJ development. Testosterone has been reported to cause an early and dose-dependent increase in transepithelial electrical resistance in vitro (15). Fetal exposure to the AR antagonist flutamide affected claudin-11 expression in prepubertal rat when BTB was being formed (16). Testosterone was shown to stimulate claudin-11 and claudin-3 expression in cultured Sertoli cells by acting through its receptor AR. Sertoli cell-specific ablation of AR resulted in an increased permeability of the BTB (17), significantly decreased expression of claudin-11, occludin, laminin {alpha}5, and gelsolin, and increased vimentin expression (18).

Besides AR, Wilms’ tumor gene 1 (WT1), which has a bifunctional role in embryonic gonad formation (19) and spermatogenesis in the adult, is also necessary for cell adhesion in Sertoli cells. WT1 knockdown specifically in mouse Sertoli cells led to dysregulation of AJ-associated genes, AJs loss, and increased germ cell apoptosis (20).

Several reports have demonstrated that mild hyperthermia affected cell ultrastructure (21, 22, 23) and secretion abilities (24, 25, 26, 27, 28) of Sertoli cells. Our earlier data showed that 43 C treatment of adult monkey and rat Sertoli cells could induce reexpression of cytokeratin 18 and liver receptor homolog-1 (LRH-1) in the differentiated cells, which may be regarded as a dedifferentiated feature of the adult Sertoli cells (29, 30), indicating that Sertoli cell function may be altered by heat treatment. However, no evidence of changes in the Sertoli cell junctional complexes was reported after heat treatment. Therefore, we designed in vivo and in vitro experiments to examine the effect of warming to 43 C on cell junctions in the seminiferous epithelium and expression of junction-associated molecules as well as upstream factors AR and WT1 in monkey primary Sertoli cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Antibodies and reagents
The polyclonal antibodies against N-cadherin (sc-7939), β-catenin (sc-7963), zonula occludens 1 (ZO-1) (sc-10804), AR (sc-816), WT1 (sc-192), and specificity protein 1 (Sp1) (sc-14027) were from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). The polyclonal antibody against Sry-related HMG box-9 (Sox9) (AB 5535) was from Chemicon International Inc. (Temecula, CA). The polyclonal antibody against vimentin (ZM-0260) was from Zymed Laboratories Inc. (South San Francisco, CA). The monoclonal antibody against β-actin was from Sigma (St. Louis, MO). Flutamide, ketoconazole, collagenase type IV, deoxyribonuclease (DNase) I, and trypsin were purchased from Sigma. Brilliant SYBR Green QPCR Master Mix was purchased from Stratagene (La Jolla, CA). Testosterone undecanoate was purchased from Xianju Pharmaceutical (Xianju, China). All restriction enzymes and CIP (alkaline phosphatase, calf intestinal) were obtained from New England Biolabs Inc. (Ipswich, MA). Lipofectamine 2000 was purchased from Invitrogen Corp. (Carlsbad, CA). T4 DNA ligase was from Fermentas (Glen Burnie, MD). Gel-Spin DNA Extraction Kit, DNA Pure-Spin Kit, and Plasmid Maxprep Kit were purchased from Tiangen Biotech Co., Ltd. (Beijing, China). The shuttle vector pShuttle-EGFP-CMV and adenoviral vector pAdxsi were purchased from Sinogenomax Co., Ltd. (Beijing, China). HEK 293 cells were obtained from American Type Culture Collection (Manassas, VA).

Animals
The male pubertal (4- to 5-yr-old) rhesus monkeys used for preparation and culture of the Sertoli cells were from Beijing Tiantan Biological Products Corp. Ltd. (Beijing, China). They were healthy and killed for preparation of other special biological reagents. The use of these monkeys was approved by the Institutional Committee on Animal Care and Use of the Ministry of Health of China. Mature male Sprague Dawley rats (2 months old) were obtained from the Experiment Animal Center, Chinese Academy of Sciences. The rats were treated in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. All the protocols had the approval of the Institutional Committee on Animal Care and Use.

Preparation of rhesus monkey Sertoli cells
After anesthesia with pentobarbital sodium (30 mg/kg body weight, iv), testes were obtained from three pubertal rhesus monkeys, each time using aseptic technique. Nine monkeys were used for these experiments. After washing in cold (0–4 C) PBS three to four times, the individual testis was placed in cold PBS (pH 7.4, containing 100 U/ml penicillin and 100 µg/ml streptomycin sulfate). Isolation and purification of the Sertoli cells were completed within 2–3 h after castration.

Sertoli cells were prepared as described (31) with modifications. Briefly, the individual testis was washed several times and decapsulated before being minced into approximately 2-mm pieces. The minced tissues were suspended in cold PBS and shaken vigorously by hand. Seminiferous tubules were recovered after sedimentation at unit gravity for 5 min at 4 C. The wash and sedimentation were repeated three more times to remove red blood cells and Leydig cells. The pellets were then incubated in a PBS solution of 10-fold volume containing 1 mg/ml collagenase IV and 75 U/ml DNase I at 33 C in a shaking water bath (160 oscillations/min) for 30 min and monitored closely to limit clumping of tissue that resulted from overdigestion. Undigested seminiferous tubules could be processed again for additional recovery of cells. After discarding the tissue clumps, the suspensions were centrifuged for 4 min at 90 x g, and the pellets were washed with DMEM/F12 two to three times. A second digestion was performed in PBS solution containing 0.25% trypsin and 75 U/ml DNase I for less than 8 min at room temperature. Fetal bovine serum (FBS) was then added to the suspension to terminate digestion. The suspensions were filtered through an 80-mesh stainless steel filter before being centrifuged for 5 min at 180 x g. The cells were washed twice with DMEM/F12, suspended in DMEM/F12 supplemented with 10% FBS, and cultured at 33 C in a CO2 incubator (5% CO2/95% air). After 40 h culture, the medium was replaced to remove unattached germ cells, and 12–24 h later when cells were confluent, they were ready for freezing. The cells were collected with 0.05% trypsin followed by FBS addition. The cells were harvested and counted before centrifugation for 5 min at 180 x g. After the supernatant was aspirated, the cells were resuspended in freezing medium (60% DMEM/F12, 30% FBS, 10% dimethylsulfoxide). The isolated cells from each testis were frozen in liquid nitrogen for later use in primary culture. Each cryovial containing 107cells in 1.5 ml freezing medium was put immediately into a freezing container, which was then placed in a –70 C refrigerator overnight. Next day, the cryovials were transferred into liquid nitrogen.

The primary monkey Sertoli cell cultures
After thawing, the cells were plated in 35-mm dishes in DMEM/F12 with 10% FBS. The density was 0.2 x 106/cm2 for protein and RNA extractions. For confocal immunohistochemistry, the cells were seeded onto 24- x 24-mm coverslips placed in 35-mm dishes at a density of 0.07 x 106/cm2. Twenty-four hours later, the cells were hypotonically treated with 20 mM Tris (pH 7.4, 22 C) for 3 min to lyse the residual germ cells. Cells were then incubated in DMEM/F12 without FBS for 24 h before treatments.

For heat treatment of cells, the dishes containing the cells were sealed with paraffin membrane and put in a sterile 43 C water bath for 30 min. Then the dishes were immediately put back into the 33 C CO2 incubator. The time immediately after completing the 30-min heat treatment was regarded as 0 min. At various time points between 0 min and 72 h, the cell cultures were terminated for analysis.

To look for possible reasons of heat-induced changes in AR and WT1 expression, the cells were pretreated with cycloheximide (25 µg/ml, 30 min), MG-132 (50 µM, 30 min), or testosterone undecanoate (100 nM, 24 h), respectively, before the heat stress, and collected immediately after completing the 43 C treatment. For evaluating the effect of testosterone undecanoate (100 nM), flutamide (10–6 M), or ketoconazole (2 µg/ml) on the expression of junction-associated molecules, the cells were incubated individually with each of the compounds either alone or in combination of two of the three drugs for 24 h before being collected.

Electron microscopy
Adult male Sprague Dawley rats (2 months old) were used for this experiment. Heat treatment was performed as reported previously (29, 30). Briefly, under light sedation, the rat scrota containing the testes were immersed into a 43 C water bath for 15 min. After the heat treatment, the animals were dried and allowed to recover from the effect of the anesthesia. Rats without the heat treatment served as controls. At 6 or 24 h after treatment, the rats were killed by CO2 asphyxiation. The testes were immersed in 2.5% glutaraldehyde/0.1 M sodium cacodylate (pH 7.4, 22 C) and incised to release the seminiferous tubules. The tissues were fixed for 2–4 h at room temperature, followed by postfixation in 1% osmium tetroxide. The samples were further processed using the standard techniques for electron microscopy and photographed on an electron microscope (JEOL, Peabody, MA).

Generation of adenoviral vector and infection of the primary monkey Sertoli cells
The vector expressing human AR, pSG5-AR, was kindly gifted from Professor Chawnshang Chang (32). A replication-defective recombinant adenoviral vector expressing human AR was prepared as described previously (33, 34). Briefly, the full-length coding sequence of AR was subcloned from pSG5-AR into the shuttle vector pShuttle-EGFP-CMV. The resultant plasmid encoded AR gene under control of a cytomegalovirus promoter followed with green fluorescent protein (GFP) gene under control of a second promoter. The sequences of AR and GFP were then subcloned into the adenoviral vector pAdxsi. The recombinant adenoviral construct was linearized with PacI and transfected into packaging cell line 293. After adenovirus production, the 293 cells were frozen and thawed several times to release intracellular viral particles. The titer of the virus stock was assessed as 2 x 1010 plaque formation unit (pfu)/ml by a plaque formation assay using 293 cells.

The monkey Sertoli cells were thawed and plated in 35-mm dishes at a density of 0.2 x 106/cm2 in DMEM/F12 containing 10% FBS. Twenty-four hours later, the cells were hypotonically treated as described above. After culture in serum-free medium for 24 h, the cells were incubated with adenoviral vector at a multiplicity of infection (MOI) of 2, 10, or 20 pfu/cell for 2 h under gentle agitation. Subsequently, medium was changed, and the cells were incubated in DMEM/F12 without FBS until assay. The 43 C treatment was performed 24 h after infection. An adenovirus-GFP was used as the control.

Western blotting
After two washes with PBS, the Sertoli cells were lysed in cold lysis buffer (PBS containing 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, supplemented with 100 µg/ml phenylmethylsulfonyl fluoride and 1 µg/ml aprotinin). The supernatants after centrifugation (13,000 x g, 20 min) were collected, and the total protein concentrations were determined by colorimetry, using BSA as a standard. Fifty micrograms total protein of each sample per lane were separated by 10% SDS-PAGE and transferred to the nitrocellulose membranes (Bio-Rad Laboratories, Hercules, CA). After blocking in 5% nonfat milk in 0.09% NaCl, 0.05% Tween 20, 100 mm Tris-HCl (pH 7.5) for 1 h at room temperature, the membranes were incubated with the primary antibodies N-cadherin (1:800), β-catenin (1:800), ZO-1 (1:800), vimentin (1:200), AR (1:500), WT1 (1:500), and β-actin (1:5000), respectively, in the blocking solution for 2 h at room temperature or 4 C overnight. The membranes were washed three times and then incubated with the corresponding peroxidase-conjugated secondary antibodies (1:2500) for 1 h at room temperature. Reactive bands were visualized by Super-Signal West Pico chemiluminescent substrate (Pierce, Rockford, IL) and exposure to film. Band intensities were determined by Quantity One software (Bio-Rad).

Confocal immunohistochemistry
After two washes with PBS, the Sertoli cells were fixed in a freshly prepared mixture of methanol and acetone (1:1) for 15 min at room temperature, followed by washing with PBS and incubation in 3% BSA for 1 h. Then the cells were immunolabeled with the primary antibody (1:150) for 2 h and the corresponding fluorescein isothiocyanate-conjugated IgG (1:200) for 1 h at room temperature. After three washes in PBS, propidium iodide (PI) incubation for 10 min was used to reveal nuclei. Finally, the cells were analyzed by confocal laser scanning microscope (Carl Zeiss Inc., Thornwood, NY). For the negative controls, the cells were processed without the primary antibodies, which were replaced with the normal rabbit or mouse IgG.

Real-time PCR
A two-step real-time RT-PCR was used to measure expression of the candidate genes. Total cell RNA was isolated with Trizol reagent according to the instructions of the manufacturer and quantified by measuring absorbance at 260 nm. Total RNA (2 µg) was reverse-transcribed into cDNA in a 20-µl reaction containing Superscript III reverse transcriptase (Invitrogen, San Diego, CA), oligo (deoxythymidine), deoxynucleotide triphosphates, and ribonuclease inhibitor, followed by a dilution with ribonuclease-free water in the ratio of 1:4. The primers specific to the candidate genes were designed using Primer 3 software. The primer pairs were designed as follows (5' to 3'): N-cadherin sense, CCATCACTCGGCTTAATGGT, and antisense, ACCCACAATCCTGTCCACAT (194 bp); β-catenin sense, GAAACGGCTTTCAGTTGAGC, and antisense, CTGGCCATATCCACCAGAGT (166 bp); ZO-1 sense, CAACAGCATCCTTCCACCTT, and antisense, CACAGTTTGCTCCAACGAGA (188 bp); vimentin sense, GAACCAATGAGTCCCTGGAA, and antisense, TCCAGCAGCTTCCTGTAGGT (211 bp); AR sense, TACCAGCTCACCAAGCTCCT, and antisense, GCTTCACTGGGTGTGGAAAT (195 bp); WT1 sense, TTCTCGTTCAGACCAGCTCA, and antisense, TGTGATGGCGGACTAATTCA (206 bp); ribosomal protein L32 (rpl32) sense, GCCCAAGATCGTCAAAAAGA, and antisense, GTTGCACATCAGCAGCACTT (250 bp); β-actin sense, TCCCTGGAGAAGAGCTACGA, and antisense, AGCACTGTGTTGGCGTACAG (194 bp); and GAPDH sense, ACCACAGTCCATGCCATCAC, and antisense, TCCACCACCCTGTTGCTGTA (451 bp). Real-time PCR was carried out in a 96-well plate using an ABI prism 7000 sequence detection system (Applied Biosystems, Foster City, CA). The previously synthesized cDNA was used as the template. Reactions for each time point were performed in triplicate and in a 20-µl reaction containing 2 µl cDNA, 12.5 µl 2x SYBR Green master mix, and 150 nM of each reverse and forward primer specific for the candidate genes. Reactions were run for 40 cycles (95 C for 30 sec, 58 C for 1 min, 72 C for 1 min) after an initial 10-min step at 95 C. The threshold cycle (CT), which indicates the relative abundance of a particular transcript, was calculated for each reaction by the ABI Prism 7000 sequence detection system. The CT values of rpl32 were used as endogenous controls. The relative concentration of the candidate gene expression was calculated using the formula 2–{Delta}{Delta}CT as described in the SYBR Green user manual, and thus the concentration of control sample was 1. Real-time PCR quantification of gene expression level in each sample was the mean of triplicate real-time PCR experiments. For each time point, values are presented as the mean ± SEM of triplicate independent experiments. All gene expression levels were normalized to rpl32 expression levels.

Testosterone RIA
The Sertoli cells were cultured in 35-mm dishes at the density of 0.2 x 106/cm2. After hypotonic shock and culture in serum-free medium for 24 h, the Sertoli cells were incubated with ketoconazole (2 µg/ml), ketoconazole plus flutamide (2 µg/ml and 10–6 M, respectively), or ketoconazole plus testosterone undecanoate (2 µg/ml and 100 nM, respectively) for 24 h. The media were then collected for analysis of testosterone concentrations, which were measured by the standard RIA procedures.

Data analysis and statistics
All monkey Sertoli cell culture experiments were repeated at least three times by using three different monkey cell preparations. For the confocal immunohistochemistry data, one representative picture of three similar results from three separate experiments is presented. The quantitative results are represented as mean ± SEM. Statistical analysis was performed with SPSS (version 13.0; SPSS Inc., Chicago, IL), and one-way ANOVA was used for analyzing the data in different groups. Probability values < 0.05 were considered as significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Purity of the primary monkey Sertoli cell preparations
Purity of the Sertoli cells was evaluated by confocal immunohistochemistry of WT1. WT1 is specifically expressed in Sertoli cells in testis. It is a stable marker of Sertoli cells, and its expression is switched on from early fetal life and then maintained throughout the whole life (35).

WT1 was specifically expressed in the nuclei of monkey Sertoli cells as shown in Fig. 1Go. The purity of the Sertoli cell preparations was 91.4 ± 0.021%, calculated from three different experiments using three different Sertoli cell preparations.


Figure 1
View larger version (26K):
[in this window]
[in a new window]

  		FIG. 1. Purity of the cultured primary monkey Sertoli cells. Sertoli cell purity was evaluated by confocal immunohistochemistry of WT1. Sertoli cells were isolated from pubertal monkey testes with enzyme digestion. The isolated cells were cultured at 33 C in a CO2 incubator (5% CO2/95% air) for 40 h to remove unattached germ cells. The Sertoli cells were subsequently frozen in liquid nitrogen and thawed when used. After hypotonic shock with 20 mM Tris (pH 7.4, 22 C) and culture in serum-free medium for 24 h, the Sertoli cells were processed for confocal immunohistochemistry. A, Positive staining of WT1; B, nuclei of all the cells stained with PI; C, overlap of A and B. WT1 was specifically expressed in nuclei of Sertoli cells. The arrow and arrowhead point to non-Sertoli cells. The relative proportion of Sertoli cells was 91.4 ± 0.021%, counted from three different experiments using three different Sertoli cell preparations. Bar, 50 µm.

 
Warming at 43 C disrupted junctions of adjacent Sertoli cells and between Sertoli and germ cells
To investigate the action of heat stress on cell junctions, we examined the ultrastructural changes in rat seminiferous tubules after in vivo treatment of testes with 43 C warming. As shown by electron microscopic observation in Fig. 2Go, cell junctions in the normal testis were intact (Fig. 2Go, A and B). Six hours after terminating the heat treatment, the cell junctions began to be disrupted. Intercellular space between the Sertoli cell and the spermatogonia could be observed in some sections (Fig. 2CGo). Large vacuoles appeared in the basement membrane, which made the structure loose (Fig. 2DGo). By 24 h after the heat treatment, damage was more obvious. More vacuoles in the cytoplasm of the Sertoli cells were observed. Some vacuoles appeared between the adjacent Sertoli cells (Fig. 2Go, E and F). These results show that the intact basement membrane, junctions of adjacent Sertoli cells, and junctions between Sertoli and germ cells were disrupted in 24 h by the 43 C warming.


Figure 2
View larger version (147K):
[in this window]
[in a new window]

  		FIG. 2. Electron micrograph of ultrastructural changes in seminiferous epithelium of adult rats before and after local testicular heat treatment. At 6 h (C and D) and 24 h (E and F) after terminating the heat treatment, the testes were collected and processed for the electron microscopy observation. Testes from the normal untreated rats were used as the control (A and B). A, Cross-section of the normal seminiferous tubule. B, BTB between the two adjacent Sertoli cells in the normal seminiferous tubule was intact (black arrows). C, Intercellular space (*) could be observed between Sertoli cell and spermatogonia. Black arrows point to the anchoring junctions. Collagen in the basement membrane was visible clearly (white arrows). D, In the basement membrane, there appeared a large vacuole (*). E, BTB between the adjacent Sertoli cells (boxed region). There were more vacuoles in the Sertoli cell cytoplasm (white arrows). F, Magnified view of the BTB shown in E. Black arrows indicate the BTB between the two Sertoli cells. Some vacuoles appeared in the BTB (*). Magnification, x2500 (A); x20,000 (B, C, D, and F); x8000 (E).

 
Changes in expression of junction-associated molecules in cultured Sertoli cells
Before examining the expression of the target molecules, we investigated expression stability of the three reference molecules with real-time PCR after the heat treatment. We observed β-actin and ribosomal protein L32 (RPL32) were stable, whereas the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was slightly up-regulated by the heat treatment (data not shown). Therefore we used β-actin as the internal control for the Western blot analysis and rpl32 for the real-time PCR.

To further verify effect of 43 C warming on changes in Sertoli cell junctions, we examined expression of AJ-associated molecules, such as N-cadherin and β-catenin, and TJ-associated molecule ZO-1 as well as the intermediate filament vimentin after the 30-min 43 C treatment of the Sertoli cells. The expression profile of N-cadherin and β-catenin in Sertoli cells was similar, as shown in Fig. 3Go. Their mRNA levels declined significantly at 12 h (P < 0.01) and 24 h (P < 0.05) after the heat treatment (Fig. 3AGo). The changes in the protein levels were observed 12–24 h later than those in their mRNAs, which became evident at 24 and 48 h after the heat treatment. N-cadherin protein at 24 h was only one fifth of the normal level (P < 0.01). Both proteins recovered to the normal level at 72 h (Fig. 3BGo). Both N-cadherin and β-catenin proteins were expressed on the membrane of the Sertoli cells but not in the cytoplasm or the nucleus. Adjacent Sertoli cells contacted closely, and the expression of N-cadherin and β-catenin seemed like a net (Fig. 4Go, A and B). The quantitative changes in their expression from the confocal immunohistochemistry were similar to those as observed by Western blot.


Figure 3
View larger version (40K):
[in this window]
[in a new window]

  		FIG. 3. Effect of heat treatment on mRNA and protein expression of N-cadherin, β-catenin, ZO-1, and vimentin in Sertoli cells. Sertoli cells were isolated and cultured as described in Fig. 1Go. After hypotonic shock and culture in serum-free medium for 24 h, the Sertoli cells were incubated at 43 C for 30 min. The time immediately after completing the heat treatment was designated as 0 min. At different time points between 2 and 72 h, the cells were collected and further processed for the measurement. N indicates the untreated control Sertoli cells. A, Real-time PCR analysis. The relative mRNA concentrations each point were calculated as 2–{Delta}{Delta}CT, and the relative concentration of N was 1. B, Western blot analysis. β-Actin was used as an internal control. The relative levels at each point were determined by the ratio of target protein to β-actin as measured by densitometry; In A and B, data are presented as mean ± SEM (n = 3). *, Significantly different at P < 0.05; **, P < 0.01.

 

Figure 4
View larger version (93K):
[in this window]
[in a new window]

  		FIG. 4. Confocal immunohistochemistry analysis of N-cadherin (A), β-catenin (B), ZO-1 (C), and vimentin (D) in Sertoli cells. Sertoli cells were isolated and cultured as described in Fig. 1Go. After hypotonic shock and culture in serum-free medium for 24 h, the Sertoli cells were incubated at 43 C for 30 min. N indicates the untreated control Sertoli cells, 6–72 h represent the time points, respectively, after terminating the 43 C treatment. Green fluorescence indicates positive staining. The nuclei were stained in red using PI. One representative picture of three similar results from three separate experiments is presented. Con, Negative control without the primary antibodies. Bar, 50 µm.

 
The mRNA level of TJ-associated molecule ZO-1 also significantly decreased in a time-dependent manner after the heat treatment, reaching the lowest level at 24 h (P < 0.01) and then recovering to the normal level at 48 h (Fig. 3AGo). The ZO-1 protein level decreased 24 h after the treatment and was more evident at 48 h (P < 0.01) (Fig. 3BGo). ZO-1 was expressed on the membrane of the Sertoli cells. Its changes observed by immunohistochemistry were similar to that measured by Western blot (Fig. 4CGo).

In contrast to the expression of the above junctional molecules, the intermediate filament vimentin mRNA did not change (Fig. 3AGo). Surprisingly, its protein level was dramatically increased in a time-dependent manner after heat treatment, reaching the maximum at 12 h (P < 0.01), about a 3-fold increase as compared with control. The expression began to recover at 48 h (Fig. 3BGo). The difference between vimentin mRNA and protein suggests that the changes in its protein level after the heat treatment may be induced at a posttranscriptional level. Vimentin was mainly localized in the cytoplasm of Sertoli cells (Fig. 4DGo). Its expression change observed by immunohistochemistry resembled that by Western blot.

AR and WT1 reversible inhibition in Sertoli cells by heat treatment
To look for possible regulation and mechanism of heat stress-induced junction disruption, we further investigated changes in expression of upstream factors AR and WT1 after the heat treatment. The mRNA of both AR and WT1 decreased significantly at 0 min, 30 min (P < 0.01), and 2 h after terminating the 30-min heat treatment (Fig. 5AGo). The changes in AR mRNA were more evident than those in WT1. Both mRNAs recovered and returned to the normal levels at 6 h. However, we were surprised to find that AR and WT1 protein expression disappeared in the Sertoli cells immediately after terminating the 30-min 43 C treatment (Fig. 5BGo). The disappearance continued until 6 h later (P < 0.01), and then their expression began to recover and reached the normal level. The time course of the changes in AR and WT1 expression was similar. The expression of two other nuclear proteins, Sox9 and Sp1, in the Sertoli cells was observed to be increased (P < 0.01) or unchanged, respectively, by the 43 C treatment, excluding the possibility of reduction in all nuclear protein expression after the heat treatment (Fig. 5CGo).


Figure 5
View larger version (42K):
[in this window]
[in a new window]

  		FIG. 5. Treatment at 43 C induced a dramatic decrease in AR and WT1 expression in Sertoli cells. Sertoli cells were isolated and cultured as described in Fig. 1Go. After hypotonic shock and culture in serum-free medium for 24 h, the Sertoli cells were incubated at 43 C for 30 min. N indicates the untreated control Sertoli cells. The time immediately after terminating the heat treatment was designated as 0' and 30' to 48 h represent the time points, respectively, after terminating the treatment;. A, Real-time PCR analysis of AR and WT1. The relative concentrations were calculated as 2–{Delta}{Delta}CT, and the relative concentration of N was 1. B, Western blot analysis of AR and WT1. C, Western blot analysis of Sox9 and Sp1. In B and C, β-actin was used as an internal control. The relative levels were determined by the ratio of target protein to β-actin as measured by densitometry. Data in A–C are presented as mean ± SEM (n = 3). *, Significantly different at P < 0.05; **, P < 0.01.

 
To clarify the questionable fast disappearance of AR and WT1 after the heat treatment, we further studied heat treatment of the Sertoli cells for shorter times to more closely examine changes in the two proteins. As shown in Fig. 6AGo, the expression of both proteins began to decrease after 5 min treatment, dramatically declined after 15 min (P < 0.01), and completely disappeared after 30 min. To explore possible reasons for the protein disappearance in cells after heat treatment, the Sertoli cells were pretreated with protein synthesis inhibitor cycloheximide, testosterone undecanoate, or MG-132, respectively, before the heat stress. Cycloheximide or testosterone undecanoate did not change the heat-induced loss of AR and WT1 protein expression, although testosterone undecanoate alone led to increasing AR expression in the untreated Sertoli cells by stabilizing AR protein against protease degradation (P < 0.01), as shown in Fig. 6BGo. Therefore, new protein synthesis may not be involved in the regulation of AR and WT1 protein disappearance. However, preincubation with MG-132, which is an inhibitor of 26S proteasome could weakly resist the loss of AR and WT1 proteins, as shown in Fig. 6CGo.


Figure 6
View larger version (36K):
[in this window]
[in a new window]

  		FIG. 6. Effect of various treatments on the heat-induced loss of AR and WT1 protein expression in Sertoli cells. Sertoli cells were isolated and cultured as described in Fig. 1Go. A, Protein levels of AR and WT1 after the Sertoli cells were incubated at 43 C for the indicated times. B, Sertoli cells were pretreated with cycloheximide (25 µg/ml, 30 min) or testosterone undecanoate (100 nM, 24 h), respectively, before the 43 C treatment and collected immediately after terminating the 30-min heat treatment. C, Cells were pretreated with MG-132 (50 µM, 30 min) before the 30-min 43 C treatment and were collected immediately after terminating the heat treatment. C, Cycloheximide; H, heat treatment; MG, MG-132; N, untreated control Sertoli cells; T, testosterone undecanoate. β-Actin was used as an internal control. The relative levels were determined by the ratio of AR or WT1 to β-actin as measured by densitometry. Data are all presented as mean ± SEM (n = 3). *, Significantly different at P < 0.05; **, P < 0.01.

 
Effect of flutamide or testosterone undecanoate on expression of the junction-associated molecules in Sertoli cells
To explore the possible relation of the disappearance of AR protein to the changes in the junction-associated molecules after heat treatment, we incubated the monkey Sertoli cells with AR antagonist flutamide, testosterone undecanoate, or both for 24 h. As shown in Fig. 7Go, A–C, testosterone undecanoate at the dose and the incubation time used in the experiment did not have an effect on mRNA or protein expression of N-cadherin, β-catenin, and ZO-1; however, it significantly decreased the vimentin protein level (P < 0.05). Addition of flutamide to the normal and testosterone undecanoate-supplemented Sertoli cell culture significantly down-regulated the mRNA and the protein levels of N-cadherin, β-catenin, and ZO-1 while dramatically increasing vimentin protein expression (P < 0.01). The mRNA of vimentin remained unchanged in all the groups (P > 0.05), which was in accordance with the observation in Fig. 3AGo. The expression profile of the junction-associated molecules with flutamide incubation was similar to that induced by the heat treatment.


Figure 7
View larger version (41K):
[in this window]
[in a new window]

  		FIG. 7. Effect of flutamide, testosterone undecanoate, or ketoconazole on expression of the junction-associated molecules in Sertoli cells. Sertoli cells were isolated and cultured as described in Fig. 1Go. N indicates the untreated control Sertoli cells. A–C, Effect of flutamide or testosterone undecanoate on mRNA and protein expression of the junction-associated molecules. After hypotonic shock and culture in serum-free medium for 24 h, the Sertoli cells were incubated with flutamide (F, 10–6 M), testosterone undecanoate (T, 100 nM), or both (T+F) for 18 h (real-time PCR) or 24 h (Western blot or confocal immunohistochemistry). For the heat-treated group, the Sertoli cells were incubated at 43 C for 30 min and collected at 18 h (real-time PCR) or 24 h (Western blot or confocal immunohistochemistry) after terminating the heat treatment. A, Real-time PCR analysis of N-cadherin, β-catenin, ZO-1, and vimentin. The relative concentrations were calculated as 2–{Delta}{Delta}CT, and the relative concentration of N was 1. B, Western blot analysis of N-cadherin, β-catenin, ZO-1, and vimentin. β-Actin was used as an internal control. The relative levels were determined by the ratio of target protein to β-actin as measured by densitometry. C, Confocal immunohistochemistry of N-cadherin (a), β-catenin (b), ZO-1 (c), and vimentin (d). Green fluorescence indicates positive staining. The nuclei were stained in red using PI. One representative picture of three similar results from three separate experiments is presented. Con, Negative control without the primary antibodies. Bar, 50 µm. In A–C, heat indicates 43 C treatment for 30 min; F, addition of flutamide without heat treatment; T, addition of testosterone undecanoate without heat treatment; T+F, addition of testosterone undecanoate and flutamide without heat treatment. D and E, Effect of ketoconazole (K, 2 µg/ml), ketoconazole plus flutamide (K+F, 2 µg/ml and 10–6 M, respectively), or ketoconazole plus testosterone undecanoate (K+T, 2 µg/ml and 100 nM, respectively) on medium testosterone concentration (D) and protein expression of N-cadherin, β-catenin, ZO-1, and vimentin (E). After hypotonic shock and culture in serum-free medium for 24 h, the Sertoli cells were incubated with K, K+F, or K+T for 24 h. D, Testosterone concentrations in the Sertoli cell conditioned media. The concentrations in the K+T group were higher than 3000 ng/dl and not marked in the figure. E, Western blot analysis of N-cadherin, β-catenin, ZO-1, and vimentin. β-Actin was used as an internal control. The relative levels were determined by the ratio of target protein to β-actin as measured by densitometry. In A, B, D, and E, the data are presented as mean ± SEM (n = 3). *, Significantly different at P < 0.05; **, P < 0.01.

 
The action of flutamide on the normal Sertoli cells observed may be due to its antagonistic effect against androgen produced by the few contaminated Leydig cells in the culture. To verify this, we treated the cells with ketoconazole (K), which could block the steroidogenesis in the contaminating Leydig cells, ketoconazole plus flutamide (K+F), or ketoconazole plus testosterone undecanoate (K+T) for 24 h. As shown in Fig. 7DGo, the testosterone concentrations in the media of control Sertoli cells were low, approximately 10 ng/dl. Addition of 2 µg/ml ketoconazole to the cultures decreased the concentrations to 0.015 ng/dl (P < 0.01). The concentrations in the ketoconazole plus testosterone group were higher than 3000 ng/dl and not marked in the figure. The effect of ketoconazole or ketoconazole plus flutamide on expression of junction proteins was similar to that of flutamide. For ZO-1 and vimentin, the action of ketoconazole plus flutamide seemed more evident than that of ketoconazole, but it did not reach the significant level. Addition of testosterone undecanoate to the culture (ketoconazole plus testosterone) recovered the expression of the four junction-associated molecules (P > 0.05) (Fig. 7EGo).

Overexpression of AR rescued disappearance of AR and expression of junction-associated molecules in Sertoli cells after heat treatment
We further constructed an adenovirus-AR vector to overexpress AR in the Sertoli cells. As shown in Fig. 8AGo, AR enhanced GFP expression was detected in greater than 95% of cultured cells at a MOI of 20 pfu/cell. Therefore, the Sertoli cells were infected with adenovirus AR at a MOI of 20 pfu/cell in the subsequent experiments.


Figure 8
View larger version (47K):
[in this window]
[in a new window]

  		FIG. 8. Infection of Sertoli cells with adenovirus AR increased AR expression before and after heat treatment. Sertoli cells were isolated and cultured as described in Fig. 1Go. After hypotonic shock and culture in serum-free medium for 24 h, Sertoli cells were infected with adenovirus AR. A, Overexpression of AR in Sertoli cells by infection with adenovirus AR at a MOI of 2, 10, or 20 pfu/cell, respectively. Sertoli cells were infected with adenovirus AR for 2 h and cultured at 33 C for 24 h. Live cell photographs were taken by confocal laser scanning microscope showing green fluorescence for the overexpressed AR. One representative picture of three similar results from three separate experiments is presented. Bar, 50 µm. B, AR protein levels at different time point (6, 12, 24, and 48 h) after Sertoli cells were infected with adenovirus AR (MOI = 20 pfu/cell). C, AR protein levels after Sertoli cells were infected with adenovirus AR (MOI = 20 pfu/cell) or heat treated for 15 or 30 min. H15' or H30' indicates 43 C treatment for 15 or 30 min, respectively; Ad-AR indicates infection with adenovirus AR; and Ad-AR+H15' or Ad-AR+H30' indicates Sertoli cells were treated at 43 C for 15 or 30 min after infection with adenovirus AR. Treatment at 43 C was performed 24 h after the infection, and the cells were collected immediately after heat treatment. In B and C, N indicates the untreated control Sertoli cells; β-actin was used as an internal control. The relative levels were determined by the ratio of AR to β-actin as measured by densitometry. Data are presented as mean ± SEM (n = 3). *, Significantly different at P < 0.05; **, P < 0.01.

 
AR protein increased significantly 6 h after infection and reached a level about 18-fold greater than the control at 24 h (P < 0.01) (Fig. 8BGo), so 43 C treatment was performed at 24 h after the infection. Although AR protein decreased significantly after the heat treatment, there was still high expression in the Sertoli cells (Fig. 8CGo). Infection of the Sertoli cells with the adenovirus-AR resulted in increasing expression of N-cadherin, β-catenin, and ZO-1, while dramatically decreasing vimentin expression. Moreover, the significant heat-induced changes in expression of the four molecules observed in uninfected Sertoli cells did not occur in the infected cells (Fig. 9Go, A and B). Infection of the Sertoli cells with adenovirus vector without AR (Ad-GFP) did not have an obvious effect on expression of the junction molecules.


Figure 9
View larger version (38K):
[in this window]
[in a new window]

  		FIG. 9. Overexpression of AR in Sertoli cells rescued the expression of N-cadherin, β-catenin, ZO-1, and vimentin after heat treatment. Sertoli cells were isolated and cultured as described in Fig. 1Go. After hypotonic shock and culture in serum-free medium for 24 h, Sertoli cells were infected with adenovirus AR or adenovirus GFP at a MOI of 20 pfu/cell for 2 h. Warming to 43 C was performed at 24 h after the infection, and the cells were collected at 18 h (real-time PCR) or 24 h (Western blot) after terminating the heat treatment. A, Real-time PCR analysis. The relative mRNA concentrations were calculated as 2–{Delta}{Delta}CT, and the relative concentration of N was 1. B, Western blot analysis. β-Actin was used as an internal control. The relative levels were determined by the ratio of target protein to β-actin as measured by densitometry. Ad-AR, Infection with adenovirus AR; Ad-GFP, infection of Sertoli cells with adenovirus GFP; Ad-GFP+H or Ad-AR+H, Sertoli cells were treated at 43 C for 30 min after infection with Ad-GFP or Ad-AR; H, 43 C for 30 min; N, untreated control Sertoli cells. Data are presented as mean ± SEM (n = 3). *, Significantly different at P < 0.05; **, P < 0.01.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We have demonstrated for the first time that 43 C treatment of testes disrupted junctions in adjacent Sertoli cells and between Sertoli and germ cells in seminiferous tubules in vivo. Furthermore, treatment of Sertoli cells in vitro with 43 C warming could affect expression of AJs-, TJs-associated molecules.

Germ cells rely largely on Sertoli cells for structural and nutritional support. Close interactions in adjacent Sertoli cells and between Sertoli and germ cells are based on various cell junctions present in seminiferous epithelium. It has been reported that compounds such as glycerol and cadmium chloride (CdCl2) can perturb TJs and the underlying associated AJs in testis (36, 37). Evidence also shows that gossypol, lonidamine, and its analog AF-2364 can perturb AJs between Sertoli and germ cells (38, 39, 40). All these compounds are known to be capable of inducing germ cell loss from epithelium and inducing infertility without any apparent effect on serum FSH, LH, and testosterone levels (10). They perturb cell junctions by changing expression of junction-associated molecules (41, 42) or interactions between these molecules (43). Consequently, we further investigated the possible effect of heat stress on the expression of AJ- and TJ-associated molecules in vitro.

The cadherin/catenin complex represents the major structural and functional unit of AJs (44). The extracellular domains of the two cadherins in the adjacent cells interact homotypically, and the intracellular domains of the cadherins associate with β- or {gamma}-catenins forming the cadherin/catenin complex. The complex in turn interacts with actin filament bundles via its interaction with vinculin and {alpha}-catenin. N-cadherin interacts with β-catenin at a ratio of almost 1:1 in the testis (45). Therefore, we selected N-cadherin and β-catenin as the marker molecules of AJs in our experiment. ZO-1 is the first TJ-associated cytoplasmic protein subjected to extensive investigation. It is a linker protein coupling the transmembrane TJ proteins such as occludins, claudins, and junction adhesion molecules to the cytoskeleton (46). ZO-1 associates with occludin at a stoichiometric ratio of 1:1 (47). For this reason, ZO-1 was chosen as the marker molecule of TJs. We also examined the intermediate filament vimentin because of Sertoli cells possessing extensive intermediate filament cytoskeleton, which is composed primarily of vimentin (48).

Our evidence has shown that expression of the AJ-associated molecules N-cadherin and β-catenin and the TJ-associated molecule ZO-1 significantly decreased at 24 and 48 h, whereas the expression of vimentin increased dramatically from 6–48 h after heat treatment, indicating that such treatment affects the junction-associated molecules in Sertoli cells. However, the vimentin mRNA did not change after the treatment. The heat-induced change in vimentin protein expression may occur at a posttranscriptional level, which may be the reason why the change in vimentin protein expression is earlier than those in the other proteins. The role of vimentin in Sertoli cells and other cells is not well known. It has been hypothesized that vimentin may have diverse functions such as structural support, plasma membrane-nucleus communication, and cell signaling (49, 50). Lang et al. (51) reported vimentin expression was correlated with cell motility. Evidence has also shown that decreased cell adhesion was accompanied with decreased cell cadherin and catenin expression but with increased cell vimentin expression (52, 53, 54). The correlative changes of decreased cadherin and catenin expression with increased vimentin expression after the heat treatment in our experiments are consistent with previous results.

AR and WT1 expressed in Sertoli cells are indispensable for spermatogenesis (55, 56, 57), and crucial in regulating cell junctions in testis. AR expression appears before Sertoli cell maturation (35). Its expression is stage specific and highest during stages VII–VIII, when new TJs form and premeiotic cells move through the BTB (58). AR is important in regulation of both AJs and TJs. In Sertoli cell-specific AR knockout mouse, the expression level of the junction-associated molecules significantly decreased, whereas the vimentin expression increased (18). This change is similar to that observed in our study. WT1 is a key regulatory factor controlling development of the genitourinary system, and its expression is maintained in Sertoli cells during embryo development as well as in adults (59). WT1 knockout in mice before sex determination results in apoptosis of the genital ridge. Ablation of WT1 function specifically in Sertoli cells after sex determination leads to the disruption of developing seminiferous tubules and subsequent progressive loss of germ cells (60). After birth, knockdown of WT1 in Sertoli cells led to loss of AJs, dysregulation of AJ-associated genes, and increased germ cell apoptosis (20). Consequently, WT1 is essential for both embryogenesis and spermatogenesis. Warming to 43 C of the monkey Sertoli cells induced a reversible loss of both AR and WT1 protein expression. Both protein levels in the Sertoli cells dramatically decreased when Sertoli cells were treated at 43 C for only 15 min and disappeared at 30 min. However, their mRNAs in the cells did not disappear but significantly decreased in a time-dependant manner. Cycloheximide or testosterone undecanoate could not block the ablation of AR and WT1 induced by the heat treatment. However, when the Sertoli cells were preincubated with MG-132, weak expression of AR and WT1 could still be observed after heat treatment. We suppose that AR and WT1 proteins in Sertoli cells after the heat treatment might be degraded quickly by some type(s) of unknown proteases besides 26S proteasome or by other mechanisms. The disappearance of AR protein has also been observed in human prostate cancer cells (LnCaP) after the cells were placed at 44 C for 1 h and then recovered at 37 C for 90 min. However, the mechanism of the 44 C-induced AR loss in LnCaP is not known (61).

It has been reported that AR first appears in Sertoli cells just before the cell final maturation and has been suggested for a marker of mature Sertoli cells (35). However, WT1 maintains its expression in the Sertoli cells throughout embryo and life development. After heat treatment, loss of both AR and WT1 expression suggests a dramatic change in Sertoli cell function, the mechanism of which may be complex and not clear. In human cryptorchid testis, germ cell development and maintenance of spermatogenesis correlated well with local AR expression in Sertoli cells. Absence of AR expression in dysgenetic Sertoli cells precisely correlated with a lack of local spermatogenesis in the tubules (62). Considering the importance of AR and WT1 in spermatogenesis, we suppose that loss of AR and WT1 expression in Sertoli cells in response to heat treatment may be one of the most important causes that lead to germ cell apoptosis.

To further investigate the role of AR in the heat-induced changes in expression of junction molecules, we examined the effect of AR antagonist or its ligand on expression of the four molecules. Earlier studies show that flutamide could reduce occludin expression in rat testis (63); however, no study has addressed flutamide action on junction-associated molecules in Sertoli cells in vitro. We demonstrated in the present study that the effect of flutamide on the Sertoli cells is similar to that of the heat treatment by decreasing the expression of N-cadehrin, β-catenin, and ZO-1 while increasing the vimentin production. Ketoconazole induced the same changes in junction protein expression as flutamide or heat treatment, and testosterone undecanoate could overcome the ketoconazole effect by recovering the expression of the four molecules, suggesting the action of flutamide on the normal Sertoli cells observed in our experiment is due to its antagonistic effect against androgen produced by the few contaminated Leydig cells in the culture. Our earlier evidence showed that the contaminated Leydig cells in the presence of Sertoli cells produced much more testosterone as compared with the Leydig cells cultured alone (64). Testosterone undecanoate alone has no effect on expression of N-cadherin, β-catenin, and ZO-1. This observation is consistent with the earlier report by Perryman et al. (13), showing that testosterone or FSH alone had no effect on the cellular content of N-cadherin.

Furthermore, we used an adenovirus vector to overexpress AR in the Sertoli cells. AR protein did not disappear and was still expressed at a high level in the infected cells after heat treatment. The significant decrease in N-cadherin, β-catenin, and ZO-1 expression along with an increase in vimentin expression in uninfected Sertoli cells after heat treatment was not observed in the infected Sertoli cells. These results provide further evidence to show that AR is involved in the regulation of the junction molecule expression after heat treatment. However, whether the regulation is direct or indirect through other factors still remains for further investigation.

FSH is also important in regulating cell junctions in seminiferous epithelium, especially for formation of ectoplasmic specialization junctions (65, 66). A decrease in FSH receptor protein was also observed in our study, but it occurred at 12–48 h after the heat treatment and overlapped with the changes in the junction molecule expression (unpublished data), implying that FSH receptor may not be involved in regulation of the junction-associated molecule expression. The regulation of cell junctions is complex in which transcriptional mediation, ubiquitination, and endocytosis may be involved (67). Evidence has shown that several cytokines and transcription factors are involved in the regulation (68, 69, 70). Among them TGF-β3 has been extensively studied in regulating cell junctions in the testis. TGF-β3 is found to regulate TJ and AJ dynamics via different signal pathways in vivo and in vitro (41, 43, 71). In addition to AR, we suppose, other molecules such as WT1 and TGF-β3 may also be involved in the regulation of junctional complex expression after the heat treatment. The role of WT1 in Sertoli cells was not documented in this study. We propose that the changes in the junctional complexes regulated through upstream factors affect the supportive function of Sertoli cells and thus may lead to germ cell apoptosis, which occurs most evidently at d 8 in monkey testis after 43 C treatment (7).

In conclusion, this study has demonstrated for the first time that 43 C treatment could disrupt the cell junctions in seminiferous epithelium and dramatically affect expression of the junction-associated molecules in the pubertal monkey Sertoli cells. More importantly, AR and WT1 proteins in Sertoli cells disappear immediately after terminating the 30-min heat treatment. Loss of AR protein in the Sertoli cells plays a role in mediating the expression of the junction-associated molecules after heat treatment. These changes in Sertoli cells impair their supportive function in spermatogenesis, which may induce germ cell apoptosis. AR and WT1 are indispensable for spermatogenesis, and they may function as the upstream factors more than just regulating cell junctions. The loss of AR and WT1 expression by heat stress might have other important actions on Sertoli cells, which remains for further investigation.


   Acknowledgments
 
We sincerely thank Professor Chawnshang Chang, George Hoyt Whipple Lab for Cancer Research, Department of Pathology and Urology, for kindly sending the gift of human AR vector, pSG5-AR, and Professor M. Ram Sairam, Director and Professor of McGill University and University of Montreal, Molecular Reproduction Research Laboratory, Clinical Research Institute of Montreal, for his reading of the manuscript and correcting the language.


   Footnotes
 
This study was supported by the "973" project (2006CB504001), the Major Research Plan (2006CB944001); the CAS Innovation Project (KSCA2-YW-R-55), the National Nature Science Foundation of China (No. 30618005, 30230190, and 30600311); and Beijing Nature Science Foundation (5073032).

Disclosure Statement: The authors have nothing to disclose.

First Published Online June 5, 2008

1 M.C. and H.C. made equal contributions to the manuscript. Back

Abbreviations: AJ, Adherens junction; AR, androgen receptor; BTB, blood-testis barrier; CT, threshold cycle; DNase, deoxyribonuclease; FBS, fetal bovine serum; GFP, green fluorescent protein; MOI, multiplicity of infection; pfu, plaque formation unit; PI, propidium iodide; Sox9, Sry-related HMG box-9; Sp1, specificity protein 1; TJ, tight junction; WT1, Wilms’ tumor gene 1; ZO-1, zonula occludens 1.

Received August 7, 2007.

Accepted for publication May 28, 2008.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Danno S, Itoh K, Matsuda T, Fujita J 2000 Decreased expression of mouse Rbm3, a cold-shock protein, in Sertoli cells of cryptorchid testis. Am J Pathol 156:1685–1692[Abstract/Free Full Text]
  2. Zhang ZH, Jin X, Zhang XS, Hu ZY, Zou RJ, Han CS, Liu YX 2003 Bcl-2 and Bax are involved in experimental cryptorchidism-induced testicular germ cell apoptosis in rhesus monkey. Contraception 68:297–301[CrossRef][Medline]
  3. Tao SX, Guo J, Zhang XS, Li YC, Hu ZY, Han CS, Liu YX 2006 Germ cell apoptosis induced by experimental cryptorchidism is mediated by multiple molecular pathways in cynomolgus macaque. Front Biosci 11:1077–1089[CrossRef][Medline]
  4. Lue YH, Sinha Hikim AP, Swerdloff RS, Im P, Taing KS, Bui T, Leung A, Wang C 1999 Single exposure to heat induces stage-specific germ cell apoptosis in rats: role of intratesticular testosterone on stage specificity. Endocrinology 140:1709–1717[Abstract/Free Full Text]
  5. Lue YH, Lasley BL, Laughlin LS, Swerdloff RS, Sinha Hikim AP, Leung A, Overstreet JW, Wang C 2002 Mild testicular hyperthermia induces profound transitional spermatogenic suppression through increased germ cell apoptosis in adult cynomolgus monkeys (Macaca fascicularis). J Androl 23:799–805[Abstract/Free Full Text]
  6. Lue YH, Wang C, Liu YX, Sinha Hikim AP, Zhang XS, Ng CM, Hu ZY, Li YC, Leung A, Swerdloff RS 2006 Transient testicular warming enhances the suppressive effect of testosterone on spermatogenesis in adult cynomolgus monkeys (Macaca fascicularis). J Clin Endocrinol Metab 91:539–545[Abstract/Free Full Text]
  7. Zhang XS, Lue YH, Guo SH, Yuan JX, Hu ZY, Han CS, Hikim AP, Swerdloff RS, Wang C, Liu YX 2005 Expression of HSP105 and HSP60 during germ cell apoptosis in the heat-treated testes of adult cynomolgus monkeys (Macaca fascicularis). Front Biosci 10:3110–3121[Medline]
  8. Wong V, Russell LD 1983 Three-dimensional reconstruction of a rat stage V Sertoli cell. 1. Methods, basic configuration, and dimensions. Am J Anat 167:143–161[CrossRef][Medline]
  9. Walker WH, Cheng J 2005 FSH and testosterone signaling in Sertoli cells. Reproduction 130:15–28[Abstract/Free Full Text]
  10. Cheng CY, Mruk DD 2002 Cell junction dynamics in the testis: Sertoli-germ cell interactions and male contraceptive development. Physiol Rev 82: 825–874
  11. Muffly KE, Nazian SJ, Cameron DF 1993 Junction-related Sertoli cell cytoskeleton in testosterone-treated hypophysectomized rats. Biol Reprod 49:1122–1132[Abstract]
  12. O'Donnell L, Stanton PG, Bartles JR, Robertson DM 2000 Sertoli cell ectoplasmic specializations in the seminiferous epithelium of the testosterone-suppressed adult rat. Biol Reprod 63:99–108[Abstract/Free Full Text]
  13. Perryman KJ, Stanton PG, Loveland KL, McLachlan RI, Robertson DM 1996 Hormonal dependency of neural cadherin in the binding of round spermatids to Sertoli cells in vitro. Endocrinology 137:3877–3883[Abstract]
  14. Cameron DF, Muffly KE 1991 Hormonal regulation of spermatid binding to Sertoli cells in vitro. J Cell Sci 100:523–533
  15. Janecki A, Jakubowiak A, Steinberger A 1991 Regulation of transepithelial electrical resistance in two-compartment Sertoli cell cultures: in vitro model of the blood-testis barrier. Endocrinology 129:1489–1496[Abstract/Free Full Text]
  16. Florin A, Maire M, Bozec A, Hellani A, Chater S, Bars R, Chuzel F, Benahmed M 2005 Androgens and postmeiotic germ cells regulate claudin-11 expression in rat Sertoli cells. Endocrinology 146:1532–1540[Abstract/Free Full Text]
  17. Meng J, Holdcraft RW, Shima JE, Griswold MD, Braun RE 2005 Androgens regulate the permeability of the blood-testis barrier. Proc Natl Acad Sci USA 102:16696–16700[Abstract/Free Full Text]
  18. Wang RS, Yeh S, Chen LM, Lin HY, Zhang C, Ni J, Wu CC, di Sant'Agnese PA, DeMesy-Bentley KL, Tzeng CR, Chang C 2006 Androgen receptor in Sertoli cell is essential for germ cell nursery and junctional complex formation in mouse testes. Endocrinology 147:5624–5633[Abstract/Free Full Text]
  19. Park SY, Jameson JL 2005 Transcriptional regulation of gonadal development and differentiation. Endocrinology 146:1035–1042[Abstract/Free Full Text]
  20. Rao MK, Pham J, Imam JS, MacLean JA, Murali D, Furuta Y, Sinha-Hikim AP, Wilkinson MF 2006 Tissue-specific RNAi reveals that WT1 expression in nurse cells controls germ cell survival and spermatogenesis. Genes Dev 20:147–152[Abstract/Free Full Text]
  21. Courtens JL, Ploen L 1999 Improvement of spermatogenesis in adult cryptorchid rat testis by intratesticular infusion of lactate. Biol Reprod 61:154–161[Abstract/Free Full Text]
  22. Rune GM, Mayr J, Neugebauer H, Anders C, Sauer H 1992 Pattern of Sertoli cell degeneration in cryptorchid prepubertal testes. Int J Androl 15:19–31[CrossRef][Medline]
  23. Kerr JB, Rich KA, de Kretser DM 1979 Effects of experimental cryptorchidism on the ultrastructure and function of the Sertoli cell and peritubular tissue of the rat testis. Biol Reprod 21:823–838[Abstract]
  24. Hagenas L, Ritzen EM 1975–1976 Impaired Sertoli cell function in experimental cryptorchidism in the rat. Mol Cell Endocrinol 4:25–34
  25. Jegou B, Laws AQ, de Kretser DM 1984 Changes in testicular function induced by short-term exposure of the rat testis to heat: further evidence for interaction of germ cells, Sertoli cells and Leydig cells. Int J Androl 7:244–257[Medline]
  26. Au CL, Robertson DM, de Kretser DM 1987 Changes in testicular inhibin after a single episode of heating of rat testes. Endocrinology 120:973–977[Abstract/Free Full Text]
  27. Barenton B, Blanc MR, Caraty A, Hochereau-de Reviers MT, Perreau C, Saumande J 1982 Effect of cryptorchidism in the ram: changes in the concentrations of testosterone and estradiol and receptors for LH and FSH in the testis, and its histology. Mol Cell Endocrinol 28:13–25[CrossRef][Medline]
  28. Antich M, Fabian E, Sarquella J, Bassas L 1995 Effect of testicular damage induced by cryptorchidism on insulin-like growth factor I receptors in rat Sertoli cells. J Reprod Fertil 104:267–275[Abstract/Free Full Text]
  29. Zhang XS, Zhang ZH, Jin X, Wei P, Hu XQ, Chen M, Lu CL, Lue YH, Hu ZY, Sinha Hikim AP, Swerdloff RS, Wang C, Liu YX 2006 Dedifferentiation of adult monkey Sertoli cells through activation of extracellularly regulated kinase 1/2 induced by heat treatment. Endocrinology 147:1237–1245[Abstract/Free Full Text]
  30. Guo J, Tao SX, Chen M, Shi YQ, Zhang ZQ, Li YC, Zhang XS, Hu ZY, Liu YX 2007 Heat treatment induces liver receptor homolog-1 expression in monkey and rat Sertoli cells. Endocrinology 148:1255–1265[Abstract/Free Full Text]
  31. Majumdar SS, Winters SJ, Plant TM 1998 Procedures for the isolation and culture of Sertoli cells from the testes of infant, juvenile, and adult rhesus monkeys (Macaca mulatta). Biol Reprod 58:633–640[Abstract/Free Full Text]
  32. Litvinov IV, Chang C, Isaacs JT 2004 Molecular characterization of the commonly used human androgen receptor expression vector, pSG5-AR. Prostate 58:319–324[CrossRef][Medline]
  33. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B 1998 A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA 95:2509–2514[Abstract/Free Full Text]
  34. Chowdhury I, Xu W, Stiles JK, Zeleznik A, Yao X, Matthews R, Thomas K, Thompson WE 2007 Apoptosis of rat granulosa cells after staurosporine and serum withdrawal is suppressed by adenovirus-directed overexpression of prohibitin. Endocrinology 148:206–217[Abstract/Free Full Text]
  35. Sharpe RM, McKinnell C, Kivlin C, Fisher JS 2003 Proliferation and functional maturation of Sertoli cells, and their relevance to disorders of testis function in adulthood. Reproduction 125:769–784[Abstract]
  36. Eng F, Wiebe JP, Alima LH 1994 Long-term alterations in the permeability of the blood-testis barrier following a single intratesticular injection of dilute aqueous glycerol. J Androl 15:311–317[Abstract/Free Full Text]
  37. Hew KW, Heath GL, Jiwa AH, Welsh MJ 1993 Cadmium in vivo causes disruption of tight junction-associated microfilaments in rat Sertoli cells. Biol Reprod 49:840–849[Abstract]
  38. Cheng CY, Silvestrini B, Grima J, Mo MY, Zhu LJ, Johansson E, Saso L, Leone MG, Palmery M, Mruk D 2001 Male contraceptives exerting their effects by depleting immature germ cells from the testis. Biol Reprod 65:449–461[Abstract/Free Full Text]
  39. Malcorni W, Meschini S, Matarrese P, Arancia G 1992 The cytoskeleton as a subcellular target of the antineoplastic drug lonidamine. Anticancer Res 12:2037–2045[Medline]
  40. Grima J, Silvestrini B, Cheng CY 2001 Reversible inhibition of spermatogenesis in rats using a new male contraceptive, 1-(2,4-dichlorobenzyl)-indazole-3-carbohydrazide. Biol Reprod 64:1500–1508[Abstract/Free Full Text]
  41. Lui WY, Wong CH, Mruk DD, Cheng CY 2003 TGF-β3 regulates the blood-testis barrier dynamics via the p38 mitogen activated protein (MAP) kinase pathway: an in vivo study. Endocrinology 144:1139–1142[Abstract/Free Full Text]
  42. Wong CH, Mruk DD, Lui WY, Cheng CY 2004 Regulation of blood-testis barrier dynamics: an in vivo study. J Cell Sci 117:783–798[Abstract/Free Full Text]
  43. Xia WL, Cheng CY 2005 TGF-β3 regulates anchoring junction dynamics in the seminiferous epithelium of the rat testis via the Ras/ERK signaling pathway: an in vivo study. Dev Biol 280:321–343[CrossRef][Medline]
  44. Goossens S, van Roy F 2005 Cadherin-mediated cell-cell adhesion in the testis. Front Biosci 10:398–419[Medline]
  45. Lee NP, Mruk D, Lee WM, Cheng CY 2003 Is the cadherin/catenin complex a functional unit of cell-cell actin-based adherens junctions in the rat testis? Biol Reprod 68:489–508[Abstract/Free Full Text]
  46. Stevenson BR, Silicano JD, Mooseker MS, Goodenough DA 1986 Identification of ZO-1: a high molecular weight polypeptide associated with the tight junction (zona occludens) in a variety of epithelia. J Cell Biol 103:755–766[Abstract/Free Full Text]
  47. Furuse M, Itoh M, Hirase T, Nagafuchi A, Yonemura S, Tsukita S, Tsukita S 1994 Direct association of occludin with ZO-1 and its possible involvement in the localization of occludin at tight junctions. J Cell Biol 127:1617–1626[Abstract/Free Full Text]
  48. Franke WW, Grund C, Schmid E 1979 Intermediate-sized filaments present in Sertoli cells are of the vimentin type. Eur J Cell Biol 19:269–275[Medline]
  49. Vogl AW, Pfeiffer DC, Redenbach DM, Grove BD 1993 Sertoli cell cytoskeleton. In: Russell LD, Griswold MD, eds. The Sertoli cell. Clearwater, FL: Cache River Press; 39–86
  50. Paramio JM, Jorcano JL 2002 Beyond structure: do intermediate filaments modulate cell signalling? Bioessays 24:836–844[CrossRef][Medline]
  51. Lang SH, Hyde C, Reid IN, Hitchcock IS, Hart CA, Bryden AA, Villette JM, Stower MJ, Maitland NJ 2002 Enhanced expression of vimentin in motile prostate cell lines and in poorly differentiated and metastatic prostate carcinoma. Prostate 52:253–263[CrossRef][Medline]
  52. Demir AY, Groothuis PG, Nap AW, Punyadeera C, de Goeij AF, Evers JL, Dunselman GA 2004 Menstrual effluent induces epithelial-mesenchymal transitions in mesothelial cells. Hum Reprod 19:21–29[Abstract/Free Full Text]
  53. Zeineldin R, Rosenberg M, Ortega D, Buhr C, Chavez MG, Stack MS, Kusewitt DF, Hudson LG 2006 Mesenchymal transformation in epithelial ovarian tumor cells expressing epidermal growth factor receptor variant III. Mol Carcinog 45:851–860[CrossRef][Medline]
  54. Singh S, Sadacharan S, Su S, Belldegrun A, Persad S, Singh G 2003 Overexpression of vimentin: role in the invasive phenotype in an androgen-independent model of prostate cancer. Cancer Res 63:2306–2311[Abstract/Free Full Text]
  55. Tan KA, De Gendt K, Atanassova N, Walker M, Sharpe RM, Saunders PT, Denolet E, Verhoeven G 2005 The role of androgens in Sertoli cell proliferation and functional maturation: studies in mice with total or Sertoli cell-selective ablation of the androgen receptor. Endocrinology 146:2674–2683[Abstract/Free Full Text]
  56. Scharnhorst V, van der Eb AJ, Jochemsen AG 2001 WT1 proteins: functions in growth and differentiation. Gene 273:141–161[CrossRef][Medline]
  57. Lim HN, Huqhes IA, Hawkins JR 2001 Clinical and molecular evidence for the role of androgens and WT1 in testis descent. Mol Cell Endocrinol 185:43–50[CrossRef][Medline]
  58. Vornberger W, Prins G, Musto NA, Suarez-Quian CA 1994 Androgen receptor distribution in rat testis: new implications for androgen regulation of spermatogenesis. Endocrinology 134:2307–2316[Abstract/Free Full Text]
  59. Armstrong JF, Pritchard-Jones K, Bickmore WA, Hastie ND, Bard JB 1993 The expression of the Wilms’ tumour gene, WT1, in the developing mammalian embryo. Mech Dev 40:85–97[CrossRef][Medline]
  60. Gao F, Maiti S, Alam N, Zhang Z, Deng JM, Behringer RR, Lecureuil C, Guillou F, Huff V 2006 The Wilms tumor gene, Wt1, is required for Sox9 expression and maintenance of tubular architecture in the developing testis. Proc Natl Acad Sci USA 103:11987–11992[Abstract/Free Full Text]
  61. Pajonk F, van Ophoven A, McBride WH 2005 Hyperthermia-induced proteasome inhibition and loss of androgen receptor expression in human prostate cancer cells. Cancer Res 65:4836–4843[Abstract/Free Full Text]
  62. Regadera J, Martinez-Garcia F, Gonzalez-Peramato P, Serrano A, Nistal M, Suarez-Quian C 2001 Androgen receptor expression in Sertoli cells as a function of seminiferous tubule maturation in the human cryptorchid testis. J Clin Endocrinol Metab 86:413–421[Abstract/Free Full Text]
  63. Gye MC, Ohsako S 2003 Effects of flutamide in the rat testis on the expression of occludin, an integral member of the tight junctions. Toxicol Lett 143: 217–222
  64. Liu YX, Dahl KD 1988 A factor(s) produced by Sertoli cells stimulates androgen biosynthesis by Leydig cells in neonatal rats. Sci Sin [B] 31:818–827[Medline]
  65. Muffly KE, Nazian SJ, Cameron DF 1994 Effects of follicle stimulating hormone on the junction-related Sertoli cell cytoskeleton and daily sperm production in testosterone-treated hypophysectomized rats. Biol Reprod 51: 158–166
  66. Sluka P, O'Donnell L, Bartles JR, Stanton PG 2006 FSH regulates the formation of adherens junctions and ectoplasmic specialisations between rat Sertoli cells in vitro and in vivo. J Endocrinol 189:381–395[Abstract/Free Full Text]
  67. Lui WY, Lee WM 2006 Regulation of junction dynamics in the testis–transcriptional and post-translational regulations of cell junction proteins. Mol Cell Endocrinol 250:25–35[CrossRef][Medline]
  68. Walsh SV, Hopkins AM, Nusrat A 2000 Modulation of tight junction structure and function by cytokines. Adv Drug Delivery Rev 41:303–313[CrossRef][Medline]
  69. Lui WY, Sze KL, Lee WM 2006 Nectin-2 expression in testicular cells is controlled via the functional cooperation between transcription factors of the Sp1, CREB, and AP-1 families. J Cell Physiol 207:144–157[CrossRef][Medline]
  70. Lui WY, Wong EW, Guan Y, Lee WM 2007 Dual transcriptional control of claudin-11 via an overlapping GATA/NF-Y motif: positive regulation through the interaction of GATA, NF-YA, and CREB and negative regulation through the interaction of Smad, HDAC1, and mSin3A. J Cell Physiol 211:638–648[CrossRef][Medline]
  71. Lui WY, Lee WM, Cheng CY 2003 Transforming growth factor β3 regulates the dynamics of Sertoli cell tight junctions via the p38 mitogen-activated protein kinase pathway. Biol Reprod 68:1597–1612[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, M.
Right arrow Articles by Liu, Y.-X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, M.
Right arrow Articles by Liu, Y.-X.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Compound via MeSH
*Substance via MeSH
*Genetics Home Reference
Medline Plus Health Information
*Heat Illness
*Heel Injuries and Disorders
Hazardous Substances DB
*TESTOSTERONE

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals