help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2008-0134
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lowry, M. B.
Right arrow Articles by Turner, R. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lowry, M. B.
Right arrow Articles by Turner, R. T.
Endocrinology Vol. 149, No. 11 5735-5746
Copyright © 2008 by The Endocrine Society

Osteitis Fibrosa Is Mediated by Platelet-Derived Growth Factor-A Via a Phosphoinositide 3-Kinase-Dependent Signaling Pathway in a Rat Model for Chronic Hyperparathyroidism

Malcolm B. Lowry1, Sutada Lotinun1, Alexey A. Leontovich, Minzhi Zhang, Avudaiappan Maran, Kristen L. Shogren, Brett K. Palama, Kevin Marley, Urszula T. Iwaniec and Russell T. Turner

Departments of Microbiology (M.B.L.), Nutrition and Exercise Sciences (S.L., B.K.P., K.M., U.T.I., R.T.T.), Chemistry (K.M.), Oregon State University, Corvallis, Oregon 97331; and Genomic Research and Microarray Shared Resource (A.A.L.) and Department of Orthopedics (M.Z., A.M., K.L.S.), Mayo Clinic College of Medicine, Rochester, Minnesota 55905

Address all correspondence and requests for reprints to: Malcolm B. Lowry, Ph.D., Department of Microbiology, 546 Nash Hall, Oregon State University, Corvallis, Oregon 97331. E-mail: malcolm.lowry{at}oregonstate.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Abnormal secretion of PTH by the parathyroid glands contributes to a variety of common skeletal disorders. Prior studies implicate platelet-derived growth factor-A (PDGF-A) as an important mediator of selective PTH actions on bone. The present studies used targeted gene profiling and small-molecule antagonists directed against candidate gene products to elucidate the roles of specific PTH-regulated genes and signaling pathways. A group of 29 genes in rats continuously infused with PTH and cotreated with the PDGF receptor antagonist trapidil were differentially expressed compared with PTH treatment alone. Several of the identified genes were functionally clustered as regulators of fibroblast differentiation and extracellular matrix modeling, including the matrix cross-linking enzyme lysyl oxidase (LOX). Treatment with β-aminopropionitrile, an irreversible inhibitor of LOX activity, dramatically reduced diffuse mineralization but had no effect on PTH-induced fibrosis. In contrast, the receptor tyrosine kinase inhibitor Gleevec and the phosphoinositide 3-kinase inhibitor wortmannin each reduced bone marrow fibrosis. In summary, the present studies support the hypotheses that PTH-induced bone marrow fibrosis is mediated by PDGF-A via a phosphoinositide 3-kinase-dependent signaling pathway and that increased LOX gene expression plays a key role in abnormal mineralization, a hallmark of chronic hyperparathyroidism.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
ELEVATED CIRCULATING LEVELS of PTH have anabolic as well as catabolic effects on bone. At the cellular level, the anabolic bone response to the hormone in rodents is associated with modulation of bone-lining cells to osteoblasts (1); increased proliferation, increased migration to bone surfaces, and differentiation of osteoblast precursors (2); and increased activity and/or lifespan of osteoblasts (3, 4, 5, 6). The catabolic effects of the hormone are associated with an increase in osteoclast number (7). In contrast to the cellular changes, which have been fairly well characterized, the molecular mechanisms mediating the complex effects of PTH on bone metabolism are poorly understood.

The overall skeletal response to PTH depends in part upon the degree and duration of occupancy of PTH receptors. Saturation of PTH receptors with the ligand results in large increases in bone turnover; bone formation usually predominates with intermittent exposure, whereas resorption of cortical bone and variable changes in cancellous bone (depending upon model system and PTH levels) predominate with continuous PTH. Brief (≤1 h) but regular (e.g. once per day) exposure to increased PTH levels is sufficient to increase bone formation and resorption in rats and humans. More sustained (>2 h) increases in levels of the hormone are required for peritrabecular bone marrow fibrosis (8). Intermittent PTH, although proven to be an effective therapy for increasing bone formation and cancellous bone mass in patients with osteoporosis, does not closely replicate normal patterns of secretion of the hormone. Furthermore, it is not clear whether changes observed during pharmacological administration of intermittent PTH recapitulate physiological actions of the hormone. On the other hand, disordered PTH secretion resulting in continuously elevated PTH levels is common and is associated with overt disease.

Primary hyperparathyroidism (HPT) occurs when there is oversecretion of PTH (generally due to an adenoma). Secondary HPT occurs as a reaction of the parathyroid glands to hypocalcemia (often due to chronic renal failure). Whereas primary HPT results in hypercalcemia and hypophosphatemia, secondary HPT is associated with hypocalcemia and hyperphosphatemia (9).

Clinically, chronic HPT is responsible for multiple skeletal disorders ranging from asymptomatic to severe, which as a group are referred to as parathyroid bone disease. High and low bone turnover forms of the disease have been described (10). However, low turnover disease is most often associated with interventions targeted to mitigate HPT and not HPT itself.

Severe primary HPT is now rare in developed countries due to early diagnosis and treatment (11, 12), and patients with mild primary HPT are generally not treated. Although often asymptomatic for years or decades, mild primary HPT may not be benign, because patients with this condition experience a significantly increased fracture risk, possibly due to decreased bone quality caused by increased bone turnover. Secondary HPT can result from a variety of causes, and mild forms are commonly associated with aging. Severe secondary HPT is considered inevitable in patients with chronic renal failure (13). In renal failure patients, focal bone resorption, increased bone formation, and peritrabecular bone marrow fibrosis are common manifestations of high turnover parathyroid bone disease. Although underlying causes differ markedly between primary and secondary HPT, the resulting skeletal pathologies overlap, suggesting chronic elevation of serum PTH is a principal driving force for skeletal pathologies associated with HPT.

In patients with severe HPT, normal bone matrix is replaced by poorly mineralized bone. The histological changes in rat bone from animals administered PTH to model primary HPT are nearly identical to those seen in humans with parathyroid disease. In rats, continuous infusion of PTH, at a dose rate of 40 µg/kg·d, results in circulating levels of the hormone corresponding to PTH levels in patients diagnosed as having severe high turnover parathyroid bone disease (5, 6, 8). Therefore, the rat provides a useful model for investigating the etiology of this disease.

Microarray technology was used to profile changes in gene expression in skeletal tissues after continuous and intermittent PTH treatment (14, 15). PTH was found to regulate groups of genes (associated with collagen turnover, cell adhesion, inflammation, signal transduction, and fibroblast proliferation) that differed depending upon the duration of daily exposure to the hormone. These findings suggest that the differential effects of PTH on bone formation, bone resorption, and bone marrow fibrosis are mediated by unique sets of genes and thus can be disassociated. Microarray studies identified platelet-derived growth factor (PDGF)-A as a candidate causative factor for PTH bone disease, a conclusion that is supported by the finding that trapidil, a PDGF receptor antagonist, reduces parathyroid bone disease in a rat model for chronic HPT (16).

A global gene profiling approach is of limited value in identifying genes and pathways responsible for mediating specific actions of PTH; the plethora of genes regulated by PTH are associated with numerous biological processes, and there is substantial overlap between the in vivo actions of continuous vs. intermittent PTH on gene expression (15, 17). There is a clear need to elucidate the mechanisms of PTH action to optimize the hormone’s therapeutic potential and to prevent or treat the manifestations of parathyroid bone disease. The present studies sought to extend our previous work by using a more focused gene profiling approach combined with a candidate gene approach to identify genes associated with continuous PTH-induced fibrosis and detail the time course for the increased skeletal expression of profibrotic genes in a rat model for HPT. Additionally, we performed intervention studies to block selected genes or pathways identified by gene profiling as putative targets for continuous PTH action. The results demonstrate the important role of receptor tyrosine kinase signaling, phosphoinositide 3-kinase (PI3K) signaling, and lysyl oxidase (LOX) activity in mediating the detrimental effects of severe chronic HPT on bone metabolism.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
Sexually mature female Sprague Dawley rats (3 or 6 months old) were used in all experiments described below. The animals were obtained from Harlan Sprague Dawley Inc. (Indianapolis, IN, or Madison, WI) and maintained under standard conditions with a 12-h light, 12-h dark cycle. Food (Laboratory Rodent Diet 5001, containing 0.95% calcium, 0.67% phosphorus, and 4.5 IU/g vitamin D3; LabDiet, St. Louis, MO) and water were provided ad libitum to all rats. The animals were maintained in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and the experimental protocols were approved by the Institutional Animal Care and Use Committee at Mayo Clinic (experiments 1, 2, 4, and 6) or Oregon State University (experiments 3, 5, and 7). For administration of continuous PTH, rats were implanted sc with osmotic pumps (Alza Corp., Mountain View, CA) delivering vehicle or 40 µg/kg·d human PTH 1–34 (Bachem, Torrance, CA). For tissue collection, all rats were anesthetized with ketamine (50 mg/kg)-xylazine HCl (5 mg/kg), and death was induced by exsanguination followed by cardiectomy.

Experiment 1: targeted gene profiling
Trapidil was shown to greatly decrease PTH-induced osteitis fibrosa in rats. In contrast, the drug did not prevent the bone anabolic response to continuous PTH (16). We, therefore, reasoned that comparison between rats treated with continuous PTH and rats treated with PTH and trapidil could be used to identify genes and signaling pathways involved in mediating PTH-induced osteitis fibrosa. To perform these analyses, 3-month-old rats were randomly assigned to one of four treatment groups (n = 3 rats per group): 1) control, 2) trapidil, 3) continuous PTH, or 4) continuous PTH plus trapidil. The rats were implanted sc with osmotic pumps continuously delivering either vehicle or PTH 1–34 for 7 d. The rats also received daily sc injections of vehicle only or 40 mg/kg·d trapidil (a gift from Dr. Reiner Ludwig, Rodleben Pharma GmbH, Rodleben, Germany) for 8 d. Although hypercalcemic, the rats tolerated continuous PTH well. Also, trapidil alone, or in combination with PTH, had no notable detrimental side effects on the overall health of the rats (16). Femora were removed at necropsy and stored frozen at –80 C for RNA isolation, gene array data analysis, and RT-PCR. Tibiae were removed, fixed in 10% neutral buffered formalin, and embedded in paraffin for immunohistochemistry.

Experiment 2: time-course effects of continuous PTH on gene expression in distal femur
Six-month-old rats were implanted sc with osmotic pumps continuously delivering either vehicle (n = 24 rats) or PTH 1–34 (n = 60 rats). Rats receiving continuous PTH were killed on d 1, 3, 5, 7, 14, and 28, whereas rats receiving vehicle were killed on d 7, 14, and 28. Additionally, after 7 d of continuous infusion, PTH was withdrawn for 7 (n = 6 per group) or 21 (n = 8 per group) days. Femora were removed at the time of killing and stored at –80 C for RNA isolation. Tibiae were removed and placed in 70% ethanol for histomorphometric analysis. The histomorphometric results have been reported in detail elsewhere (6). Results for Northern, ribonuclease (RNase) protection and RT-PCR analyses for the profibrotic genes type 1 collagen, osteonectin (Sparc), Mmp14, PDGF-A, Sfrp-4, Dcn, and LOX are reported herein.

Experiment 3: effects of continuous PTH treatment and withdrawal on bone histomorphometry and ultrastructure
Three-month-old rats were randomized into five treatment groups (n = 10 rats per group): 7- and 14-d controls, rats administered continuous PTH for 3 d and killed 4 d later, rats killed immediately after 7 d of treatment with continuous PTH, and rats administered continuous PTH for 7 d and killed 7 d later. Right tibiae were removed at necropsy and placed in 70% ethanol for histomorphometry, and left tibiae were fixed for transmission electron microscopy.

Experiment 4: effects of continuous PTH on tibia histomorphometry and BMP and Wnt gene expression
Six-month-old rats were randomized into one of three groups (n = 5 rats per group): 1) control, 2) intermittent PTH (80 µg/kg·day injected sc once daily), or 3) continuous PTH. At termination of 7 d treatment, tibiae were removed and fixed in 70% ethanol for histomorphometric analysis and femora were collected for RNA analysis. mRNA levels for BMP (1, 2, 3, 4, 5, 6, 7) and Wnt (1, 2, 3a, 4, 5b, and 6) gene expression in the distal femur were measured by RNase protection assay.

Experiment 5: effects of continuous PTH on β-aminopropionitrile (BAPN) on bone histomorphometry in rats treated with continuous PTH
Six-month-old rats were divided into four groups (n = 8 rats per group): 1) control, 2) BAPN, 3) continuous PTH, and 4) continuous PTH plus BAPN. BAPN (350 mg/kg·day; Sigma, St. Louis, MO) was injected sc daily for 7 d. The rats tolerated treatment with BAPN with no notable detrimental side effects on their overall health. The fluorochrome labels tetracycline (20 mg/kg) and calcein (20 mg/kg) were injected at the base of the tail 7 and 1 d before animals were killed, respectively. Tibiae were removed at the time of killing and fixed in 70% ethanol for bone histomorphometry.

Experiment 6: effects of the receptor tyrosine kinase inhibitor Gleevec (imatinib) on continuous PTH-induced peritrabecular bone marrow fibrosis
The experimental design was the same as for experiment 5, with the exception that the receptor tyrosine kinase inhibitor Gleevec (50 mg/kg·day ip; Novartis, Basel, Switzerland) was used and bones recovered from n = 4–7 rats per group. The reduced numbers were due to Gleevec toxicity, which was especially pronounced when Gleevec was combined with PTH. Tibiae were removed at necropsy and fixed in 70% alcohol for bone histomorphometry.

Experiment 7: effects of the PI3K inhibitor wortmannin on continuous PTH-induced peritrabecular bone marrow fibrosis
The experimental design was the same as for experiments 5 and 6, with the exception that the PI3K inhibitor wortmannin (32 mg/kg·day sc) was used and n = 9 rats per group in this study. Other than variable bruising at the site of its administration, the rats tolerated treatment with wortmannin well. Tibiae were removed at necropsy and fixed in 70% alcohol for bone histomorphometry.

Isolation of RNA
The distal femoral metaphyses containing bone and marrow were homogenized in guanidine isothiocyanate using a Spex freezer mill (Spex Industries, Inc., Edison, NJ). Total cellular RNA was isolated using a modified organic solvent method (18), and RNA yields were determined spectrophotometrically at 260 nm.

Gene array sample preparation, hybridization, and scanning
Purified cDNA was used as an in vitro template for the synthesis of biotinylated cRNA using a RNA transcript labeling reagent (Affymetrix, Santa Clara, CA). Labeled cRNA was then fragmented and hybridized onto the Affymetrix GeneChip Rat Genome U34A oligonucleotide microarray. Appropriate amounts of fragmented cRNA and control oligonucleotide B2 were added to the hybridization buffer along with control cRNA (BioB, BioC, and BioD), herring sperm DNA, and BSA. The hybridization mixture was heated at 99 C for 5 min followed by incubation at 45 C for 5 min before injecting the sample into the Gene Chip. Hybridization was performed at 45 C for 16 h with mixing on a rotisserie at 60 rpm. After hybridization, the solutions were removed and arrays were washed and stained with streptavidin-phycoerythrin (Molecular Probes, Eugene, OR).

After washing and staining, probe arrays were scanned using the GeneChip Scanner 3000 (Affymetrix, Santa Clara, CA). The quality of the fragmented biotin-labeled cRNA in each experiment was evaluated before hybridizing onto the U34A expression array by gel electrophoresis and hybridizing onto Test-3 microarrays as a measure of quality control. Hybridization and confocal scanning were performed at the institutional microarray core facility at the Mayo Clinic.

Gene array data analysis
ArrayAssist 2.5 software (Lobion Laboratories, Stratagene, La Jolla, CA) was used to perform microarray data analysis. Raw data were preprocessed using GCRMA algorithm. Two groups of three samples in each experiment were compared. Genes whose expression was reported as significantly changed between groups were identified. The significance criteria were 2-fold expression change with 5% false discovery rate without multiple testing correction. Furthermore, GeneSpring 6.1 software (Silicon Genetics Inc., Redwood City, CA) was used for data visualization.

Northern analysis
Nylon membranes were prehybridized for 3 h at 65 C in 11 ml Quickhyb (Stratagene) solution with 100 µl salmon sperm DNA (Stratagene) added to reduce background labeling. cDNA probes were labeled with 32P by random sequence hexanucleotide primer extension using the Megaprime DNA labeling kit (Amersham, Arlington Heights, IL) up to a minimal activity of 6 x 106 cpm/ml for collagen I and osteonectin, and 1 x 106 cpm/ml for cDNA-plasmid probe for 18S rRNA, which was used to correct for unequal loading of RNA in the agarose gel. Hybridization was carried out for 80 min at 65 C, and the membranes were washed for 30 min in 3x saline-sodium citrate (SSC) at 43 C, 15 min in 1x SSC at 43 C, and, if necessary, once again for 15 min in 0.5x SSC at 55 C and 65 C consecutively. The mRNA bands on the Northern blots were quantified by densitometric scanning using a phosphor imager (Molecular Dynamics, Sunnyvale, CA). The cDNA probes used were rat Coll I (Lofstrand Laboratories, Ltd., Gaithersburg, MD), rat ON (a gift from Dr. G. Long, University of Vermont, Burlington, VT), and 18S cDNA plasmid (Lofstrand).

RNase protection assays
The mRNA levels for PDGF-A, BMP, and Wnt were determined using RNase protection assays according to the manufacturer’s protocol (BD PharMingen, San Diego, CA). Protected RNA fragments were resolved on denaturing polyacrylamide gels and quantitated by phosphoimager analysis. L32, a ribosomal structural protein, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as internal controls for sample loading.

RT-PCR
Two micrograms total RNA were reverse-transcribed into first-strand cDNA with oligo dT primer using Superscript II (Invitrogen, Carlsbad, CA) and amplified using specific primers. The primers used for specific genes were as follows: Sfrp-4 forward CTTCAGGAACAGCAGAGAACAACTC and reverse GGGTGGCTTCAACTTGGAAAG, Dcn forward CGGCAACCCACTGAAAAACTC and reverse CACAACGGTGATGCTATTGAAGC, Mmp-14 forward TTTATGGAAGCAAGTCAGGGTCAC and reverse TGAACTCCTCATTGAAGCGGTAG, LOX forward TTCAGCCACTACGACCTGCTG and reverse AGTCTGATTCAGGCACCAGG (19), and L32 forward CATGGCTGCCCTTCGGCCTC and reverse CATTCTCTTCGCTGCGTAGCC (20). Amplification was carried out using AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA). PCR products were electrophoresed on 2% agarose gels containing ethidium bromide and visualized by UV-induced fluorescence. The band intensities of genes relative to L32 were quantitated by ImageQuant PC-based software (Molecular Dynamics, Sunnyvale, CA).

Immunohistochemistry
Localization studies were performed using standard immunohistochemistry techniques. Five-micrometer-thick, paraffin-embedded sections were deparaffinized and rehydrated. Endogenous peroxidase activity was blocked with 0.3% hydrogen peroxide in absolute methanol for 30 min. Nonspecific binding sites were blocked with 10% normal goat serum (Vector Laboratories, Burlingame, CA) in Tris-buffered saline. Sections were incubated with rabbit anti-LOX polyclonal antibody (a gift from Dr. Dawn A. Kirschmann, Children’s Memorial Research Center, Chicago, IL) at a dilution of 1:200 for 1 h, rinsed with Tris-buffered saline, and incubated with peroxidase-labeled secondary antibody (Envision Plus; DakoCytomation, Carpinteria, CA) for 40 min. After incubation in diaminobenzidine substrate (Vector), the sections were counterstained with hematoxylin.

For detection of the PTH receptor, sections were treated with proteinase K at 10 µg/ml for 10 min after treatment with hydrogen peroxide, refixed with 4% paraformaldehyde for 10 min, and then washed and blocked. A rabbit polyclonal antibody against the rat PTH receptor (Covance, Berkeley, CA) was used at 1:100 dilution in 2% donkey serum in PBS and incubated overnight at 4 C. The sections were then processed for detection as described above using a diaminobenzidine substrate system. For detection of {alpha}-PDGF receptor, a polyclonal rabbit antibody (Santa Cruz Biotechnology, Santa Cruz, CA) was used at 1:200 dilution with a modified procedure for antigen retrieval. After rehydration, the sections were briefly boiled in 10 mM citrate buffer (pH 6.0), processed as above for detection, and counterstained with toluidine blue. For negative controls, normal rabbit IgG was used at the same concentration as the specific primary antibody.

Bone histomorphometry
For histomorphometric evaluation of cancellous bone and bone marrow fibrosis, proximal tibiae were dehydrated in graded ethanols and xylene and embedded undecalcified in modified methyl methacrylate (21). Longitudinal sections (4 µm thick) were cut on a Reichert-Jung Supercut 2050 microtome (Leica, Heidelberg, Germany) and affixed to slides precoated with 1% gelatin. One section per animal was stained according to the Von Kossa method with a tetrachrome counterstain (Polysciences, Warrington, PA) and used for assessing bone area and cell-based measurements. Alternatively, the sections were stained with either toluidine blue or Goldner’s stain. A second section was left unstained and used for assessing fluorochrome-based measurements. A standard sampling site with an average area of 1.65 mm2 was evaluated in the secondary spongiosa of the metaphysis. The following histomorphometric data were collected: fibroblast perimeter/bone perimeter (percent) and diffuse mineralization perimeter/bone perimeter (percent).

Electron microscopy
Three-millimeter-thick bone tissue biopsies were fixed and demineralized (30 d) in 1.9% glutaraldehyde, 150 mM EDTA in 60 mM sodium cacodylate buffer (pH 7.4) at 4 C. After demineralization, sections were postfixed in osmium tetroxide. Thin sections were double stained with lead citrate and uranyl acetate according to standard methods (22) and imaged on a Philips CM12 transmission electron microscope.

Statistical analysis
Differences among groups were determined using one- or two-way ANOVA test (SPSS version 11.5; SPSS Inc., Chicago, IL) or StatView4 (Abacus Concepts, Berkeley, CA). A Fisher’s protected least significant difference test was used to assess differences among specific groups. Differences were considered significant at P < 0.05. All data are expressed as mean ± SE.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Rat model for chronic HPT
Elevation in serum levels of PTH caused by HPT results in skeletal abnormalities in humans that are recapitulated in rats infused with the hormone. Figure 1Go, A and B, shows micrographs of Goldner-stained sections from iliac crest biopsies of a healthy individual and a renal dialysis patient with parathyroid bone disease, respectively. In the latter, high bone turnover, focal bone resorption, and peritrabecular bone marrow fibrosis result in the replacement of normal bone with poorly mineralized bone. As shown in Fig. 1Go, C and D, chronic administration of continuous PTH to rats results in replacement of normally mineralized bone with undermineralized matrix, resulting in a histological appearance similar to patients with parathyroid bone disease.


Figure 1
View larger version (104K):
[in this window]
[in a new window]

  		FIG. 1. Effects of continuous PTH on bone histomorphometry in humans and rats. A and B, Goldner-stained iliac crest bone biopsies from a healthy individual (A) and a patient with chronic HPT due to renal failure (B). Note the predominant green-stained bone matrix in the healthy individual, indicating normal bone turnover and normal mineralization. In the HPT patient, islands of normal bone are connected by poorly mineralized (red stained) regions of bone. High bone turnover, focal bone resorption, peritrabecular fibrosis, and defective mineralization result in decreased bone quality. C and D, UV micrographs showing bone from a normal rat (C) and a rat treated with continuous PTH (D). Note the loss of connectivity of dense bone and increase in poorly mineralized bone matrix in the rat treated with PTH. High-density bone appears dark in the micrograph, whereas the lighter bone is less mineralized. Chronic elevation of PTH in rats results in the same suite of skeletal abnormalities as in humans with chronic HPT.

 
Selected actions of continuous PTH (experiment 1)
A targeted gene profiling study was conducted to identify candidate genes that were antagonized by trapidil in the presence of continuous PTH. A total of 29 genes were differentially expressed in the distal femur metaphysis of rats treated with continuous PTH compared with rats treated with continuous PTH and trapidil (Fig. 2AGo). Expression levels for 27 genes were decreased by trapidil, whereas expression levels for two genes were increased. Several of the genes antagonized by trapidil clustered functionally into categories related to fibrosis. These included extracellular matrix proteins [Col 11a1 and Sparc (osteonectin)], proteases (Mmp 14 and Plat), cell adhesion molecules (Omd, Cd24, and Tesk1), tumorigenesis/cell cycle regulators (Plagl1, Facl3, and Maf), cytokines (Egfl3), immune response molecules ({lambda}-5 and IgG1), and extracellular matrix cross-linking molecules including LOX (S77494, AI234060, and S66184) and a gene similar to LOX-like protein 1 (LOXL1, AA800844). The stimulation of LOX gene expression by continuous PTH and inhibition of LOX gene expression by trapidil was confirmed by RT-PCR (Fig. 2BGo). The significance of increased LOX expression was investigated in experiment 5.


Figure 2
View larger version (47K):
[in this window]
[in a new window]

  		FIG. 2. Differential gene expression profile of a femur metaphysis from a rat treated with continuous PTH or the combination of continuous PTH and trapidil (A). Gene expression data were obtained using Affymetrix Rat Genome U34A GeneChip. The color scale indicates the fold change in expression. Trapidil decreased LOX (S77494, AI234060, and S66184) and a gene similar to LOX like protein-1 (AA800844). The inhibition of LOX gene expression by trapidil was confirmed by RT-PCR (B). Values are mean ± SE.

 
Time-course effects of continuous PTH on gene expression (experiment 2)
Our previous microarray data, obtained after 7 d of continuous PTH treatment, showed an increase in the expression of several genes that have been implicated in pathological fibrosis, including PDGF-A, Sfrp-4, Dcn, Mmp 14, and LOX (15). The results of the targeted gene profiling study (experiment 1) demonstrated that treatment with trapidil for 8 d reduced mRNA levels for several profibrotic genes.

Femur RNA from a time-course study, described in detail elsewhere (6), was analyzed. This study was performed to confirm the results of the microarray and correlate changes in selected PTH-regulated genes with the histological changes in bone. mRNA levels for PDGF-A were increased within 3 d of the start of continuous PTH administration (Fig. 3Go). mRNA levels for type 1 collagen and osteonectin were increased within 5 d (Fig. 3Go). mRNA levels for Sfrp-4, Dcn, and LOX were increased within 5 d, and Mmp-14 was increased within 7 d (Fig. 4Go). With the exception of PDGF-A, gene expression for the profibrotic genes remained elevated for the duration of continuous PTH administration (up to 28 d). PDGF-A mRNA levels did not differ from control on d 14 of treatment. However, PDGF-A mRNA levels increased after replacement of PTH-loaded osmotic pumps on d 14. mRNA levels for all but type 1 collagen returned to the control level within 7 d of discontinuing PTH treatment. mRNA levels for type 1 collagen returned to the control level within 21 d.


Figure 3
View larger version (21K):
[in this window]
[in a new window]

  		FIG. 3. Time-course effects of continuous PTH treatment on mRNA levels for PDGF-A, type 1 collagen, and osteonectin in distal femur. mRNA levels for PDGF-A were measured by RNase protection assay. mRNA levels for type 1 collagen and osteonectin were measured by Northern analysis. Ribosomal protein L32 and 18S were used as internal controls for the RNase protection assays and Northern analysis, respectively. Values are mean ± SE. *, Different from d 0, P < 0.05. wd, Withdrawal.

 

Figure 4
View larger version (53K):
[in this window]
[in a new window]

  		FIG. 4. Time-course effects of continuous PTH on mRNA levels for Sfrp-4, Dcn, LOX, and Mmp-14 in distal femur. RT-PCR products were separated on agarose gels (A), and the corresponding band intensities were normalized to L32 (B). Values are mean ± SE. *, Different from d 0, P < 0.05. wd, Withdrawal.

 
Effects of continuous PTH on bone marrow cells (experiments 1 and 3)
The time-dependent effects of continuous PTH administration and PTH withdrawal on bone histology were further evaluated in experiment 3. Peritrabecular fibrosis was detected after 7 d of continuous PTH treatment (Fig. 5BGo). Very little or no peritrabecular fibrosis was observed in animals administered continuous PTH for 3 d and killed on d 7 (Fig. 5CGo) or in animals administered continuous PTH for 7 d and killed on d 14 (Fig. 5DGo). The peritrabecular cells lining bone surfaces in rats treated with continuous PTH exhibited a fibroblastic rather than an osteoblastic phenotype. Also, these cells produced extensive extracellular matrix that was highly disorganized. These PTH-induced changes in bone histology were confirmed by transmission electron microscopy (Fig. 5FGo).


Figure 5
View larger version (152K):
[in this window]
[in a new window]

  		FIG. 5. Effects of continuous PTH on proximal tibia bone morphology. A–D, Von Kossa-stained with tetrachrome-counterstained sections: A, d-7 control; B, 7-d continuous PTH; C, 3-d continuous PTH killed on d 7; D, 7-d continuous PTH killed on d 14. This study demonstrates that osteitis fibrosa requires continuous elevation of PTH levels. E and F, Transmission electron microscopy of proximal tibia from a control rat (E) and a rat treated for 7 d with continuous PTH illustrating the fibroblastic morphology (F).

 
We examined the localization of LOX, PDGF receptor, and PTH receptor expression in rat bone by immunohistochemistry. Immunostaining for LOX was greatest in mast cell granules (Fig. 6BGo). Much weaker staining was observed in the extracellular matrix surrounding peritrabecular fibroblasts. Staining for PDGF receptor was identified in osteoblast lineage cells but not in mast cells (Fig. 6CGo). Intense PTH receptor staining was identified in osteoblast lineage cells (Fig. 6DGo) and osteoclasts (supplemental Fig. 1, published as supplemental data on The Endocrine Society’s Journals Online web site at http://endo.endojournals.org) and in a minority of mononuclear bone marrow cells. PTH receptor staining was rarely observed in mast cells (Fig. 6DGo and supplemental Fig. 1).


Figure 6
View larger version (125K):
[in this window]
[in a new window]

  		FIG. 6. Immunohistochemistry. A, Normal rabbit IgG negative control; B, LOX staining of a rat treated with continuous PTH showing intense mast cell staining; C, PDGF receptor staining of a rat treated with continuous PTH showing staining of peritrabecular fibroblasts but no staining of mast cells; D, PTH receptor staining showing staining of osteoblasts and some bone marrow cells (arrowheads). Mast cells were not stained (triangle).

 
Effects of continuous PTH on BMP and Wnt gene expression (experiment 4)
BMP and Wnt signaling have also been implicated in the skeletal response to PTH (23). The effects of intermittent PTH and continuous PTH on selective BMP and Wnt gene expression in the distal femur are shown in Fig. 7Go, A and B, respectively. We detected mRNA for BMPs 1–4, 6, and 7 and Wnts 3a, 4, and 5b. A 7-d administration of continuous PTH, but not intermittent PTH, increased mRNA levels for BMP-1. Neither intermittent nor continuous PTH had significant effects on mRNA levels for BMP 2–4, 6, and 7. Continuous PTH, but not intermittent PTH, increased mRNA levels for Wnt 4. Neither intermittent PTH nor continuous PTH altered mRNA levels for Wnt 3a, whereas both intermittent PTH and continuous PTH increased mRNA levels for Wnt 5b.


Figure 7
View larger version (24K):
[in this window]
[in a new window]

  		FIG. 7. Effects of 7 d intermittent PTH and continuous PTH administration on mRNA levels for BMPs (A) and Wnts (B). Continuous PTH resulted in significant increases in mRNA levels for BMP1 and Wnts 4 and 5b. Intermittent PTH increased mRNA levels for Wnt 5b but had no significant effect on the expression of other Wnts or BMPs. Values are mean ± SE. *, Different from control, P < 0.05. V, Vehicle.

 
Effects of small-molecule inhibitors on the skeletal response to continuous PTH (experiments 5–7)
Continuous PTH induced diffuse mineralization and severe peritrabecular fibrosis (Fig. 8Go). The LOX inhibitor BAPN reduced the diffuse mineralization in continuous PTH-treated rats by 72% (Fig. 8DGo) but had no significant effect on PTH-induced peritrabecular fibrosis (data not shown). As expected, continuous PTH induced and Gleevec decreased fibrosis (Fig. 8HGo). Many of the downstream effects of PDGF-A are mediated by PI3K signaling. The PI3K inhibitor wortmannin decreased fibrosis (Fig. 8LGo) and increased bone area/tissue area (data not shown) compared with rats administered continuous PTH alone.


Figure 8
View larger version (113K):
[in this window]
[in a new window]

  		FIG. 8. A–C, Fluorochrome labeling pattern in the proximal tibial metaphysis of a representative control rat (A), rat treated for 7 d with continuous PTH (B), and a rat cotreated with continuous PTH and BAPN (C). D, The dramatic effects of PTH treatment and the LOX inhibitor BAPN on diffuse mineralization are quantified in the bar graph. E–G, Toluidine blue staining of proximal tibial metaphysis of a representative control rat (E), rat treated for 7 d with continuous PTH (F), and a rat cotreated with PTH and the receptor tyrosine kinase inhibitor Gleevec (G). H, The dramatic effects of PTH and Gleevec on peritrabecular fibrosis are quantified in the bar graph. I–K, Von Kossa staining of proximal tibial metaphysis of a representative control rat (I), rat treated for 7 d with continuous PTH (J), and a rat cotreated with continuous PTH and the PI3K inhibitor wortmannin (K). L, The dramatic effects of PTH and wortmannin on peritrabecular fibrosis are shown in the bar graph. Values are mean ± SE. *, Different from cPTH, P < 0.05.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Continuous PTH resulted in coordinated increases in mRNA levels for PDGF-A and profibrotic genes in the distal femur and induced peritrabecular bone marrow fibrosis with a similar time course in the proximal tibia. Antagonism of PDGF receptor with trapidil suppressed mRNA levels for profibrotic genes, including LOX. Inhibition of LOX activity with BAPN reduced diffuse mineralization and inhibition of receptor tyrosine kinase signaling with Gleevec, and PI3K signaling with wortmannin reduced bone marrow fibrosis.

Trapidil, a PDGF receptor antagonist, was previously shown to reduce parathyroid bone disease in rats treated with continuous PTH (16). In the present time-course study, PDGF-A gene expression was increased before marrow fibrosis, and Gleevec, a receptor tyrosine kinase inhibitor known to inhibit PDGF signaling, blunted PTH-induced peritrabecular bone marrow fibrosis. Both trapidil and Gleevec have several molecular targets (24, 25, 26, 27, 28) with the only known overlap between these enzyme antagonists being the PDGF receptor. Gleevec was recently reported to inhibit osteoblast proliferation while promoting osteoblast differentiation by a mechanism involving inhibition of PDGF receptor signaling (29). Combined with the knowledge that continuous PTH increases mRNA levels for PDGF receptor and PDGF-A (15, 17), these findings support the hypothesis that increased PDGF-A signaling contributes to PTH-induced peritrabecular bone marrow fibrosis.

PDGF increases the expression of fibronectin, MMP-1, thrombospondin, prolyl 4-hydroxylase, and LOX in the lung and kidney (30, 31). The same genes were increased in bone by continuous PTH in this and other studies (15), suggesting continuous PTH executes its fibrotic action, at least in part, through activating the PDGF signaling pathway. Our data support the hypothesis that PDGF-A contributes to fibrosis by promoting the proliferation and migration of preosteoblastic fibroblasts to bone surfaces. Once the preosteoblast or fibroblast population expands, the expression of profibrotic genes associated with the extracellular matrix, such as LOX, is increased. In vivo time-course studies show that PDGF-A mRNA is induced after PTH 2 d before expression of profibrotic genes such as type I collagen and LOX. Increased expression of these profibrotic genes was closely associated with the formation of peritrabecular bone marrow fibrosis, as determined by morphology during the in vivo time-course study.

PI3K-Akt signaling plays a role in PDGF-mediated fibroblast proliferation and migration (32, 33, 34, 35) and is activated by PTH in cultured osteosarcoma cells (36). In the present study, we show that wortmannin, a specific inhibitor of PI3K, reduced fibrosis and prevented bone loss (data not shown) in rats treated with continuous PTH. These results imply PI3K signaling plays a role in the catabolic as well as anabolic bone response to continuous PTH.

Although trapidil greatly reduced peritrabecular bone marrow fibrosis induced by continuous PTH, it had no effect on bone formation (16). These differential effects suggested trapidil could be used as a probe to identify specific genes mediating the fibrotic response to continuous PTH; expression profiling comparing distal femora of rats treated with continuous PTH with or without trapidil revealed 29 genes that were altered by trapidil treatment. This subset of PTH-regulated genes clustered functionally into categories related to fibrosis. One of the most interesting of these genes was LOX.

LOX is an extracellular matrix-remodeling enzyme that initiates the covalent cross-linking of collagen and elastin by oxidizing lysine residues into {alpha}-aminoadipic acid-{delta}-semialdehyde (37). These aldehyde residues spontaneously form covalent cross-linkages that make collagen polymers insoluble. Intermittent treatment with PTH increased type 1 collagen expression and bone formation but not LOX expression (15). Trapidil decreased the expression of mRNA sequences for the untranslated 3' region (S77494) and coding regions (S66184 and S77494) of LOX in rats treated with continuous PTH. Additionally, trapidil decreased the expression of a gene similar to LOXL1 (AA800844). Increased expression of LOX is associated with excessive accumulation of insoluble collagen fibers and has been reported in many forms of pathological tissue fibrosis (38). Recent studies also demonstrate that LOX plays an important role in breast cancer metastasis and cancer-induced fibrosis (39). LOXL1, which cross-links elastin, is also increased in pathological tissue fibrosis (40). The present study demonstrates that inhibition of LOX activity with the highly specific LOX inhibitor BAPN decreases the pathological mineralization associated with continuous PTH. This finding suggests LOX-mediated collagen cross-linking plays a causative role in the abnormal mineralization that is a hallmark of parathyroid bone disease.

Initially produced as prolysyl oxidase, LOX is activated by BMP-1 (41), which also mediates the proteolytic processing of collagens 1 and 11 (42). In the present study, we show that continuous, but not intermittent, PTH increases BMP-1 gene expression in the distal femur. Thus, continuous PTH not only increases the skeletal expression of LOX but also increases the expression of BMP-1, a gene that activates LOX.

Wnt signaling has been implicated in the skeletal response to PTH (23), and Sizzled, a secreted inhibitor of Wnt signaling, is a natural inhibitor of BMP-1 activity (43). In the present study, we show that continuous, but not intermittent, PTH increases Wnt 4 gene expression. This finding may be relevant to parathyroid bone disease because increased Wnt 4 expression is profibrotic (44, 45). Thus, we conclude that peritrabecular bone marrow fibrosis is associated with increased expression of several genes that process extracellular matrix proteins.

In the present study, we localized high levels of LOX expression to resident mature bone marrow mast cells in the distal femur. We previously localized PDGF-A to mast cells in rats treated with continuous PTH (16), and patients with mastocytosis (Turner, R. T., unpublished data). A significant role for mast cells in fibrosis has been established for several tissues; mast cells produce and release products involved in the development of fibrosis, including PDGF-A, TGF-β, basic fibroblast growth factor, tryptase, and histamine (46, 47). We have recently shown that mast cell-deficient rodents are resistant to PTH-induced peritrabecular bone marrow fibrosis (Turner, R. T., unpublished data), suggesting that mast cells play an essential role in mediating PTH-induced fibrosis. However, immunohistochemistry failed to detect receptors for PTH or PDGF on mast cells. In addition, PTH did not increase cAMP production, indicative of activation of PTH receptor, in cultured human mast cells (HMC-1) (Turner, R. T., unpublished data). In contrast to these negative findings, PTH receptors were detected on osteoblast lineage cells and on a limited number of bone marrow cells. Low levels of immunostaining for PDGF receptor were also detected in osteoblast lineage cells. These findings suggest that although mast cells appear to produce both LOX and PDGF-A and are ideally situated to promote tissue fibrosis, it is unlikely they are direct targets of PTH action.

The fibroblasts responsible for continuous PTH-induced peritrabecular fibrosis are preosteoblasts (6). Based on immunohistochemistry, these cells become more osteoblast-like after their migration to bone surfaces (6). Although they retain a fibroblastic morphology, the peritrabecular fibroblasts and surrounding extracellular matrix become positive for osteonectin and later osteocalcin (6). Further investigation is required to determine the significance of the PTH receptor-positive bone marrow cells identified by immunohistochemistry. We speculate that these are PTH target cells and are important to the physiological actions of PTH on bone metabolism as well as peritrabecular fibrosis.

Taken together, our findings suggest PTH targets a population of early PTH receptor-positive preosteoblastic fibroblasts within bone marrow and induces their proliferation and migration to bone surfaces where, in the continued presence of high levels of the hormone, they secrete large quantities of extracellular matrix. The present results also support an important causative role for PDGF-A in the skeletal response to continuous PTH. The results imply PI3K signaling is necessary for the bone catabolic as well as fibrotic actions of PTH and that abnormal matrix processing is responsible for the defective mineralization. Finally, our results suggest small-molecule antagonists directed against specific receptors, downstream signaling pathways, and enzymes may be useful in preventing or reversing the detrimental skeletal effects associated with HPT.


   Acknowledgments
 
We acknowledge Dr. Gobinda Sarkar for the RT-PCR protocol and Jill Pfaff and Paul Lapke for technical assistance.


   Footnotes
 
This work was supported by National Institutes of Health Grants AR48833 and AA011140 (to R.T.T.).

Current address for S.L.: Department of Oral Medicine, Infection and Immunity Harvard School of Dental Medicine, Boston, Massachusetts 02115.

Current address for M.Z.: Endocrine Research, Mayo Clinic College of Medicine, Rochester, Minnesota 55905.

Disclosure Statement: The authors have nothing to disclose.

First Published Online July 17, 2008

1 M.B.L. and S.L. contributed equally to this work. Back

Abbreviations: BAPN, β-Aminopropionitrile; HPT, primary hyperparathyroidism; LOX, lysyl oxidase; PDGF, platelet-derived growth factor; PI3K, phosphoinositide 3-kinase; RNase, ribonuclease; SSC, saline-sodium citrate.

Received January 29, 2008.

Accepted for publication July 3, 2008.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Dobnig H, Turner RT 1995 Evidence that intermittent treatment with parathyroid hormone increases bone formation in adult rats by activation of bone lining cells. Endocrinology 136:3632–3638[Abstract]
  2. Ishizuya T, Yokose S, Hori M, Noda T, Suda T, Yoshiki S, Yamaguchi A 1997 Parathyroid hormone exerts disparate effects on osteoblast differentiation depending on exposure time in rat osteoblastic cells. J Clin Invest 99:2961–2970[Medline]
  3. Kaiser E, Sato M, Onyia JE, Chandrasekhar S 2001 Parathyroid hormone (1–34) regulates integrin expression in vivo in rat osteoblasts. J Cell Biochem 83:617–630[CrossRef][Medline]
  4. Locklin RM, Khosla S, Turner RT, Riggs BL 2003 Mediators of the biphasic responses of bone to intermittent and continuously administered parathyroid hormone. J Cell Biochem 89:180–190[CrossRef][Medline]
  5. Lotinun S, Sibonga JD, Turner RT 2002 Differential effects of intermittent and continuous administration of parathyroid hormone on bone histomorphometry and gene expression. Endocrine 17:29–36[CrossRef][Medline]
  6. Lotinun S, Sibonga JD, Turner RT 2005 Evidence that the cells responsible for marrow fibrosis in a rat model for hyperparathyroidism are preosteoblasts. Endocrinology 146:4074–4081[Abstract/Free Full Text]
  7. Tam CS, Heersche JN, Murray TM, Parsons JA 1982 Parathyroid hormone stimulates the bone apposition rate independently of its resorptive action: differential effects of intermittent and continuous administration. Endocrinology 110:506–512[Abstract/Free Full Text]
  8. Dobnig H, Turner RT 1997 The effects of programmed administration of human parathyroid hormone fragment (1–34) on bone histomorphometry and serum chemistry in rats. Endocrinology 138:4607–4612[Abstract/Free Full Text]
  9. Khan A, Bilezikian J 2000 Primary hyperparathyroidism: pathophysiology and impact on bone. CMAJ 163:184–187[Abstract/Free Full Text]
  10. Ferreira A 2006 Development of renal bone disease. Eur J Clin Invest 36(Suppl 2):2–12
  11. Bilezikian JP, Meng X, Shi Y, Silverberg SJ 2000 Primary hyperparathyroidism in women: a tale of two cities—New York and Beijing. Int J Fertil Womens Med 45:158–165[Medline]
  12. Silverberg SJ, Bilezikian JP 2001 Clinical presentation of primary hyperparathyroidism in the United States. In: Bilezikian JP, Marcus R, Levine MA, eds. The parathyroids: basic and clinical concepts. 2nd ed. San Diego: Academic Press; 349–360
  13. Elder G 2002 Pathophysiology and recent advances in the management of renal osteodystrophy. J Bone Miner Res 17:2094–2105[CrossRef][Medline]
  14. Li X, Liu H, Qin L, Tamasi J, Bergenstock M, Shapses S, Feyen JH, Notterman DA, Partridge NC 2007 Determination of dual effects of parathyroid hormone on skeletal gene expression in vivo by microarray and network analysis. J Biol Chem 282:33086–33097[Abstract/Free Full Text]
  15. Onyia JE, Helvering LM, Gelbert L, Wei T, Huang S, Chen P, Dow ER, Maran A, Zhang M, Lotinun S, Lin X, Halladay DL, Miles RR, Kulkarni NH, Ambrose EM, Ma YL, Frolik CA, Sato M, Bryant HU, Turner RT 2005 Molecular profile of catabolic versus anabolic treatment regimens of parathyroid hormone (PTH) in rat bone: an analysis by DNA microarray. J Cell Biochem 95:403–418[CrossRef][Medline]
  16. Lotinun S, Sibonga JD, Turner RT 2003 Triazolopyrimidine (trapidil), a platelet-derived growth factor antagonist, inhibits parathyroid bone disease in an animal model for chronic hyperparathyroidism. Endocrinology 144:2000–2007[Abstract/Free Full Text]
  17. Qin L, Qiu P, Wang L, Li X, Swarthout JT, Soteropoulos P, Tolias P, Partridge NC 2003 Gene expression profiles and transcription factors involved in parathyroid hormone signaling in osteoblasts revealed by microarray and bioinformatics. J Biol Chem 278:19723–19731[Abstract/Free Full Text]
  18. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  19. Huffman MD, Curci JA, Moore G, Kerns DB, Starcher BC, Thompson RW 2000 Functional importance of connective tissue repair during the development of experimental abdominal aortic aneurysms. Surgery 128:429–438[CrossRef][Medline]
  20. Bonnelye E, Merdad L, Kung V, Aubin JE 2001 The orphan nuclear estrogen receptor-related receptor alpha (ERR{alpha}) is expressed throughout osteoblast differentiation and regulates bone formation in vitro. J Cell Biol 153:971–984[Abstract/Free Full Text]
  21. Baron R, Vignery A, Neff L, Silvergate A, Santa Maria A 1983 Processing of undecalcified bone specimens for bone histomorphometry. In: Recker RR, ed. Bone histomorphometry: techniques and interpretation. Boca Raton, FL: CRC Press; 13–35
  22. Daddow LY 1986 An abbreviated method of the double lead stain technique. J Submicrosc Cytol 18:221–224[Medline]
  23. Kulkarni NH, Halladay DL, Miles RR, Gilbert LM, Frolik CA, Galvin RJ, Martin TJ, Gillespie MT, Onyia JE 2005 Effects of parathyroid hormone on Wnt signaling pathway in bone. J Cell Biochem 95:1178–1190[CrossRef][Medline]
  24. Bando K, Kannuki S, Rokutan K, Shouno M, Matsumoto K 1995 Effects of trapidil and suramin on growth factor-induced calcium response and tyrosine phosphorylation in human glioma cells. Neurol Med Chir (Tokyo) 35:631–638[CrossRef][Medline]
  25. Mazurov AV, Menshikov M, Leytin VL, Tkachuk VA, Repin VS 1984 Decrease of platelet aggregation and spreading via inhibition of the cAMP phosphodiesterase by trapidil. FEBS Lett 172:167–171[CrossRef][Medline]
  26. Ohnishi H, Kosuzume H, Hayashi Y, Yamaguchi K, Suzuki Y, Itoh R 1981 Effects of trapidil on thromboxane A2-induced aggregation of platelets, ischemic changes in heart and biosynthesis of thromboxane A2. Prostaglandins Med 6:269–281[CrossRef][Medline]
  27. Zhou L, Ismaili J, Stordeur P, Thielemans K, Goldman M, Pradier O 1999 Inhibition of the CD40 pathway of monocyte activation by triazolopyrimidine. Clin Immunol 93:232–238[CrossRef][Medline]
  28. Bonisch D, Weber AA, Wittpoth M, Osinski M, Schror K 1998 Antimitogenic effects of trapidil in coronary artery smooth muscle cells by direct activation of protein kinase A. Mol Pharmacol 54:241–248[Abstract/Free Full Text]
  29. O'Sullivan S, Naot D, Callon K, Porteous F, Horne A, Wattie D, Watson M, Cornish J, Browett P, Grey A 2007 Imatinib promotes osteoblast differentiation by inhibiting PDGFR signaling and inhibits osteoclastogenesis by both direct and stromal cell-dependent mechanisms. J Bone Miner Res 22:1679–1689[CrossRef][Medline]
  30. Koslowski R, Seidel D, Kuhlisch E, Knoch KP 2003 Evidence for the involvement of TGF-β and PDGF in the regulation of prolyl 4-hydroxylase and lysyloxidase in cultured rat lung fibroblasts. Exp Toxicol Pathol 55:257–264[CrossRef][Medline]
  31. Rodgers K, McMahon B, Mitchell D, Sadlier D, Godson C 2005 Lipoxin A4 modifies platelet-derived growth factor-induced pro-fibrotic gene expression in human renal mesangial cells. Am J Pathol 167:683–694[Abstract/Free Full Text]
  32. Jimenez C, Portela RA, Mellado M, Rodriguez-Frade JM, Collard J, Serrano A, Martinez AC, Avila J, Carrera AC 2000 Role of the PI3K regulatory subunit in the control of actin organization and cell migration. J Cell Biol 151:249–262[Abstract/Free Full Text]
  33. Kim SJ, Kim SY, Kwon CH, Kim YK 2007 Differential effect of FGF and PDGF on cell proliferation and migration in osteoblastic cells. Growth factors 25:77–86[CrossRef][Medline]
  34. Onishi K, Higuchi M, Asakura T, Masuyama N, Gotoh Y 2007 The PI3K-Akt pathway promotes microtubule stabilization in migrating fibroblasts. Genes Cells 12:535–546[Abstract/Free Full Text]
  35. Zhang H, Bajraszewski N, Wu E, Wang H, Moseman AP, Dabora SL, Griffin JD, Kwiatkowski DJ 2007 PDGFRs are critical for PI3K/Akt activation and negatively regulated by mTOR. J Clin Invest 117:730–738[CrossRef][Medline]
  36. Yamamoto T, Kambe F, Cao X, Lu X, Ishiguro N, Seo H 2007 Parathyroid hormone activates phosphoinositide 3-kinase-Akt-Bad cascade in osteoblast-like cells. Bone 40:354–359[CrossRef][Medline]
  37. Kagan HM 1994 Lysyl oxidase: mechanism, regulation and relationship to liver fibrosis. Pathol Res Pract 190:910–919[Medline]
  38. van der Slot AJ, Zuurmond AM, van den Bogaerdt AJ, Ulrich MM, Middelkoop E, Boers W, Karel Ronday H, DeGroot J, Huizinga TW, Bank RA 2004 Increased formation of pyridinoline cross-links due to higher telopeptide lysyl hydroxylase levels is a general fibrotic phenomenon. Matrix Biol 23:251–257[CrossRef][Medline]
  39. Erler JT, Giaccia AJ 2006 Lysyl oxidase mediates hypoxic control of metastasis. Cancer Res 66:10238–10241[Abstract/Free Full Text]
  40. Akiri G, Sabo E, Dafni H, Vadasz Z, Kartvelishvily Y, Gan N, Kessler O, Cohen T, Resnick M, Neeman M, Neufeld G 2003 Lysyl oxidase-related protein-1 promotes tumor fibrosis and tumor progression in vivo. Cancer Res 63:1657–1666[Abstract/Free Full Text]
  41. Uzel MI, Shih SD, Gross H, Kessler E, Gerstenfeld LC, Trackman PC 2000 Molecular events that contribute to lysyl oxidase enzyme activity and insoluble collagen accumulation in osteosarcoma cell clones. J Bone Miner Res 15:1189–1197[CrossRef][Medline]
  42. Medeck RJ, Sosa S, Morris N, Oxford JT 2003 BMP-1-mediated proteolytic processing of alternatively spliced isoforms of collagen type XI. Biochem J 376:361–368[CrossRef][Medline]
  43. Lee HX, Ambrosio AL, Reversade B, De Robertis EM 2006 Embryonic dorsal-ventral signaling: secreted frizzled-related proteins as inhibitors of tolloid proteinases. Cell 124:147–159[CrossRef][Medline]
  44. Jiang F, Parsons CJ, Stefanovic B 2006 Gene expression profile of quiescent and activated rat hepatic stellate cells implicates Wnt signaling pathway in activation. J Hepatol 45:401–409[CrossRef][Medline]
  45. Surendran K, McCaul SP, Simon TC 2002 A role for Wnt-4 in renal fibrosis. Am J Physiol Renal Physiol 282:F431–F441
  46. Galli SJ, Kalesnikoff J, Grimbaldeston MA, Piliponsky AM, Williams CM, Tsai M 2005 Mast cells as "tunable" effector and immunoregulatory cells: recent advances. Annu Rev Immunol 23:749–786[CrossRef][Medline]
  47. Pejler G, Abrink M, Ringvall M, Wernersson S 2007 Mast cell proteases. Adv Immunol 95:167–255[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lowry, M. B.
Right arrow Articles by Turner, R. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lowry, M. B.
Right arrow Articles by Turner, R. T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals