| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Cell Biology (J.J.P., J.R., X.L.) and Obstetrics and Gynecology (J.J.P.), University of Connecticut Health Center, Farmington, Connecticut 06030
Address all correspondence and requests for reprints to: John J. Peluso, Ph.D., Department of Cell Biology, University of Connecticut Health Center, Farmington, Connecticut 06030. E-mail: peluso{at}nso2.uchc.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
One reason for this void is that the receptor that mediates P4s antiapoptotic actions has not been conclusively identified. Interestingly, studies conducted in the late 1970s (11, 12) and early 1980s (13, 14) demonstrated that P4 binds to ovarian preparations with a Kd in the nanomolar range. With the discovery that the nuclear PGR mediates P4s actions within the uterus and other tissues (15), it was generally assumed that the P4 binding within the ovary was due to the presence of PGR. This assumption was proven incorrect when the pioneering studies of Park and Mayo (16, 17, 18) conclusively demonstrated that PGR is not expressed by granulosa cells of developing follicles and luteal cells of the rat. These studies were independently confirmed by studies from the laboratories of Richards (19) and Billig (20). Subsequent studies have also shown that P4s antiapoptotic action is initiated at the membrane (3, 10).
After eliminating receptors such as the GABAA and glucocorticoid receptors (21, 22), which promiscuously bind P4, serpine mRNA binding protein (SERBP1), which is also referred to as plasminogen activator inhibitor 1 RNA binding protein (PAIRBP1), was shown to be involved in transducing P4s antiapoptotic action (23, 24). Further studies revealed that PAIRBP1 binds progesterone receptor membrane component-1 (PGRMC1), a P4 binding protein initially isolated from porcine liver (25). That PGRMC1 transduces P4s action in the ovary is supported by the observations that 1) it is expressed in granulosa and luteal cells, 2) it is detected at the plasma membrane, 3) its overexpression results in an increase in [3H]P4 binding and P4 responsiveness, and 4) an antibody to PGRMC1 completely attenuates P4s antiapoptotic action (24). Although these studies provide strong evidence that PGRMC1 mediates P4s action, genetic deletion of PGRMC1 is required to demonstrate that PGRMC1 is the membrane progesterone receptor that initiates P4s antiapoptotic action. Thus, the first series of studies was designed to assess the effect of PGRMC1 small interfering RNA (siRNA) treatment on P4s actions.
To expand and complement the siRNA-based studies, a second series of investigations used both deletion and point mutants of PGRMC1 to assess PGRMC1s actions. PGRMC1 is a 28-kDa protein that has a short N terminus (amino acids 1–20), a single pass transmembrane domain (amino acids 21–69), and a C terminus that has a heme-binding domain (amino acids 70–130) and several potential kinase binding sites (3, 26, 27). Constructs were made that encode GFP-PGRMC1 deletion mutants without 1) the N terminus, 2) the majority of the C terminus, or 3) the C terminus distal to the heme-binding domain (i.e. amino acids 131–194). An aspartic acid to glycine point mutation at amino acid 120 (i.e. within the heme-binding domain) was also made, because this mutation alters PGRMC1 function (28). These PGRMC1 mutants were used to assess the structure-function characteristics of PGRMC1.
| Materials and Methods |
|---|
|
|
|---|
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and PGRMC1 siRNA treatment
GAPDH siRNA treatment.
To define optimal transfection conditions, SIGCs were plated on 12-mm glass coverslips in 35-mm culture dishes and cultured for 24 h before transfection. Cells were then transfected using either siPORT Amine or siPORT NeoFx transfection agent using the protocols provided by Ambion (Austin, TX). Cells were transfected with either scramble control (catalog no. AM4611) or GAPDH (catalog no. AM4624) siRNA at a final concentration of 30 nM. After a 72-h exposure to either scramble or GAPDH siRNA, the cells were fixed in 4% paraformaldehyde for 7 min, permeabilized for 7 min in 0.1% Triton X-100, washed with 3% BSA/PBS for 1 h, and then rinsed in distilled water and stored at 4 C until processed for immunocytochemical evaluation of GAPDH.
To detect GAPDH, cells were incubated for 1 h with a GAPDH antibody (1:800 dilution; Ambion, Austin, TX) and then washed in PBS and incubated for 1 additional hour with a 1:100 dilution of Alexa-Fluor 488-conjugated goat antimouse IgG antibody (Invitrogen, Eugene, OR). After staining, the coverglasses were rinsed in PBS and then water and mounted on glass microscope slides in ProLong Gold antifade reagent (Invitrogen, Eugene, OR). The edges of the coverglass were then sealed with nail polish, and the slides observed under a fluorescein isothiocyanate (FITC) filter set. As a negative control, the primary antibody was omitted from the staining protocol.
PGRMC1 siRNA treatement.
Once the siPORT NeoFx transfection agent was established as the better transfection agent, scramble (catalog no. AM4611) or one of three predesigned PGRMC1 siRNAs (Ambion siRNA ID 253163, 253164, and 253165) was mixed with siPORT NeoFX transfection agent to yield a final concentration of 30 nM and siRNA transfection carried out according the siPORT NeoFX protocol outlined by Ambion. PGRMC1 siRNA ID 253163 and 253165 targeted sequences in the noncoding region (nucleotides 977–994 and 1329–1348, respectively). PGRMC1 siRNA ID 253164 targeted the polyA tail of PGRMC1 (nucleotides 1853–1870). Seventy-two hours after transfection, cells were fixed and immunocytochemically stained for PGRMC1 and PAIRBP1. For immunocytochemical staining, the primary antibodies were used at a dilution of 1:50 for PGRMC1 (24) and PAIRBP1 (23). The secondary antibody was either an Alexa-Fluor 488-conjugated goat antirabbit or Alexa-Fluor 633 antichicken IgG antibody.
This pilot study revealed that PGRMC1 siRNA 253164 was the most effective PGRMC1 siRNA. Based on this observation, PGRMC1 siRNA 253164 was transfected as described above and the cells cultured for 24 h. The relative amount of PGRMC1 and PAIRBP1 remaining after PGRMC1 siRNA treatment was determined using the following quantitative approach. After treatment with either scramble or PGRMC1 siRNA, cells were fixed and stained for either PGRMC1 or PAIRBP1 as previously described. Images from each treatment were taken from five random areas within the culture dish. These images were collected using the same photographic and optical settings so that they could be compared. Using iVision software (Biovision Technologies, Exton, PA), the specific fluorescent intensity in grayscale units (values 0–255)/area (pixel) of confluent of cells in each image was determined. PGRMC1 protein levels, expressed as fluorescent intensity units/pixel, were calculated for cells treated with either scramble or PGRMC1 siRNA. A similar analysis was conducted for PAIRBP1 expression. Values were ultimately expressed as a percentage of the scramble control treatment. This entire experiment was repeated on 5 different days.
PGRMC1 siRNA treatment and SIGC function
Apoptosis.
Twenty-four hours after transfection with scramble or PGRMC1 siRNA (ID 253164), which was determined to be the most effective PGRMC1 siRNA, the SIGCs were washed and placed in serum-free medium in the presence or absence of 1 µM P4. Apoptotic cells were detected by in situ nuclear staining after 5 h of serum-free culture, because this is the optimal time to assess apoptosis in this model system (30). For these experiments, the nuclear stain, YOPRO-1, was added directly into each culture chamber at a final concentration of 10 µM. The cells were then incubated for 10 min at 37 C and observed under fluorescent optics using the FITC filter set. The number of fluorescent cells (i.e. apoptotic cells) in a field was counted. The total number of cells in that field was counted under phase optics. A total of 100 cells per well were counted and the percentage of apoptotic cells calculated (31).
[3H]P4 binding.
To assess the effect of PGRMC1 siRNA, binding studies must be conducted at a saturating concentration of [3H]P4. To determine this concentration, SIGCs were plated at 3.6 x 105 cells/35-mm culture dish and cultured overnight in serum-supplemented medium. The cells were washed twice in PBS and then incubated at 4 C in 500 µl 0.1% digitonin in Tris-EDTA-molybdate-glycerol-dithiothreitol (TEMGD) buffer as described (21). After 30 min, increasing concentrations of [1,2,6,7-3H]progesterone (specific activity = 86 Ci/mmol; Amersham, Arlington Heights, IL) was added in the presence or absence of 10–4 M P4 and the incubation continued for an additional 60 min. The cells were then washed several times, harvested, and then filtered through Whatman Glass Microfiber filters (GF/F) (Fisher Scientific Inc., Pittsburgh, PA). The filters were rinsed five times with 1 ml cold PBS, and then the filters were placed in a scintillation vial with 5 ml scintillation fluid and counted in a scintillation counter. Specific binding was determined by subtracting the dpm associated with the 10–4 M P4 treatment from the dpm of the non-P4 treatment.
After it was determined that 1 x 106 dpm was a saturating dose of [3H]P4, SIGCs were transfected with either scramble or PGRMC1 siRNA as described. Twenty-four hours after transfection, the cells were incubated with 1 x 106 dpm of [3H]P4, and their ability to bind [3H]P4 was assessed as described above. The specific [3H]P4 binding associated with the PGRMC1 siRNA treatment was expressed as a percentage of the scramble control.
GFP-PGRMC1 expression vectors
Total mRNA was isolated from SIGCs and cDNA generated as previously described (23). The entire coding region of PGRMC1 was then amplified using the following primer pair: sense: TTCTCGAGATGGCTGCCGAGGATGTG (with XhoI site) and antisense: AGAAGCTTGTCACTCTTCCGAGC (with HindIII site). PGRMC1 was then cloned into pEGFP-N1 vector (Clontech, Mountain View, CA) at XhoI and HindIII restriction sites. The resulting construct, referred to as GFP-PGRMC1, was sequenced to ensure that it correctly encoded PGRMC1. GFP-PGRMC1 was used as a template with the primers shown in Table 1
to generate the deletion mutants. Each of these PGRMC1 constructs was verified by restriction enzyme digest and referred to by the amino acid sequence that they encode.
|
Transfection and localization of GFP-PGRMC1 mutants
SIGCs were plated in 35-mm culture dishes as previously described. After 24 h, cells were transfected using Lipofectamine (Life Technologies, Rockville, MD) according to the manufacturers instructions. SIGCs were transfected with 2 µg/dish of each GFP-PGRMC1 expression construct and after 24 h observed under the FITC optics to estimate the percentage of transfected cells and the cellular localization of the GFP fusion proteins.
To monitor the levels of GFP fusion proteins, transfected cells were lysed in RIPA buffer (50 mM Tris, 150 mM sodium chloride, 1.0 mM EDTA, 1% Nonidet P-40, and 0.25% sodium deoxycholate, pH 7.0), which was supplemented with complete protease inhibitor cocktail (Roche, Mannheim, Germany) and phosphatase inhibitor cocktail 1 (Sigma Chemical Co., St Louis, MO). The lysate was centrifuged at 16,000 relative centrifugal force at 4 C for 5 min. Protein concentration was determined using the BCA protein assay (Bio-Rad, Hercules, CA). Levels of GFP-fusion protein were determined by Western blot analysis using previously published protocols (23) and antibodies to either GFP (1:2000 dilution; Cell Signaling, Danvers, MA) or PGRMC1 (1:2000 dilution) (24). In some cases, Western blots were also run to assess PAIRBP1 expression as previously described (23). All Western blot protocols included a negative control in which the primary antibody was omitted.
Purification of GFP-PGRMC1 fusion proteins
For experiments involving the purification of GFP-fusion proteins, 1 x 107 cells were plated in 100-mm culture dishes and cultured overnight. The cells were then transfected using Lipofectamine as described. Twenty-four hours after transfection, SIGCs were lysed in 1 ml cold RIPA buffer and centrifuged, and the supernatant was collected. The GFP-PGRMC1 fusion proteins were isolated using the protocol and reagents provided by Miltenyi Biotec (Auburn, CA). Briefly the cellular supernatant was transferred to a 1.5-ml tube and 50 µl anti-GFP microbeads added to the supernatant to magnetically label the GFP-tagged PGRMC1 protein. After a 30-min incubation on ice, the supernatant was loaded onto a GFP-µMACS column, which was placed in a magnetic field. The supernatant was then passed through the column and the column rinsed with wash buffer. The column was removed from the magnetic field, 70 µl TEMGD buffer without digitonin was added to the column, and a 40-µl fraction was collected.
For protocols involving either Coomassie Blue staining or Western blot, the isolation protocol was modified such that the TEMGD buffer was replaced with a 70 µl preheated (95 C) elution buffer and a 40-µl fraction collected. To assess the purity of the GFP-PGRMC1 isolation protocol, the eluted proteins were separated on a 10% acrylamide gel and then either stained with 0.2% Coomassie Blue for 40 min or processed for Western blot analysis.
[3H]P4 binding to partially purified PGRMC1.
Displacement studies were conducted in which the effect of increasing concentrations of nonradioactive P4 on [3H]P4 binding was determined. For each binding experiment, GFP-PGRMC1 was isolated as previously described. Typically, GFP-PGRMC1 was isolated from two 100-mm culture dishes, which provided enough protein to run 12 binding assays.
[3H]P4 (
1.0 x 105 dpm) was added to 100 µl TEMGD buffer without digitonin in the presence or absence of 10–4 M P4 and placed in a 1.5-ml Eppendorf tube together with 10 µl purified protein. This reaction mixture was incubated at 4 C for 1 h and then filtered through Whatman glass microfiber filters. After five washes in cold PBS, the filters were counted in a scintillation counter.
In addition, SIGCs were transfected with the different GFP-PGRMC1 mutants and these GFP fusion proteins isolated. Binding studies were conducted in the presence or absence of 10–4 M P4. Specific [3H]P4 binding was determined and binding expressed as a percentage of the [3H]P4 specifically bound to the wild-type GFP-PGRMC1 (21). For these studies, aliquots of each partially purified protein preparation was run on a gel and either stained with Coomassie Blue for total protein and/or assessed for GFP-fusion proteins by Western blot to ensure that the binding assays were conducted with approximately equal amounts of each GFP-PGRMC1 fusion protein.
Apoptosis.
To determine whether mutations of PGRMC1 were capable for mediating P4s antiapoptotic action, SIGCs were plated on 35-mm dishes with glass coverslip bottoms (MatTek Corp., Ashland, MA). After 24 h, the cells were transfected with 2 µg/dish of each PGRMC1 mutant. After an additional 24 h, the serum-supplemented medium was removed and the cells placed in serum-free medium supplemented with a suboptimal dose of P4 (1 nM P4) (24). After 5 h, the cells were rinsed three times in Krebs/HEPES buffer and stained with 4',6-diamidino-2-phenylindole (DAPI) (0.3 µM in Krebs/HEPES buffer) for 10 min at 37 C in the dark. After staining, the cells were rinsed three times in Krebs/HEPES buffer and observed under epifluorescent optics.
To determine whether mutations of PGRMC1 altered the cells ability to respond to P4, random areas within each cell culture were sequentially observed under a FITC filter set and a DAPI filter set. Images of each area under each optical condition were captured and stored in a computer. By comparing the images from the same area, the transfection status (FITC-green fluorescence) and viability (apoptosis; DAPI-blue fluorescence) of each cell could be determined. Approximately 100 transfected cells per culture dish were evaluated for apoptosis. The percentage of transfected apoptotic cells per treatment dish was calculated (24).
Statistical analysis
All experiments were repeated two to three times with each experiment yielding essentially identical results. When appropriate, data from each replicate was pooled and analyzed by either a Students t test if only two treatment groups were involved or by a one-way ANOVA followed by a Student-Newman-Keuls test, if means of three or more treatment groups were compared. P values of <0.05 were considered to be significant regardless of the statistical test used.
| Results |
|---|
|
|
|---|
|
|
|
To expand these findings, a GFP-expression vector that encoded PGRMC1 was transfected into SIGCs. After 24 h, the amount of GFP-PGRMC1 fusion protein, detected on a Western blot as a 56-kDa protein (i.e. 28 kDa for GFP plus 28 kDa for PGRMC1), was severalfold greater than the amount of endogenous PGRMC1. This increase in GFP-PGRMC1 corresponded to 30–40% of the cells being transfected (Fig. 4
).
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
It has been proposed that PGRMC1 interacts with PAIRBP1 to form a complex, which functions as a membrane receptor for P4 (8). It has been assumed that PGRMC1 is the P4 binding protein in this complex because partially purified PGRMC1 from porcine liver binds P4 (33). The present binding studies on partially purified PGRMC1 demonstrate that PGRMC1 is the P4 binding protein. Moreover, an analysis of the P4-PGRMC1 binding characteristics indicates that P4 binds competitively and reversibly to PGRMC1 at a single binding site with an apparent Kd of about 35 nM. This is consistent with the presence of the high-affinity binding (apparent Kd of 11 nM) observed for PGRMC1 isolated and purified from porcine liver (33).
As illustrated by the saturation binding experiment (Fig. 3B
), the maximal amount of P4 bound to intact SIGCs is approximately 2 fmol/µg or 1.2 x 109 P4 binding sites/µg. This represents binding to about 4 x 105 cells, indicating that SIGCs possess approximately 3000 P4 binding sites per cell. PGRMC1 siRNA treatment reduces both PGRMC1 levels and [3H]P4 binding by about 60%, suggesting that at least 1800 of these sites are due to PGRMC1. The remaining 40% of specific P4 binding sites could also be due to PGRMC1, because the PGRMC1 siRNA treatment did not completely deplete endogenous PGRMC1 levels. Alternatively, some other P4 binding proteins such as the membrane progestin receptors described by Thomas and colleagues (34, 35) could account for P4 binding sites remaining after PGRMC1 siRNA treatment, although the expression of these receptors have not been documented in SIGCs. Importantly, the remaining P4 binding sites cannot be due to the PGR, because SIGCs do not express PGRs (22).
Although these studies demonstrate the importance of PGRMC1 in regulating P4-mediated cell survival, they do not address its mechanism of action. To begin to address this issue, studies were designed to correlate the structural components of PGRMC1 with their function. PGRMC1 is a relatively small protein (28 kDa) composed of a short N terminus, a transmembrane domain, and a C terminus that contains a heme-binding domain and putative kinase interaction sites (26). All of the deletion and point mutations in this study possessed the transmembrane domain and at least a short segment of the C terminus that is adjacent to the transmembrane domain. Moreover, all of these mutants localized to the same cellular sites as judged by GFP fluorescence. This is most likely due to the fact that each mutant had an intact transmembrane domain. Several interesting findings were observed using these PGRMC1 mutants.
First, these studies reveal that deletion or alteration in any segment of PGRMC1 results in a 60–80% decrease in [3H]P4 binding. As might be expected based on the [3H]P4 binding data, SIGCs transfected with these mutants fail to respond to a suboptimal dose of P4. The reduced ability to bind P4 accounts at least in part for the reduction in P4 responsiveness. However, because all the segments influence P4 binding, these studies were not able to identify the segments that are involved in activating the downstream components of P4s signal transduction cascade. Future studies will have to employ alternate approaches to identify those PGRMC1 segments that are involved in signal transduction. The most likely segment to be involved in signal transduction is the C terminus, given that in silico analysis of PGRMC1 revealed a heme-binding domain and several putative SH2 and SH3 sites in this segment [see reviews by Peluso (2, 3) or Cahill (26)].
The second interesting aspect relates to the P4 binding site. This has been a difficult issue to resolve because bacterially expressed PGRMC1 bind heme but not P4 (36, 37). Although this cast doubt on PGRMC1s ability to act as a P4 receptor, failure of the bacterially expressed PGRMC1 to bind P4 may be related to improper folding or the absence of posttranslational modifications, which are characteristic of bacterially expressed protein. Because of these issues, the present binding studies were conducted on GFP-tagged PGRMC1 that was purified from GFP-PGRMC1-transfected SIGCs. This isolation protocol detected a single specific 56-kDa Coomassie Blue-stained band, which was also detected by a GFP antibody. Binding studies on GFP-PGRMC1 demonstrate that PGRMC1 binds P4 with a high affinity (an apparent Kd of 35 nM), which is well within the levels of P4 in serum and in follicular fluid (38).
These studies also suggest that the P4 binding site within PGRMC1 is localized between amino acids 20 and 70 (i.e. the transmembrane domain and an adjacent segment of the C terminus). This conclusion is based on the fact that the only segment common to the PGRMC1 mutants is the segment between amino acids 20–70. Because modeling of the binding characteristics revealed only one binding site within PGRMC1, the P4 binding site is likely to be in this segment. This putative localization of the P4 binding site is consistent with the chemical modification studies that indicate that the P4 binding site is within a hydrophobic region most likely associated with the transmembrane domain (27, 39).
Third, these studies demonstrate that all the mutants bind [3H]P4 but at a significantly reduced level compared with wild-type control. Given that there is only one binding site, this implies that other segments of PGRMC1 influence P4 binding affinity. There are at least three ways that these non-P4 binding segments could enhance P4 binding affinity. First, the entire PGRMC1 molecule may be required to produce a three-dimensional site capable of binding P4 with high affinity. This fits well with the finding that chemical modification of several amino acids within different segments reduces PGRMC1s capacity to bind P4 (39). Second, specific segments may be required to allow PGRMC1 to form dimers or oligomers. PGRMC1 dimerizes through the formation of disulfide bonds (40). These bonds can be broken by dithiothreitol treatment resulting in the formation of monomers and a decrease in P4 binding (39, 40). Finally, other proteins could interact with PGRMC1 at unknown sites and influence P4 binding. Importantly, all three of these possibilities could represent physiologically relevant mechanisms, because they are not mutually exclusive.
To date, a limited number of PGRMC1 binding partners have been identified (8, 41, 42, 43). One binding partner, PAIRBP1 (8), may influence P4-PGRMC1 interaction, because overexpression of PAIRBP1 increases [3H]P4 binding by about 20% (23). It does not appear that PAIRBP1 directly binds P4, because the 1–70 PGRMC1 mutant does not interact with PAIRBP1 but binds P4 to the same degree as the other PGRMC1 mutants that do bind PAIRBP1. Also, the amount of PAIRBP1 bound to wild-type PGRMC1 is similar to other mutants that show a reduced capacity to bind [3H]P4. However, to conclusively resolve this issue, the capacity of PAIRBP1 to directly bind P4 in the absence of PGRMC1 must be determined.
Although PAIRBP1 does not appear to bind to the putative P4 binding site (i.e. amino acids 20–70), it does appear to interact with the heme-binding domain (i.e. amino acids 70–130). This assessment is based on the observations that the 1–70 PGRMC1 mutant does not interact with PARIBP1, whereas the 1–130 PGRMC1 mutant, which encodes the entire heme-binding domain but none of the remaining C terminus of PGRMC1, does bind PAIRBP1. Interestingly, the D120G point mutation, which is within the heme-binding domain, reduces the capacity of PGRMC1 to bind heme (28) but does not alter the PAIRBP1-PGRMC1 interaction. This implies that PAIRBP1 binding to the heme-binding domain of PGRMC1 is not dependent on the precise sequence that is required to bind heme-proteins. Thus, the exact binding site of the PAIRBP1-PGRMC1 interaction remains to be elucidated.
The fourth and final point involves the D120G mutant. As indicated, this point mutation results in the loss of P4s ability to activate its antiapoptotic signal transduction cascade. This is consistent with the initial observation by Cravens group that this PGRMC1 mutation renders breast cancer cells more sensitive to the apoptotic effects of various chemotherapeutic agents (28, 44, 45). The precise mechanism by which this point mutation influences cell survival is likely to have at least two components. First, in cells that are exposed to P4, it can reduce P4 binding, thereby making them less responsive to P4s antiapoptotic action. Second, this point mutation alters the ability of PGRMC1 to interact with heme-proteins (28). There are numerous heme-proteins with some expressed in a cell-specific manner and others ubiquitously (for review see Ref. 46). Therefore, PGRMC1-heme-protein interactions could be an important part of a survival mechanism that affects numerous cell types. Future studies will be required to identify heme-proteins that specifically bind PGRMC1 and regulate PGRMC1-mediated cell survival.
In summary, the present studies provide genetic-based evidence that PGRMC1 mediates P4s antiapoptotic action with each structural component of PGRMC1 playing an essential but still undefined role in this antiapoptotic mechanism. These studies also demonstrate that PGRMC1 specifically binds P4 with the most likely binding site being localized to the transmembrane domain and an adjacent segment of the C terminus. Finally, these studies suggest that PAIRBP1 binds to PGRMC1 through an interaction with the heme-binding domain of PGRMC1. Taken together, these studies not only begin to shed light on the complexities of PGRMC1 but also illustrate the need for future detailed investigations into the structural-functional relationships of PGRMC1.
| Acknowledgments |
|---|
| Footnotes |
|---|
Disclosure Statement: The authors have nothing to declare.
First Published Online November 8, 2007
Abbreviations: DAPI, 4',6-Diamidino-2-phenylindole; FITC, fluorescein isothiocyanate; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; P4, progesterone; PAIRBP1, plasminogen activator inhibitor 1 RNA binding protein; PGR, nuclear progesterone receptor; PGRMC1, progesterone receptor membrane component-1; SIGC, spontaneously immortalized granulosa cell; siRNA, small interfering RNA; TEMGD, Tris-EDTA-molybdate-glycerol-dithiothreitol.
Received July 30, 2007.
Accepted for publication October 30, 2007.
| References |
|---|
|
|
|---|
-dependent pathway. Endocrinology 141:4209–4217
. Biol Reprod 71:1870–1878This article has been cited by other articles:
![]() |
J. J. Peluso, A. Gawkowska, X. Liu, T. Shioda, and J. K. Pru Progesterone Receptor Membrane Component-1 Regulates the Development and Cisplatin Sensitivity of Human Ovarian Tumors in Athymic Nude Mice Endocrinology, November 1, 2009; 150(11): 4846 - 4854. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Peluso, X. Liu, A. Gawkowska, and E. Johnston-MacAnanny Progesterone Activates a Progesterone Receptor Membrane Component 1-Dependent Mechanism That Promotes Human Granulosa/Luteal Cell Survival But Not Progesterone Secretion J. Clin. Endocrinol. Metab., July 1, 2009; 94(7): 2644 - 2649. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Liu, J. Wang, L. Zhao, J. Nilsen, K. McClure, K. Wong, and R. D. Brinton Progesterone Increases Rat Neural Progenitor Cell Cycle Gene Expression and Proliferation Via Extracellularly Regulated Kinase and Progesterone Receptor Membrane Components 1 and 2 Endocrinology, July 1, 2009; 150(7): 3186 - 3196. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Friberg, D.G. J. Larsson, and H. Billig Dominant Role of Nuclear Progesterone Receptor in the Control of Rat Periovulatory Granulosa Cell Apoptosis Biol Reprod, June 1, 2009; 80(6): 1160 - 1167. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Gomez, A. Gutierrez-Adan, C. Diez, P. Bermejo-Alvarez, M. Munoz, A. Rodriguez, J. Otero, M. Alvarez-Viejo, D. Martin, S. Carrocera, et al. Biological differences between in vitro produced bovine embryos and parthenotes Reproduction, February 1, 2009; 137(2): 285 - 295. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Mansouri, J. Schuster, J. Badhai, E.-L. Stattin, R. Losel, M. Wehling, B. Carlsson, O. Hovatta, P. O. Karlstrom, I. Golovleva, et al. Alterations in the expression, structure and function of progesterone receptor membrane component-1 (PGRMC1) in premature ovarian failure Hum. Mol. Genet., December 1, 2008; 17(23): 3776 - 3783. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Peluso, X. Liu, M. M. Saunders, K. P. Claffey, and K. Phoenix Regulation of Ovarian Cancer Cell Viability and Sensitivity to Cisplatin by Progesterone Receptor Membrane Component-1 J. Clin. Endocrinol. Metab., May 1, 2008; 93(5): 1592 - 1599. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |