help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2007-1050
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Peluso, J. J.
Right arrow Articles by Liu, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peluso, J. J.
Right arrow Articles by Liu, X.
Endocrinology Vol. 149, No. 2 534-543
Copyright © 2008 by The Endocrine Society

Progesterone Receptor Membrane Component-1 (PGRMC1) Is the Mediator of Progesterone’s Antiapoptotic Action in Spontaneously Immortalized Granulosa Cells As Revealed by PGRMC1 Small Interfering Ribonucleic Acid Treatment and Functional Analysis of PGRMC1 Mutations

John J. Peluso, Jonathan Romak and Xiufang Liu

Departments of Cell Biology (J.J.P., J.R., X.L.) and Obstetrics and Gynecology (J.J.P.), University of Connecticut Health Center, Farmington, Connecticut 06030

Address all correspondence and requests for reprints to: John J. Peluso, Ph.D., Department of Cell Biology, University of Connecticut Health Center, Farmington, Connecticut 06030. E-mail: peluso{at}nso2.uchc.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Progesterone (P4) receptor membrane component-1 (PGRMC1) and its binding partner, plasminogen activator inhibitor 1 RNA binding protein (PAIRBP1) are thought to form a complex that functions as membrane receptor for P4. The present investigations confirm PGRMC1’s role in this membrane receptor complex by demonstrating that depleting PGMRC1 with PGRMC1 small interfering RNA results in a 60% decline in [3H]P4 binding and the loss of P4’s antiapoptotic action. Studies conducted on partially purified GFP-PGRMC1 fusion protein indicate that [3H]P4 specifically binds to PGRMC1 at a single site with an apparent Kd of about 35 nM. In addition, experiments using various deletion mutations reveal that the entire PGRMC1 molecule is required for maximal [3H]P4 binding and P4 responsiveness. Analysis of the binding data also suggests that the P4 binding site is within a segment of PGRMC1 that is composed of the transmembrane domain and the initial segment of the C terminus. Interestingly, PAIRBP1 appears to bind to the C terminus between amino acids 70–130, which is distal to the putative P4 binding site. Taken together, these data provide compelling evidence that PGRMC1 is the P4 binding protein that mediates P4’s antiapoptotic action. Moreover, the deletion mutation studies indicate that each domain of PGRMC1 plays an essential role in modulating PGRMC1’s capacity to both bind and respond to P4. Additional studies are required to more precisely delineate the role of each PGRMC1 domain in transducing P4’s antiapoptotic action.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PROGESTERONE (P4) PLAYS several important roles in regulating ovarian function (1, 2, 3, 4). Specifically, P4 is essential for ovulation and studies using P4 receptor knockout mice demonstrate that P4’s role in ovulation is mediated at least in part through the nuclear progesterone receptor (PGR) (4). In addition, antagonist studies have implicated PGR in the mechanism that promotes the viability of granulosa cells of preovulatory follicles (5, 6, 7). However, it has been known for several decades that P4 also influences the rate of development and steroidogenesis of developing follicles (for review see Ref. 2). More recent studies have shown that P4 directly acts on granulosa cells of developing follicles and luteal cells to maintain their viability (8). P4’s antiapoptotic action has also been observed in a cell line derived from rat granulosa cells, i.e. spontaneously immortalized granulosa cells (SIGCs) (3, 9, 10). Despite these well-documented findings, the mechanism by which P4 acts to preserve ovarian cell viability has not been defined.

One reason for this void is that the receptor that mediates P4’s antiapoptotic actions has not been conclusively identified. Interestingly, studies conducted in the late 1970s (11, 12) and early 1980s (13, 14) demonstrated that P4 binds to ovarian preparations with a Kd in the nanomolar range. With the discovery that the nuclear PGR mediates P4’s actions within the uterus and other tissues (15), it was generally assumed that the P4 binding within the ovary was due to the presence of PGR. This assumption was proven incorrect when the pioneering studies of Park and Mayo (16, 17, 18) conclusively demonstrated that PGR is not expressed by granulosa cells of developing follicles and luteal cells of the rat. These studies were independently confirmed by studies from the laboratories of Richards (19) and Billig (20). Subsequent studies have also shown that P4’s antiapoptotic action is initiated at the membrane (3, 10).

After eliminating receptors such as the GABAA and glucocorticoid receptors (21, 22), which promiscuously bind P4, serpine mRNA binding protein (SERBP1), which is also referred to as plasminogen activator inhibitor 1 RNA binding protein (PAIRBP1), was shown to be involved in transducing P4’s antiapoptotic action (23, 24). Further studies revealed that PAIRBP1 binds progesterone receptor membrane component-1 (PGRMC1), a P4 binding protein initially isolated from porcine liver (25). That PGRMC1 transduces P4’s action in the ovary is supported by the observations that 1) it is expressed in granulosa and luteal cells, 2) it is detected at the plasma membrane, 3) its overexpression results in an increase in [3H]P4 binding and P4 responsiveness, and 4) an antibody to PGRMC1 completely attenuates P4’s antiapoptotic action (24). Although these studies provide strong evidence that PGRMC1 mediates P4’s action, genetic deletion of PGRMC1 is required to demonstrate that PGRMC1 is the membrane progesterone receptor that initiates P4’s antiapoptotic action. Thus, the first series of studies was designed to assess the effect of PGRMC1 small interfering RNA (siRNA) treatment on P4’s actions.

To expand and complement the siRNA-based studies, a second series of investigations used both deletion and point mutants of PGRMC1 to assess PGRMC1’s actions. PGRMC1 is a 28-kDa protein that has a short N terminus (amino acids 1–20), a single pass transmembrane domain (amino acids 21–69), and a C terminus that has a heme-binding domain (amino acids 70–130) and several potential kinase binding sites (3, 26, 27). Constructs were made that encode GFP-PGRMC1 deletion mutants without 1) the N terminus, 2) the majority of the C terminus, or 3) the C terminus distal to the heme-binding domain (i.e. amino acids 131–194). An aspartic acid to glycine point mutation at amino acid 120 (i.e. within the heme-binding domain) was also made, because this mutation alters PGRMC1 function (28). These PGRMC1 mutants were used to assess the structure-function characteristics of PGRMC1.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SIGC culture
SIGCs were used in these studies. These cells were derived from rat granulosa cells isolated from preovulatory follicles as described by Stein et al. (29). Unless otherwise indicated, SIGCs were plated at 2 x 105 cells/ml in 35-mm culture dishes or glass Lab-Tek slides for studies of apoptosis. The cultures were maintained for 24 h in DMEM-F12 supplemented with 5% fetal bovine serum. After 24 h, cells were washed three times in serum-free DMEM-F12 and treated according to the protocols outlined in each experiment.

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and PGRMC1 siRNA treatment
GAPDH siRNA treatment.
To define optimal transfection conditions, SIGCs were plated on 12-mm glass coverslips in 35-mm culture dishes and cultured for 24 h before transfection. Cells were then transfected using either siPORT Amine or siPORT NeoFx transfection agent using the protocols provided by Ambion (Austin, TX). Cells were transfected with either scramble control (catalog no. AM4611) or GAPDH (catalog no. AM4624) siRNA at a final concentration of 30 nM. After a 72-h exposure to either scramble or GAPDH siRNA, the cells were fixed in 4% paraformaldehyde for 7 min, permeabilized for 7 min in 0.1% Triton X-100, washed with 3% BSA/PBS for 1 h, and then rinsed in distilled water and stored at 4 C until processed for immunocytochemical evaluation of GAPDH.

To detect GAPDH, cells were incubated for 1 h with a GAPDH antibody (1:800 dilution; Ambion, Austin, TX) and then washed in PBS and incubated for 1 additional hour with a 1:100 dilution of Alexa-Fluor 488-conjugated goat antimouse IgG antibody (Invitrogen, Eugene, OR). After staining, the coverglasses were rinsed in PBS and then water and mounted on glass microscope slides in ProLong Gold antifade reagent (Invitrogen, Eugene, OR). The edges of the coverglass were then sealed with nail polish, and the slides observed under a fluorescein isothiocyanate (FITC) filter set. As a negative control, the primary antibody was omitted from the staining protocol.

PGRMC1 siRNA treatement.
Once the siPORT NeoFx transfection agent was established as the better transfection agent, scramble (catalog no. AM4611) or one of three predesigned PGRMC1 siRNAs (Ambion siRNA ID 253163, 253164, and 253165) was mixed with siPORT NeoFX transfection agent to yield a final concentration of 30 nM and siRNA transfection carried out according the siPORT NeoFX protocol outlined by Ambion. PGRMC1 siRNA ID 253163 and 253165 targeted sequences in the noncoding region (nucleotides 977–994 and 1329–1348, respectively). PGRMC1 siRNA ID 253164 targeted the polyA tail of PGRMC1 (nucleotides 1853–1870). Seventy-two hours after transfection, cells were fixed and immunocytochemically stained for PGRMC1 and PAIRBP1. For immunocytochemical staining, the primary antibodies were used at a dilution of 1:50 for PGRMC1 (24) and PAIRBP1 (23). The secondary antibody was either an Alexa-Fluor 488-conjugated goat antirabbit or Alexa-Fluor 633 antichicken IgG antibody.

This pilot study revealed that PGRMC1 siRNA 253164 was the most effective PGRMC1 siRNA. Based on this observation, PGRMC1 siRNA 253164 was transfected as described above and the cells cultured for 24 h. The relative amount of PGRMC1 and PAIRBP1 remaining after PGRMC1 siRNA treatment was determined using the following quantitative approach. After treatment with either scramble or PGRMC1 siRNA, cells were fixed and stained for either PGRMC1 or PAIRBP1 as previously described. Images from each treatment were taken from five random areas within the culture dish. These images were collected using the same photographic and optical settings so that they could be compared. Using iVision software (Biovision Technologies, Exton, PA), the specific fluorescent intensity in grayscale units (values 0–255)/area (pixel) of confluent of cells in each image was determined. PGRMC1 protein levels, expressed as fluorescent intensity units/pixel, were calculated for cells treated with either scramble or PGRMC1 siRNA. A similar analysis was conducted for PAIRBP1 expression. Values were ultimately expressed as a percentage of the scramble control treatment. This entire experiment was repeated on 5 different days.

PGRMC1 siRNA treatment and SIGC function
Apoptosis.
Twenty-four hours after transfection with scramble or PGRMC1 siRNA (ID 253164), which was determined to be the most effective PGRMC1 siRNA, the SIGCs were washed and placed in serum-free medium in the presence or absence of 1 µM P4. Apoptotic cells were detected by in situ nuclear staining after 5 h of serum-free culture, because this is the optimal time to assess apoptosis in this model system (30). For these experiments, the nuclear stain, YOPRO-1, was added directly into each culture chamber at a final concentration of 10 µM. The cells were then incubated for 10 min at 37 C and observed under fluorescent optics using the FITC filter set. The number of fluorescent cells (i.e. apoptotic cells) in a field was counted. The total number of cells in that field was counted under phase optics. A total of 100 cells per well were counted and the percentage of apoptotic cells calculated (31).

[3H]P4 binding.
To assess the effect of PGRMC1 siRNA, binding studies must be conducted at a saturating concentration of [3H]P4. To determine this concentration, SIGCs were plated at 3.6 x 105 cells/35-mm culture dish and cultured overnight in serum-supplemented medium. The cells were washed twice in PBS and then incubated at 4 C in 500 µl 0.1% digitonin in Tris-EDTA-molybdate-glycerol-dithiothreitol (TEMGD) buffer as described (21). After 30 min, increasing concentrations of [1,2,6,7-3H]progesterone (specific activity = 86 Ci/mmol; Amersham, Arlington Heights, IL) was added in the presence or absence of 10–4 M P4 and the incubation continued for an additional 60 min. The cells were then washed several times, harvested, and then filtered through Whatman Glass Microfiber filters (GF/F) (Fisher Scientific Inc., Pittsburgh, PA). The filters were rinsed five times with 1 ml cold PBS, and then the filters were placed in a scintillation vial with 5 ml scintillation fluid and counted in a scintillation counter. Specific binding was determined by subtracting the dpm associated with the 10–4 M P4 treatment from the dpm of the non-P4 treatment.

After it was determined that 1 x 106 dpm was a saturating dose of [3H]P4, SIGCs were transfected with either scramble or PGRMC1 siRNA as described. Twenty-four hours after transfection, the cells were incubated with 1 x 106 dpm of [3H]P4, and their ability to bind [3H]P4 was assessed as described above. The specific [3H]P4 binding associated with the PGRMC1 siRNA treatment was expressed as a percentage of the scramble control.

GFP-PGRMC1 expression vectors
Total mRNA was isolated from SIGCs and cDNA generated as previously described (23). The entire coding region of PGRMC1 was then amplified using the following primer pair: sense: TTCTCGAGATGGCTGCCGAGGATGTG (with XhoI site) and antisense: AGAAGCTTGTCACTCTTCCGAGC (with HindIII site). PGRMC1 was then cloned into pEGFP-N1 vector (Clontech, Mountain View, CA) at XhoI and HindIII restriction sites. The resulting construct, referred to as GFP-PGRMC1, was sequenced to ensure that it correctly encoded PGRMC1. GFP-PGRMC1 was used as a template with the primers shown in Table 1Go to generate the deletion mutants. Each of these PGRMC1 constructs was verified by restriction enzyme digest and referred to by the amino acid sequence that they encode.


View this table:
[in this window]
[in a new window]

 
TABLE 1.
 
A point mutation at amino acid 120 (D120G) was made using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). Briefly, the PCR mixture contained 100 ng pEGFP-N1-PGRMC1, 125 ng of the primer pairs (primer 1, 5'-GTCTTTGCTGGAAGAGGTG CATCCAGGGGCCTTGCCACATT TTGC-3', and primer 2, 5'-GCAAAATGTGGCAAGGCCCCTGGATGCACCTCTTCCAGCAAAGAC-3'), 300 mM dNTPs, 2.5 U PfuTurbo DNA polymerase, and the buffer supplied with the polymerase in a total volume of 50 µl. PCR was performed under the following conditions: denaturation at 95 C for 30 sec, followed by 12 cycles of denaturation at 95 C for 30 sec, annealing at 55 C for 1 min, and extension at 68 C for 5 min. An aliquot of the PCR mixture was examined by agarose gel electrophoresis to determine whether the correct-sized product (5300 bp) was obtained. Finally, the PCR product was incubated with 10 U DpnI for 1 h at 37 C to digest the parental supercoiled DNA. The digested PCR product was then transformed into 50 µl XL-1 Blue supercompetent cells. The presence of the mutation was verified by DNA sequencing.

Transfection and localization of GFP-PGRMC1 mutants
SIGCs were plated in 35-mm culture dishes as previously described. After 24 h, cells were transfected using Lipofectamine (Life Technologies, Rockville, MD) according to the manufacturer’s instructions. SIGCs were transfected with 2 µg/dish of each GFP-PGRMC1 expression construct and after 24 h observed under the FITC optics to estimate the percentage of transfected cells and the cellular localization of the GFP fusion proteins.

To monitor the levels of GFP fusion proteins, transfected cells were lysed in RIPA buffer (50 mM Tris, 150 mM sodium chloride, 1.0 mM EDTA, 1% Nonidet P-40, and 0.25% sodium deoxycholate, pH 7.0), which was supplemented with complete protease inhibitor cocktail (Roche, Mannheim, Germany) and phosphatase inhibitor cocktail 1 (Sigma Chemical Co., St Louis, MO). The lysate was centrifuged at 16,000 relative centrifugal force at 4 C for 5 min. Protein concentration was determined using the BCA protein assay (Bio-Rad, Hercules, CA). Levels of GFP-fusion protein were determined by Western blot analysis using previously published protocols (23) and antibodies to either GFP (1:2000 dilution; Cell Signaling, Danvers, MA) or PGRMC1 (1:2000 dilution) (24). In some cases, Western blots were also run to assess PAIRBP1 expression as previously described (23). All Western blot protocols included a negative control in which the primary antibody was omitted.

Purification of GFP-PGRMC1 fusion proteins
For experiments involving the purification of GFP-fusion proteins, 1 x 107 cells were plated in 100-mm culture dishes and cultured overnight. The cells were then transfected using Lipofectamine as described. Twenty-four hours after transfection, SIGCs were lysed in 1 ml cold RIPA buffer and centrifuged, and the supernatant was collected. The GFP-PGRMC1 fusion proteins were isolated using the protocol and reagents provided by Miltenyi Biotec (Auburn, CA). Briefly the cellular supernatant was transferred to a 1.5-ml tube and 50 µl anti-GFP microbeads added to the supernatant to magnetically label the GFP-tagged PGRMC1 protein. After a 30-min incubation on ice, the supernatant was loaded onto a GFP-µMACS column, which was placed in a magnetic field. The supernatant was then passed through the column and the column rinsed with wash buffer. The column was removed from the magnetic field, 70 µl TEMGD buffer without digitonin was added to the column, and a 40-µl fraction was collected.

For protocols involving either Coomassie Blue staining or Western blot, the isolation protocol was modified such that the TEMGD buffer was replaced with a 70 µl preheated (95 C) elution buffer and a 40-µl fraction collected. To assess the purity of the GFP-PGRMC1 isolation protocol, the eluted proteins were separated on a 10% acrylamide gel and then either stained with 0.2% Coomassie Blue for 40 min or processed for Western blot analysis.

[3H]P4 binding to partially purified PGRMC1.
Displacement studies were conducted in which the effect of increasing concentrations of nonradioactive P4 on [3H]P4 binding was determined. For each binding experiment, GFP-PGRMC1 was isolated as previously described. Typically, GFP-PGRMC1 was isolated from two 100-mm culture dishes, which provided enough protein to run 12 binding assays.

[3H]P4 (~1.0 x 105 dpm) was added to 100 µl TEMGD buffer without digitonin in the presence or absence of 10–4 M P4 and placed in a 1.5-ml Eppendorf tube together with 10 µl purified protein. This reaction mixture was incubated at 4 C for 1 h and then filtered through Whatman glass microfiber filters. After five washes in cold PBS, the filters were counted in a scintillation counter.

In addition, SIGCs were transfected with the different GFP-PGRMC1 mutants and these GFP fusion proteins isolated. Binding studies were conducted in the presence or absence of 10–4 M P4. Specific [3H]P4 binding was determined and binding expressed as a percentage of the [3H]P4 specifically bound to the wild-type GFP-PGRMC1 (21). For these studies, aliquots of each partially purified protein preparation was run on a gel and either stained with Coomassie Blue for total protein and/or assessed for GFP-fusion proteins by Western blot to ensure that the binding assays were conducted with approximately equal amounts of each GFP-PGRMC1 fusion protein.

Apoptosis.
To determine whether mutations of PGRMC1 were capable for mediating P4’s antiapoptotic action, SIGCs were plated on 35-mm dishes with glass coverslip bottoms (MatTek Corp., Ashland, MA). After 24 h, the cells were transfected with 2 µg/dish of each PGRMC1 mutant. After an additional 24 h, the serum-supplemented medium was removed and the cells placed in serum-free medium supplemented with a suboptimal dose of P4 (1 nM P4) (24). After 5 h, the cells were rinsed three times in Krebs/HEPES buffer and stained with 4',6-diamidino-2-phenylindole (DAPI) (0.3 µM in Krebs/HEPES buffer) for 10 min at 37 C in the dark. After staining, the cells were rinsed three times in Krebs/HEPES buffer and observed under epifluorescent optics.

To determine whether mutations of PGRMC1 altered the cells’ ability to respond to P4, random areas within each cell culture were sequentially observed under a FITC filter set and a DAPI filter set. Images of each area under each optical condition were captured and stored in a computer. By comparing the images from the same area, the transfection status (FITC-green fluorescence) and viability (apoptosis; DAPI-blue fluorescence) of each cell could be determined. Approximately 100 transfected cells per culture dish were evaluated for apoptosis. The percentage of transfected apoptotic cells per treatment dish was calculated (24).

Statistical analysis
All experiments were repeated two to three times with each experiment yielding essentially identical results. When appropriate, data from each replicate was pooled and analyzed by either a Student’s t test if only two treatment groups were involved or by a one-way ANOVA followed by a Student-Newman-Keuls test, if means of three or more treatment groups were compared. P values of <0.05 were considered to be significant regardless of the statistical test used.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A comparison of siPORT Amine and siPORT NeoFx transfection reagents demonstrated that the siPORT NeoFx protocol was more effective in delivering GAPDH siRNA than the siPORT Amine protocol. GAPDH levels after transfecting GAPDH siRNA using the siPORT NeoFx protocol were dramatically reduced (Fig. 1BGo) compared with scramble siRNA control (Fig. 1AGo). Using the siPORT NeoFx protocol, SIGCs were incubated with 30 nM of one of three predesigned PGRMC1 siRNAs. After 72 h, all the PGRMC1 siRNAs suppressed PGRMC1 levels to some degree as assessed by immunocytochemistry (compare Fig. 1Go, D–F with C). PGRMC1 siRNA ID 253163 (Fig. 1EGo) and 253165 (Fig. 1DGo) appeared to be less effective in reducing PGRMC1 levels than PGRMC1 siRNA ID 253164 (Figs. 1FGo and 2Go). A quantitative analysis of PGRMC1 expression revealed that this PGRMC1 siRNA reduced PGRMC1 levels by about 55% (P < 0.05) without affecting PAIRBP1 levels (Fig. 2BGo). Based on this finding, only this PGRMC1 siRNA was used in subsequent experiments and will be referred to as PGRMC1 siRNA throughout the remainder of this text.


Figure 1
View larger version (43K):
[in this window]
[in a new window]

 
FIG. 1. The effect of scramble (A) and GAPDH siRNA (B) on GAPDH expression and the effect of scramble (C) or one of three different PGRMC1 (D–F) siRNAs on the expression of PGRMC1. Both GAPDH and PGRMC1 were assessed by immunofluorescence staining.

 

Figure 2
View larger version (29K):
[in this window]
[in a new window]

 
FIG. 2. A, The effect of either scramble or PGRMC1 siRNA treatment on the expression of PGRMC1 (green) and PAIRBP1 (red) in SIGCs as assessed by immunofluorescence staining; B, quantitative estimate of immunofluorescent-stained PGRMC1 and PAIRBP1. Scramble control values were set to 100%. Values are means ± 1 SE. *, Values significantly different from scramble control value (P < 0.05).

 
To assess the effect of PGRMC1 depletion, SIGCs were treated with either scramble or PGRMC1 siRNA. Twenty-four hours later, the ability of P4 to suppress apoptosis induced by serum withdrawal was monitored. As seen in Fig. 3AGo, treatment with PGRMC1 siRNA completely attenuated P4’s ability to suppress apoptosis.


Figure 3
View larger version (8K):
[in this window]
[in a new window]

 
FIG. 3. The effect of either scramble or PGRMC1 siRNA treatment on SIGC function. A, Effect of these siRNA treatments on P4’s ability to prevent apoptosis; B, effect of increasing [3H]P4 on specific [3H]P4 binding to intact SIGCs. The dashed line in B represents the best fit as described by a polynomial equation (r = 0.91). Note that maximal specific [3H]P4 binding is achieved with the addition of 1 x 106 dpm [3H]P4 (i.e. 4.7 pmol). C, Effect of either scramble or PGRMC1 siRNA treatment on the capacity of intact SIGCs to specifically bind [3H]P4 when [3H]P4 is added at a saturating dose (1 x 106 dpm). Values in A and C are means ± 1 SE. *, Value significantly different from the appropriate control value (P < 0.05).

 
Before the effect of PGRMC1 siRNA on [3H]P4 binding could be estimated, it was necessary to determine the amount [3H]P4 that was required to achieve maximal [3H]P4 binding to intact SIGCs. The data in Fig. 3BGo showed that maximal [3H]P4 binding was achieved at approximately 2 fmol [3H]P4/µg protein. Moreover, under these saturation [3H]P4 binding conditions, PGRMC1 siRNA treatment reduced [3H]P4 binding to cultured SIGCs by about 60% of control values (Fig. 3CGo). This is consistent with the degree to which PGRMC1 siRNA depleted PGRMC1 levels.

To expand these findings, a GFP-expression vector that encoded PGRMC1 was transfected into SIGCs. After 24 h, the amount of GFP-PGRMC1 fusion protein, detected on a Western blot as a 56-kDa protein (i.e. 28 kDa for GFP plus 28 kDa for PGRMC1), was severalfold greater than the amount of endogenous PGRMC1. This increase in GFP-PGRMC1 corresponded to 30–40% of the cells being transfected (Fig. 4Go).


Figure 4
View larger version (43K):
[in this window]
[in a new window]

 
FIG. 4. GFP-PGRMC1 expression in SIGCs. Overexpression of GFP-PGRMC1 increases the amount of a 56-kDa band that is detected by both the PGRMC1-NT antibody and the antibody to GFP (left). Note that this results in a dramatic increase in PGRMC1 levels compared with endogenous levels of PGRMC1 (faint 28-kDa band in upper left panel). The negative controls did not show any bands. Transfection of GFP-PGRMC1 results in 30–40% of the cells being transfected as judged by GFP fluorescence (right).

 
To determine whether PGRMC1 directly binds [3H]P4, SIGCs were transfected with either empty vector or GFP-PGRMC1. GFP proteins were then isolated after transfection using GFP-µMACS beads. The GFP fusion proteins were then separated by gel electrophoresis and stained with Coomassie Blue. Major protein bands at 25, 48, and 62 kDa were detected among the eluted proteins isolated after transfection with either the empty GFP vector or GFP-PGRMC1 vector. However, a 28- or a 56-kDa band was observed among the eluted proteins from cells transfected with the empty GFP vector or the GFP-PGRMC1 vector, respectively (Fig. 5AGo). Both of these bands were also detected using a GFP antibody in a Western blot analysis (Fig. 5BGo). Binding studies demonstrated that partially purified GFP-PGRMC1 fusion protein specifically bound [3H]P4 (Fig. 5CGo). Subsequent studies demonstrated that specific [3H]P4 binding was reduced with increasing concentrations of nonradioactive P4 (Fig. 6Go). Analysis of these binding data revealed that P4 bound to a single site with a correlation coefficient (r) of 0.92. The sole P4 binding site had an apparent Kd of 35 nM. Moreover a Hill plot yielded a straight line with a slope (nH) of 1.08, indicating that P4 binding was competitive and reversible (Fig. 6Go, inset).


Figure 5
View larger version (33K):
[in this window]
[in a new window]

 
FIG. 5. Isolation of GFP fusion proteins using the anti-GFP µMACS beads. SIGCs were transfected with either empty vector (pEGFP-N1) or GFP-PGRMC1. Twenty-four hours after transfection, cells were lysed and GFP-fusion proteins isolated as described in Materials and Methods. The GFP isolates were run on a gel and stained with either Coomassie Blue (A) or analyzed for the presence of GFP-fusion proteins by Western blot (B). Coomassie Blue-stained bands at 25, 48, and 62 kDa were detected among the eluted proteins isolated from cells transfected with empty vector and GFP-PGRMC1. However, a 28- and 56-kDa band was among the eluted proteins from empty vector and GFP-PGRMC1, respectively. These bands were also detected by Western blot using the GFP antibody (B). The negative control for the GFP Western blot did not show any bands. C, Total binding, nonspecific binding, and specific binding of [3H]P4 to partially purified GFP-proteins.

 

Figure 6
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 6. Ligand binding analysis of [3H]P4 to partially purified GFP-PGRMC1 fusion protein. Specific [3H]P4 binding decreased with the addition of nonradioactive P4. Hill plot analysis (inset) yielded a straight line with a slope of 1.08, indicting that [3H]P4 specifically bound to GFP-PGRMC1 in a competitive and reversible manner.

 
To further assess PGRMC1’s role in mediating P4’s antiapoptotic action, a series of depletion mutants were generated. The mutants were referred to by the amino acid sequences that they encode (Fig. 7AGo). Each of these mutants possessed a transmembrane domain and were efficiently transfected into SIGCs as judged by GFP Western blots (Fig. 7BGo). In addition, all of these mutants appeared to have the same cellular localization (Fig. 7CGo). Interestingly, each partially purified deletion mutant was capable of specifically binding [3H]P4 but at a level 60–80% less than that of the wild-type PGRMC1 (i.e. 1–194) (Fig. 8AGo). The reduction in [3H]P4 binding capacity of each mutant correlated to its inability to prevent apoptosis after treatment with a suboptimal dose of P4 (Fig. 8BGo).


Figure 7
View larger version (43K):
[in this window]
[in a new window]

 
FIG. 7. GFP-PGRMC1 mutants. A, Diagram that identifies each domain of PGRMC1, with numbers at the top representing amino acid numbers; B, Western blot probed with the GFP antibody that reveals that after transfection with the different GFP-PGRMC1 mutants, the appropriate-sized GFP-fusion protein is detected. The negative control for the GFP Western blot did not show any bands. Each GFP-PGRMC1 mutant was highly expressed and possessed the same cellular localization as revealed by GFP fluorescence (C).

 

Figure 8
View larger version (9K):
[in this window]
[in a new window]

 
FIG. 8. A, Capacity of the various partially purified GFP-PGRMC1 fusion proteins to specifically binding [3H]P4. The numbers associated with each GFP-PGRMC1 fusion protein represent the amino acids that are encoded by the vector. B, Effect of transfecting the various GFP-PGRMC1 mutants on their ability to transduce P4’s antiapoptotic action in intact SIGCs. In both A and B, values are expressed as means ± 1 SE. *, Value that is significantly different from either the wild-type (1–194) vector (A) or the empty vector (B).

 
Because PAIRBP1 interacts with PGRMC1 and may influence PGRMC1’s capacity to bind P4, studies were undertaken to determine which if any of the PGRMC1 mutants were able to bind PAIRBP1. As seen in Fig. 9AGo, relatively equal amounts of GFP-PGRMC1 protein were isolated from SIGCs transfected with each mutant, but only the 1–70 PGRMC1 mutant failed to bind PAIRBP1. Failure of the 1–70 PGRMC1 mutant to bind PAIRBP1 was not due to insufficient levels of PAIRBP1 as demonstrated by the Western blot shown in Fig. 9BGo. In addition, a point mutation in the heme-binding domain of PGRMC1 (D120G) also bound PAIRBP1.


Figure 9
View larger version (47K):
[in this window]
[in a new window]

 
FIG. 9. A, PAIRBP1-PGRMC1 interaction as detected in the GFP pull-down assay. In this assay, SIGCs were transfected with GFP-PGRMC1 deletion mutants as well as the GFP-PGRMC1 D120G point mutation. GFP-PGRMC1 fusion proteins were isolated and Western blot performed using antibodies to GFP and PAIRBP1. Note that the GFP Western blot demonstrated that approximately the same amount of each GFP-PGRMC1 fusion protein was isolated for each vector. However, PAIRBP1 Western blot detected PAIRBP1 with all the mutants except the 1–70 deletion PGRMC1 mutant. B, Western blot analysis revealed that similar amounts of PAIRBP1 were present within all the lysates before the isolation of GFP-fusion proteins. The negative controls for the GFP and PAIRBP1 Western blots did not show any bands.

 
Because previous studies demonstrated that the D120G mutant alters PGRMC1’s function in breast cancer cells (28), studies were undertaken to assess D120G’s ability to bind and respond to P4. These studies revealed that this point mutation was effectively transfected (Fig. 10AGo) and showed the same cellular localization as wild-type PGRMC1 (compare Fig. 10BGo with either Fig. 4Go or 7C). However, the partially purified D120G mutant had a reduced ability to bind [3H]P4 (Fig. 10CGo), and cells transfected with this D120G mutant were not responsive to the antiapoptotic effect of suboptimal P4 (Fig. 10DGo).


Figure 10
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 10. The expression, localization, and function of the GFP-PGRMC1 point mutant D120G. SIGCs were transfected with either GFP-PGRMC1 or GFP-PGRMC1-D120G. After 24 h, approximately the same amount of GFP-PGRMC1 fusion protein was detected in lysates from each treatment as revealed by Western blots using antibodies to either PGRMC1 or GFP. The negative controls for the PGRMC1 and GFP Western blots did not show any bands. The GFP-PGRMC1-D120G mutant has the same transfection efficiency and cellular localization as the other GFP-PGRMC1 fusion proteins (compare B with Fig. 4Go). The partially purified D120G point mutation has a reduced capacity to bind (C), and cells transfected with this mutant did not respond to a suboptimal concentration of P4 (1 nM) (D). Values are presented as means ± 1 SE. *, Value that is significantly different from the appropriate control (P < 0.05).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although numerous studies have shown that P4 inhibits apoptosis of granulosa and luteal cells as well as SIGCs (for review see Ref. 2), the receptor that mediates this antiapoptotic action has not been conclusively identified. Previous studies using overexpression and blocking antibody approaches suggest that PGRMC1 is involved in transducing P4’s antiapoptotic action (24). The present siRNA-based studies provide additional genetic evidence that PGRMC1 is the P4 binding protein that mediates P4’s antiapoptotic signal. This conclusion is based on the observations that PGRMC1 siRNA treatment selectively depletes PGRMC1 levels and that depletion of PGRMC1 results in a reduced ability to bind P4 and an inability of the cells to respond to P4. Because P4 inhibits apoptosis (32) and mitosis (22) by a common mechanism (i.e. by maintaining low basal intracellular levels of free calcium) (32), it is likely that ligand activation of PGRMC1 also accounts for P4’s antimitotic action.

It has been proposed that PGRMC1 interacts with PAIRBP1 to form a complex, which functions as a membrane receptor for P4 (8). It has been assumed that PGRMC1 is the P4 binding protein in this complex because partially purified PGRMC1 from porcine liver binds P4 (33). The present binding studies on partially purified PGRMC1 demonstrate that PGRMC1 is the P4 binding protein. Moreover, an analysis of the P4-PGRMC1 binding characteristics indicates that P4 binds competitively and reversibly to PGRMC1 at a single binding site with an apparent Kd of about 35 nM. This is consistent with the presence of the high-affinity binding (apparent Kd of 11 nM) observed for PGRMC1 isolated and purified from porcine liver (33).

As illustrated by the saturation binding experiment (Fig. 3BGo), the maximal amount of P4 bound to intact SIGCs is approximately 2 fmol/µg or 1.2 x 109 P4 binding sites/µg. This represents binding to about 4 x 105 cells, indicating that SIGCs possess approximately 3000 P4 binding sites per cell. PGRMC1 siRNA treatment reduces both PGRMC1 levels and [3H]P4 binding by about 60%, suggesting that at least 1800 of these sites are due to PGRMC1. The remaining 40% of specific P4 binding sites could also be due to PGRMC1, because the PGRMC1 siRNA treatment did not completely deplete endogenous PGRMC1 levels. Alternatively, some other P4 binding proteins such as the membrane progestin receptors described by Thomas and colleagues (34, 35) could account for P4 binding sites remaining after PGRMC1 siRNA treatment, although the expression of these receptors have not been documented in SIGCs. Importantly, the remaining P4 binding sites cannot be due to the PGR, because SIGCs do not express PGRs (22).

Although these studies demonstrate the importance of PGRMC1 in regulating P4-mediated cell survival, they do not address its mechanism of action. To begin to address this issue, studies were designed to correlate the structural components of PGRMC1 with their function. PGRMC1 is a relatively small protein (28 kDa) composed of a short N terminus, a transmembrane domain, and a C terminus that contains a heme-binding domain and putative kinase interaction sites (26). All of the deletion and point mutations in this study possessed the transmembrane domain and at least a short segment of the C terminus that is adjacent to the transmembrane domain. Moreover, all of these mutants localized to the same cellular sites as judged by GFP fluorescence. This is most likely due to the fact that each mutant had an intact transmembrane domain. Several interesting findings were observed using these PGRMC1 mutants.

First, these studies reveal that deletion or alteration in any segment of PGRMC1 results in a 60–80% decrease in [3H]P4 binding. As might be expected based on the [3H]P4 binding data, SIGCs transfected with these mutants fail to respond to a suboptimal dose of P4. The reduced ability to bind P4 accounts at least in part for the reduction in P4 responsiveness. However, because all the segments influence P4 binding, these studies were not able to identify the segments that are involved in activating the downstream components of P4’s signal transduction cascade. Future studies will have to employ alternate approaches to identify those PGRMC1 segments that are involved in signal transduction. The most likely segment to be involved in signal transduction is the C terminus, given that in silico analysis of PGRMC1 revealed a heme-binding domain and several putative SH2 and SH3 sites in this segment [see reviews by Peluso (2, 3) or Cahill (26)].

The second interesting aspect relates to the P4 binding site. This has been a difficult issue to resolve because bacterially expressed PGRMC1 bind heme but not P4 (36, 37). Although this cast doubt on PGRMC1’s ability to act as a P4 receptor, failure of the bacterially expressed PGRMC1 to bind P4 may be related to improper folding or the absence of posttranslational modifications, which are characteristic of bacterially expressed protein. Because of these issues, the present binding studies were conducted on GFP-tagged PGRMC1 that was purified from GFP-PGRMC1-transfected SIGCs. This isolation protocol detected a single specific 56-kDa Coomassie Blue-stained band, which was also detected by a GFP antibody. Binding studies on GFP-PGRMC1 demonstrate that PGRMC1 binds P4 with a high affinity (an apparent Kd of 35 nM), which is well within the levels of P4 in serum and in follicular fluid (38).

These studies also suggest that the P4 binding site within PGRMC1 is localized between amino acids 20 and 70 (i.e. the transmembrane domain and an adjacent segment of the C terminus). This conclusion is based on the fact that the only segment common to the PGRMC1 mutants is the segment between amino acids 20–70. Because modeling of the binding characteristics revealed only one binding site within PGRMC1, the P4 binding site is likely to be in this segment. This putative localization of the P4 binding site is consistent with the chemical modification studies that indicate that the P4 binding site is within a hydrophobic region most likely associated with the transmembrane domain (27, 39).

Third, these studies demonstrate that all the mutants bind [3H]P4 but at a significantly reduced level compared with wild-type control. Given that there is only one binding site, this implies that other segments of PGRMC1 influence P4 binding affinity. There are at least three ways that these non-P4 binding segments could enhance P4 binding affinity. First, the entire PGRMC1 molecule may be required to produce a three-dimensional site capable of binding P4 with high affinity. This fits well with the finding that chemical modification of several amino acids within different segments reduces PGRMC1’s capacity to bind P4 (39). Second, specific segments may be required to allow PGRMC1 to form dimers or oligomers. PGRMC1 dimerizes through the formation of disulfide bonds (40). These bonds can be broken by dithiothreitol treatment resulting in the formation of monomers and a decrease in P4 binding (39, 40). Finally, other proteins could interact with PGRMC1 at unknown sites and influence P4 binding. Importantly, all three of these possibilities could represent physiologically relevant mechanisms, because they are not mutually exclusive.

To date, a limited number of PGRMC1 binding partners have been identified (8, 41, 42, 43). One binding partner, PAIRBP1 (8), may influence P4-PGRMC1 interaction, because overexpression of PAIRBP1 increases [3H]P4 binding by about 20% (23). It does not appear that PAIRBP1 directly binds P4, because the 1–70 PGRMC1 mutant does not interact with PAIRBP1 but binds P4 to the same degree as the other PGRMC1 mutants that do bind PAIRBP1. Also, the amount of PAIRBP1 bound to wild-type PGRMC1 is similar to other mutants that show a reduced capacity to bind [3H]P4. However, to conclusively resolve this issue, the capacity of PAIRBP1 to directly bind P4 in the absence of PGRMC1 must be determined.

Although PAIRBP1 does not appear to bind to the putative P4 binding site (i.e. amino acids 20–70), it does appear to interact with the heme-binding domain (i.e. amino acids 70–130). This assessment is based on the observations that the 1–70 PGRMC1 mutant does not interact with PARIBP1, whereas the 1–130 PGRMC1 mutant, which encodes the entire heme-binding domain but none of the remaining C terminus of PGRMC1, does bind PAIRBP1. Interestingly, the D120G point mutation, which is within the heme-binding domain, reduces the capacity of PGRMC1 to bind heme (28) but does not alter the PAIRBP1-PGRMC1 interaction. This implies that PAIRBP1 binding to the heme-binding domain of PGRMC1 is not dependent on the precise sequence that is required to bind heme-proteins. Thus, the exact binding site of the PAIRBP1-PGRMC1 interaction remains to be elucidated.

The fourth and final point involves the D120G mutant. As indicated, this point mutation results in the loss of P4’s ability to activate its antiapoptotic signal transduction cascade. This is consistent with the initial observation by Craven’s group that this PGRMC1 mutation renders breast cancer cells more sensitive to the apoptotic effects of various chemotherapeutic agents (28, 44, 45). The precise mechanism by which this point mutation influences cell survival is likely to have at least two components. First, in cells that are exposed to P4, it can reduce P4 binding, thereby making them less responsive to P4’s antiapoptotic action. Second, this point mutation alters the ability of PGRMC1 to interact with heme-proteins (28). There are numerous heme-proteins with some expressed in a cell-specific manner and others ubiquitously (for review see Ref. 46). Therefore, PGRMC1-heme-protein interactions could be an important part of a survival mechanism that affects numerous cell types. Future studies will be required to identify heme-proteins that specifically bind PGRMC1 and regulate PGRMC1-mediated cell survival.

In summary, the present studies provide genetic-based evidence that PGRMC1 mediates P4’s antiapoptotic action with each structural component of PGRMC1 playing an essential but still undefined role in this antiapoptotic mechanism. These studies also demonstrate that PGRMC1 specifically binds P4 with the most likely binding site being localized to the transmembrane domain and an adjacent segment of the C terminus. Finally, these studies suggest that PAIRBP1 binds to PGRMC1 through an interaction with the heme-binding domain of PGRMC1. Taken together, these studies not only begin to shed light on the complexities of PGRMC1 but also illustrate the need for future detailed investigations into the structural-functional relationships of PGRMC1.


    Acknowledgments
 
We thank Drs. Wehling and Losel of the University of Heidelberg-Mannheim for providing the NT-PGRMC1 antibody.


    Footnotes
 
This work was supported by a grant from National Institutes of Health (HD 047205 and HD 052740).

Disclosure Statement: The authors have nothing to declare.

First Published Online November 8, 2007

Abbreviations: DAPI, 4',6-Diamidino-2-phenylindole; FITC, fluorescein isothiocyanate; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; P4, progesterone; PAIRBP1, plasminogen activator inhibitor 1 RNA binding protein; PGR, nuclear progesterone receptor; PGRMC1, progesterone receptor membrane component-1; SIGC, spontaneously immortalized granulosa cell; siRNA, small interfering RNA; TEMGD, Tris-EDTA-molybdate-glycerol-dithiothreitol.

Received July 30, 2007.

Accepted for publication October 30, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bramley T 2003 Non-genomic progesterone receptors in the mammalian ovary: some unresolved issues. Reproduction 125:3–15[Abstract]
  2. Peluso JJ 2006 Multiplicity of progesterone’s actions and receptors in the mammalian ovary. Biol Reprod 75:2–8[Abstract/Free Full Text]
  3. Peluso JJ 2007 Non-genomic actions of progesterone in the normal and neoplastic mammalian ovary. Semin Reprod Med 25:198–207[CrossRef][Medline]
  4. Robker RL, Russell DL, Espey LL, Lydon JP, O’Malley BW, Richards JS 2000 Progesterone-regulated genes in the ovulation process: ADAMTS-1 and cathepsin L proteases. Proc Natl Acad Sci USA 97:4689–4694[Abstract/Free Full Text]
  5. Rung E, Friberg PA, Shao R, Larsson DG, Nielsen E, Svensson PA, Carlsson B, Carlsson LM, Billig H 2005 Progesterone-receptor antagonists and statins decrease de novo cholesterol synthesis and increase apoptosis in rat and human periovulatory granulosa cells in vitro. Biol Reprod 72:538–545[Abstract/Free Full Text]
  6. Svensson EC, Markstrom E, Andersson M, Billig H 2000 Progesterone receptor-mediated inhibition of apoptosis in granulosa cells isolated from rats treated with human chorionic gonadotropin. Biol Reprod 63:1457–1464[Abstract/Free Full Text]
  7. Svensson EC, Markstrom E, Shao R, Andersson M, Billig H 2001 Progesterone receptor antagonists Org 31710 and RU 486 increase apoptosis in human periovulatory granulosa cells. Fertil Steril 76:1225–1231[CrossRef][Medline]
  8. Peluso JJ, Pappalardo A, Losel R, Wehling M 2005 Expression and function of PAIRBP1 within gonadotropin-primed immature rat ovaries: PAIRBP1 regulation of granulosa and luteal cell viability. Biol Reprod 73:261–270[Abstract/Free Full Text]
  9. Peluso JJ 2003 Progesterone as a regulator of granulosa cell viability. J Steroid Biochem Mol Biol 85:167–173[CrossRef][Medline]
  10. Peluso JJ 2004 Rapid actions of progesterone on granulosa cells. Steroids 69:579–583[CrossRef][Medline]
  11. Schreiber JR, Erickson GF 1979 Progesterone receptor in the rat ovary: further characterization and localization in the granulosa cell. Steroids 34:459–469[CrossRef][Medline]
  12. Schreiber JR, Hsueh JW 1979 Progesterone "receptor" in rat ovary. Endocrinology 105:915–919[Abstract/Free Full Text]
  13. Schreiber JR, Hsueh AJ, Baulieu EE 1983 Binding of the anti-progestin RU-486 to rat ovary steroid receptors. Contraception 28:77–85[CrossRef][Medline]
  14. Naess O 1981 Characterization of cytoplasmic progesterone receptors in rat granulosa cells. Evidence for nuclear translocation. Acta Endocrinol (Copenh) 98:288–294[Abstract/Free Full Text]
  15. Li X, Lonard DM, O’Malley BW 2004 A contemporary understanding of progesterone receptor function. Mech Ageing Dev 125:669–678[CrossRef][Medline]
  16. Park OK, Mayo KE 1991 Transient expression of progesterone receptor messenger RNA in ovarian granulosa cells after the preovulatory luteinizing hormone surge. Mol Endocrinol 5:967–978[Abstract/Free Full Text]
  17. Park-Sarge OK, Mayo KE 1994 Regulation of the progesterone receptor gene by gonadotropins and cyclic adenosine 3',5'-monophosphate in rat granulosa cells. Endocrinology 134:709–718[Abstract/Free Full Text]
  18. Park-Sarge OK, Parmer TG, Gu Y, Gibori G 1995 Does the rat corpus luteum express the progesterone receptor gene? Endocrinology 136:1537–1543[Abstract]
  19. Natraj U, Richards JS 1993 Hormonal regulation, localization, and functional activity of the progesterone receptor in granulosa cells of rat preovulatory follicles. Endocrinology 133:761–769[Abstract/Free Full Text]
  20. Shao R, Markstrom E, Friberg PA, Johansson M, Billig H 2003 Expression of progesterone receptor (PR) A and B isoforms in mouse granulosa cells: stage-dependent PR-mediated regulation of apoptosis and cell proliferation. Biol Reprod 68:914–921[Abstract/Free Full Text]
  21. Peluso JJ, Fernandez G, Pappalardo A, White BA 2001 Characterization of a putative membrane receptor for progesterone in rat granulosa cells. Biol Reprod 65:94–101[Abstract/Free Full Text]
  22. Peluso JJ, Fernandez G, Pappalardo A, White BA 2002 Membrane-initiated events account for progesterone’s ability to regulate intracellular free calcium levels and inhibit rat granulosa cell mitosis. Biol Reprod 67:379–385[Abstract/Free Full Text]
  23. Peluso JJ, Pappalardo A, Fernandez G, Wu CA 2004 Involvement of an unnamed protein, RDA288, in the mechanism through which progesterone mediates its antiapoptotic action in spontaneously immortalized granulosa cells. Endocrinology 145:3014–3022[Abstract/Free Full Text]
  24. Peluso JJ, Pappalardo A, Losel R, Wehling M 2006 Progesterone membrane receptor component 1 expression in the immature rat ovary and its role in mediating progesterone’s antiapoptotic action. Endocrinology 147:3133–3140[Abstract/Free Full Text]
  25. Meyer C, Schmid R, Schmieding K, Falkenstein E, Wehling M 1998 Characterization of high affinity progesterone-binding membrane proteins by anti-peptide antiserum. Steroids 63:111–116[CrossRef][Medline]
  26. Cahill MA 2007 Progesterone receptor membrane component 1: an integrative review. J Steroid Biochem Mol Biol 105:16–36[CrossRef][Medline]
  27. Losel R, Breiter S, Seyfert M, Wehling M, Falkenstein E 2005 Classic and non-classic progesterone receptors are both expressed in human spermatozoa. Horm Metab Res 37:10–14[CrossRef][Medline]
  28. Crudden G, Chitti RE, Craven RJ 2006 Hpr6 (heme-1 domain protein) regulates the susceptibility of cancer cells to chemotherapeutic drugs. J Pharmacol Exp Ther 316:448–455[Abstract/Free Full Text]
  29. Stein LS, Stoica G, Tilley R, Burghardt RC 1991 Rat ovarian granulosa cell culture: a model system for the study of cell-cell communication during multistep transformation. Cancer Res 51:696–706[Abstract/Free Full Text]
  30. Peluso JJ, Pappalardo A, Fernandez G 2001 E-cadherin-mediated cell contact prevents apoptosis of spontaneously immortalized granulosa cells by regulating Akt kinase activity. Biol Reprod 64:1183–1190[Abstract/Free Full Text]
  31. Lynch K, Fernandez G, Pappalardo A, Peluso JJ 2000 Basic fibroblast growth factor inhibits apoptosis of spontaneously immortalized granulosa cells by regulating intracellular free calcium levels through a protein kinase C{delta}-dependent pathway. Endocrinology 141:4209–4217[Abstract/Free Full Text]
  32. Peluso JJ, Pappalardo A 2004 Progesterone regulates granulosa cell viability through a protein kinase G-dependent mechanism that may involve 14-3-3{sigma}. Biol Reprod 71:1870–1878[Abstract/Free Full Text]
  33. Meyer C, Schmid R, Scriba PC, Wehling M 1996 Purification and partial sequencing of high-affinity progesterone-binding site(s) from porcine liver membranes. Eur J Biochem 239:726–731[Medline]
  34. Zhu Y, Rice CD, Pang Y, Pace M, Thomas P 2003 Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes. Proc Natl Acad Sci USA 100:2231–2236[Abstract/Free Full Text]
  35. Zhu Y, Bond J, Thomas P 2003 Identification, classification, and partial characterization of genes in humans and other vertebrates homologous to a fish membrane progestin receptor. Proc Natl Acad Sci USA 100:2237–2242[Abstract/Free Full Text]
  36. Ghosh K, Thompson AM, Goldbeck RA, Shi X, Whitman S, Oh E, Zhiwu Z, Vulpe C, Holman TR 2005 Spectroscopic and biochemical characterization of heme binding to yeast Dap1p and mouse PGRMC1p. Biochemistry 44:16729–16736[CrossRef][Medline]
  37. Min L, Strushkevich NV, Harnastai IN, Iwamoto H, Gilep AA, Takemori H, Usanov SA, Nonaka Y, Hori H, Vinson GP, Okamoto M 2005 Molecular identification of adrenal inner zone antigen as a heme-binding protein. FEBS J 272:5832–5843[CrossRef][Medline]
  38. Fujii T, Hoover DJ, Channing CP 1983 Changes in inhibin activity, and progesterone, oestrogen and androstenedione concentrations, in rat follicular fluid throughout the oestrous cycle. J Reprod Fertil 69:307–314[Abstract/Free Full Text]
  39. Falkenstein E, Eisen C, Schmieding K, Krautkramer M, Stein C, Losel R, Wehling M 2001 Chemical modification and structural analysis of the progesterone membrane binding protein from porcine liver membranes. Mol Cell Biochem 218:71–79[CrossRef][Medline]
  40. Losel R, Dorn-Beineke A, Falkenstein E, Wehling M, Feuring M 2004 Porcine spermatozoa contain more than one membrane progesterone receptor. Int J Biochem Cell Biol 36:1532–1541[CrossRef][Medline]
  41. Debose-Boyd RA 2007 A helping hand for cytochrome p450 enzymes. Cell Metab 5:81–83[CrossRef][Medline]
  42. Hughes AL, Powell DW, Bard M, Eckstein J, Barbuch R, Link AJ, Espenshade PJ 2007 Dap1/PGRMC1 binds and regulates cytochrome P450 enzymes. Cell Metab 5:143–149[CrossRef][Medline]
  43. Suchanek M, Radzikowska A, Thiele C 2005 Photo-leucine and photo-methionine allow identification of protein-protein interactions in living cells. Nat Methods 2:261–267[CrossRef][Medline]
  44. Crudden G, Loesel R, Craven RJ 2005 Overexpression of the cytochrome p450 activator hpr6 (heme-1 domain protein/human progesterone receptor) in tumors. Tumour Biol 26:142–146[CrossRef][Medline]
  45. Hand RA, Craven RJ 2003 Hpr6.6 protein mediates cell death from oxidative damage in MCF-7 human breast cancer cells. J Cell Biochem 90:534–547[CrossRef][Medline]
  46. Tsiftsoglou AS, Tsamadou AI, Papadopoulou LC 2005 Heme as key regulator of major mammalian cellular functions: molecular, cellular and pharmacological aspects. Pharm Ther 111:327–345[CrossRef]



This article has been cited by other articles:


Home page
EndocrinologyHome page
L. Liu, J. Wang, L. Zhao, J. Nilsen, K. McClure, K. Wong, and R. D. Brinton
Progesterone Increases Rat Neural Progenitor Cell Cycle Gene Expression and Proliferation Via Extracellularly Regulated Kinase and Progesterone Receptor Membrane Components 1 and 2
Endocrinology, July 1, 2009; 150(7): 3186 - 3196.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
P. A. Friberg, D.G. J. Larsson, and H. Billig
Dominant Role of Nuclear Progesterone Receptor in the Control of Rat Periovulatory Granulosa Cell Apoptosis
Biol Reprod, June 1, 2009; 80(6): 1160 - 1167.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
E. Gomez, A. Gutierrez-Adan, C. Diez, P. Bermejo-Alvarez, M. Munoz, A. Rodriguez, J. Otero, M. Alvarez-Viejo, D. Martin, S. Carrocera, et al.
Biological differences between in vitro produced bovine embryos and parthenotes
Reproduction, February 1, 2009; 137(2): 285 - 295.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. R. Mansouri, J. Schuster, J. Badhai, E.-L. Stattin, R. Losel, M. Wehling, B. Carlsson, O. Hovatta, P. O. Karlstrom, I. Golovleva, et al.
Alterations in the expression, structure and function of progesterone receptor membrane component-1 (PGRMC1) in premature ovarian failure
Hum. Mol. Genet., December 1, 2008; 17(23): 3776 - 3783.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. J. Peluso, X. Liu, M. M. Saunders, K. P. Claffey, and K. Phoenix
Regulation of Ovarian Cancer Cell Viability and Sensitivity to Cisplatin by Progesterone Receptor Membrane Component-1
J. Clin. Endocrinol. Metab., May 1, 2008; 93(5): 1592 - 1599.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Peluso, J. J.
Right arrow Articles by Liu, X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peluso, J. J.
Right arrow Articles by Liu, X.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals