help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2007-0908
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aga-Mizrachi, S.
Right arrow Articles by Sampson, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aga-Mizrachi, S.
Right arrow Articles by Sampson, S. R.
Endocrinology Vol. 149, No. 2 605-614
Copyright © 2008 by The Endocrine Society

Cytosolic Protein Tyrosine Phosphatase-{epsilon} Is a Negative Regulator of Insulin Signaling in Skeletal Muscle

Shlomit Aga-Mizrachi, Tamar Brutman-Barazani, Avraham I. Jacob, Asia Bak, Ari Elson and Sanford R. Sampson

Mina and Everard Goodman Faculty of Life Sciences (S.A.-M., T.B.-B., A.I.J., A.B., S.R.S.), Bar-Ilan University, Ramat-Gan 52900, Israel; and Department of Molecular Genetics (A.E.), Weizmann Institute of Science, Rehovot 76100, Israel

Address all correspondence and requests for reprints to: Sanford. R. Sampson, The Mina and Everard Goodman Faculty of Life Sciences, Bar-Ilan University, Ramat-Gan 52900, Israel. E-mail: sampsos{at}mail.biu.ac.il.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Whereas positive regulatory events triggered by insulin binding to insulin receptor (IR) have been well documented, the mechanism by which the activated IR is returned to the basal status is not completely understood. Recently studies focused on the involvement of protein tyrosine phosphatases (PTPs) and how they might influence IR signaling. In this study, we examined the possibility that cytosolic PTP{epsilon} (cytPTP{epsilon}) is involved in IR signaling. Studies were performed on L6 skeletal muscle cells. cytPTP{epsilon} was overexpressed by using pBABE retroviral expression vectors. In addition, we inhibited cytPTP{epsilon} by RNA silencing. We found that insulin induced rapid association of cytPTP{epsilon} with IR. Interestingly, this association appeared to occur in the plasma membrane and on stimulation with insulin the two proteins internalized together. Moreover, it appeared that almost all internalized IR was associated with cytPTP{epsilon}. We found that knockdown of cytPTP{epsilon} by RNA silencing increased insulin-induced tyrosine phosphorylation of IR and IR substrate (IRS)-1 as well as phosphorylation of protein kinase B and glycogen synthase kinase-3 and insulin-induced stimulation of glucose uptake. Moreover, overexpression of wild-type cytPTP{epsilon} reduced insulin-induced tyrosine phosphorylation of IR, IRS-1, and phosphorylation of protein kinase B and glycogen synthase kinase-3 and insulin-induced stimulation of glucose uptake. Finally, insulin-induced tyrosine phosphorylation of IR and IRS-1 was greater in skeletal muscle from mice lacking the cytPTP{epsilon} gene than that from wild-type control animals. We conclude that cytPTP{epsilon} serves as another major candidate negative regulator of IR signaling in skeletal muscle.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
A MAJOR CHARACTERISTIC of type 2 (non-insulin dependent) diabetes is insulin resistance in peripheral tissues including liver, fat, and skeletal muscle. The molecular mechanism is believed to involve the impairment of insulin receptor (IR) signal transduction. The binding of insulin to its receptor leads to activation of the β-subunit tyrosine kinase and association with endogenous intracellular substrates [IR substrate (IRS)]. Phosphorylated motifs on these proteins serve as binding sites for the recruitment of downstream signaling proteins such as phosphatidylinositol 3-kinase and Akt/protein kinase B (PKB). Activated PKB regulates multiple cellular functions such as glucose up-take, glycogen synthesis, gluconeogenesis, and lipid synthesis (1, 2).

Whereas positive regulation of IR is well documented (3), the mechanism by which the activated IR is returned to the basal status through the activity of protein tyrosine phosphatases (PTPs) is not completely understood (4). Recently studies focused on the involvement of PTPs in IR signaling. PTP1B has been implicated as potentially the key phosphatase that dephosphorylates IR. Thus, insulin-induced tyrosine phosphorylation of IR was higher and remained elevated for a longer period, and overall glucose use was higher in PTP1B null mice than in their wild-type counterparts (5, 6). However, a number of additional PTPs, such as LAR small heterodimer partner-2, PTP{alpha}, and PTP{epsilon}, have also been implicated as potential modulators of IR signaling, but their status as IR regulators is still controversial (4). PTP{epsilon} exists as a small group of four proteins produced by the single PTP{epsilon} gene. The two most prevalent are the receptor-type (RPTP{epsilon}) and the nonreceptor-type (cytPTP{epsilon}) forms. In addition, shorter molecules expressed together with either RPTP{epsilon} or cytPTP{epsilon}, are regulated at the levels of translation and posttranslational processing (7, 8). PTP{epsilon} is not ubiquitously expressed. The two major forms (the receptor RPTP{epsilon} and nonreceptor cyt-PTP{epsilon}) are expressed in a nonoverlapping pattern due to different expression of the distinct promoters that regulate expression of each form. RPTP{epsilon} is expressed in brain, lungs, Neu-induced mammary tumors, and hepatocytes. cytPTP{epsilon} is expressed in fibroblasts; many hematopoietically derived cells and tissues (spleen, lymph nodes, thymus, osteoclasts (9, 10, 11); and insulin target tissues, liver (12) and skeletal muscle (this study). It was reported that RPTP{epsilon} can associate with IR in the basal state and after insulin stimulation in HEK293 cells and down-regulates insulin receptor signaling in BHK cells (13, 14) and hepatocytes (12). The role of cytPTP{epsilon} in insulin-responsive tissues remains unknown. In this study, we examined the involvement of cytPTP{epsilon} in IR signaling of L6 skeletal muscle cells by overexpression of cytPTP{epsilon} using pBABE retroviral expression vectors and inhibition of endogenous cytPTP{epsilon} by RNA silencing.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
The study was approved by the Animal Ethics Committee of Bar-Ilan University. Accepted standards of animal care were used.

Materials
The cDNA of green fluorescent protein (GFP)-cytPTP{epsilon} cloned into the pcDNA3 expression vector (Invitrogen, Carlsbad, CA) and cytPTP{epsilon} and D245AcytPTP{epsilon} cloned into retroviral vector used in these studies have been previously described (15, 16). The D245AcytPTP{epsilon} is a substrate trapping mutant of PTP{epsilon} (17); mutants of this type have been shown to bind and remain associated with phosphorylated tyrosine residues they would normally dephosphorylate, thereby allowing isolation of enzyme-substrate complexes (18). Both cytPTP{epsilon} cDNAs contained a FLAG tag at their C terminus. The cDNA of IR was cloned into pRK5 mammalian expression vector. Tissue culture media and serum were purchased from Biological Industries (Beit HaEmek, Israel). Primary antibodies to various proteins were obtained from the following sources: polyclonal anti-PTP{epsilon} (10), polyclonal anti-IRβ, anti-IRS-1, and monoclonal anti-Src were purchased from Santa Cruz Biotechnology (Santa Cruz, CA); polyclonal antiphosphoY972IR and antiphosphoY1162/1163IR were purchased from Biosource (Camarillo, CA); polyclonal antiphospho-Y529Src was purchased from Stressgen Bioreagents (Victoria, British Columbia, Canada); polyclonal antiphospho-PKBThr308, polyclonal anti-phospho-glycogen synthase kinase (GSK)-3 Ser (9) and monoclonal antibodies to phosphotyrosine were purchased from Cell Signaling (Beverly, MA); monoclonal anti-β-actin and monoclonal anti-FLAG M2 were purchased from Sigma (St. Louis, MO). Horseradish peroxidase-conjugated antirabbit and antimouse IgG were obtained from Bio-Rad (Hercules, CA). Antiphosphatases and antiprotease cocktails were purchased from Sigma. Enhanced chemical luminescence was performed with antibodies purchased from Bio-Rad and reagents from Sigma. Insulin (HumulinR, recombinant human insulin) was purchased from Lilly France SA (Fergersheim, France).

Methods
Cell culture and Infection with retroviral virus.
L6 skeletal muscle cells were obtained from Dr. Nava Bashan (Ben-Gurion University, Beersheba, Israel). L6 cells were grown in {alpha}MEM supplemented with 10% fetal calf serum, 100 U/ml penicillin, and 100 µg/ml streptomycin (Biological Industries, Beit HaEmek, Israel). All experiments were performed on 50–70% confluent myoblasts. cytPTP{epsilon} was expressed in these cells by retroviral infection using the cytPTP{epsilon} cDNA cloned in pBABE as described previously (15, 19). The day after cells were transferred to low glucose (4.5 mM), serum-free {alpha}MEM for 18 h and then treated with 100 nM insulin.

Primary skeletal muscle cultures were prepared from thigh muscles obtained from 2- to 4-d-old neonatal mice as described (20, 21, 22). On the day after isolation, the cells were infected either with control vector-pBABE or pBABE cytPTP{epsilon}. These cells differentiate spontaneously within 3–4 d. On d 5 in culture, myotubes were transferred to low glucose (4.5 mM), serum-free DMEM containing 1% BSA 18 h and then treated with 100 nM insulin.

Preparation of cell lysates and substrate trapping.
Cells were washed with Ca+2/Mg+2-free PBS and then mechanically detached in Nonidet P-40 buffer [150 mM NaCl, 1% Nonidet P-40, and 50 mM Tris-Cl (pH 8.0)] containing a cocktail of protease and phosphatase inhibitors (20 µg/ml leupeptin; 10 µg/ml aprotinin; 0.1 mM phenylmethylsulfonyl fluoride; 1 mM dithiothreitol; 200 µM orthovanadate; 2 µg/ml pepstatin). After scraping, the preparation was incubated for 30 min on ice and centrifuged at 17,400 x g for 15 min at 4 C. The supernatants were retained and subjected to immunoprecipitation or directly to immunoblotting. For substrate-trapping immunoprecipitation experiments, cells were lysed in buffer Nonidet P-40 supplemented with 5 mM sodium iodoacetate (Sigma) and protease inhibitors.

Immunoprecipitation.
Six hundred to 800 µg of total cell protein were incubated with appropriate primary antibodies (dilution 1:100) and 25 µl of protein A/G Sepharose beads (Santa Cruz) overnight at 4 C with gentle agitation. The immunoprecipitates were washed with Nonidet P-40 buffer three times. Twenty-five microliters of sample buffer [0.5 M Tris HCl (pH 6.8); 10% sodium dodecyl sulfate (SDS); 10% glycerol; 4% β-mercaptoethanol; 0.05% bromophenol blue] were added and SDS-PAGE was performed.

Western blot analysis.
Twenty to 40 µg of total protein were analyzed on 7.5% SDS-polyacrylamide gels, followed by transfer to nitrocellulose membranes (Protran; Schleicher and Schuell, Whatman, Dassel, Germany), and hybridization to antibodies. The membranes were subjected to standard blocking procedures and were incubated with antibodies as described (20). Equal protein loading of blots was confirmed by immunoblotting for skeletal muscle β-actin.

RT-PCR.
Total RNA was obtained using total RNA purification kit (Gentra Systems, Minneapolis, MN) from primary culture and L6 cells. Reverse transcription was performed on 0.5 µg total RNA using One Tube RT-PCR premix kit (iNtRON Biotechnology, Inc., Gyeonggi-Do, Korea) and 10 pmol specific primers for RPTP{epsilon} or cytPTP{epsilon}. The reverse transcription reaction was amplified as described in the kit (one cycle at 45 C, 30 min; 94 C, 5 min; 28 cycles at 94 C, 1 min; 60 C, 1 min; 72 C, 50 sec; one cycle at 72 C, 5 min). Finally the amplified products were resolved on a 1% agarose gel.

Specific primers for RPTP{epsilon} and cytPTP{epsilon} were designed based on reported sequences. The 3' primer 5'-CCATCCAATTGGCTCAAAAT is common to both forms of PTP{epsilon}. The 5' primers were designed based on the 5' sequence unique to each form and as close as possible to their respective initiator ATG codons to maximize the differences between the sizes of the RT-PCR products. 5' primers unique to each PTP{epsilon} isoform were: RPTP{epsilon}, 5'-CCCTTGTGTCCACTCCTGTT (yielding a 539 bp product); cytPTP{epsilon}, 5'-AAGAACTTTTCCAGGCTCACC (yielding a 362 bp product).

RNA interference (RNAi) transfection.
Duplex RNAi primer sequences (20 µM) for PTP{epsilon} and control (Stealth RNAi, Invitrogen) were transfected into L6 myoblasts using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol.

The RNA sequences (5' to 3') transfected were as follows: RNAi control, CCCGUUAACUUCGGAGAGUAAAUUU and AAAUUUACUCUCCGAAGUUAACGGG; and RNAi PTP{epsilon}, CCCAAUGAUCAUUGCAGAGUGAUUU and AAAUCACUCUGCAAUGAUCAUUGGG.

Fractionation.
Cells were washed with Ca+2/Mg+2-free PBS and then mechanically detached in buffer A [50 mM Tris-Cl (pH 7.5), 150 mM NaCl, 2 mM EDTA, 1 mM EGTA] containing a cocktail of antiproteases and antiphosphatases. After scraping, the preparation was subjected to three freeze-thaw cycles in liquid nitrogen and then centrifuged at 17,400 x g for 20 min at 4 C. The supernatant was collected as cytosol. The pellet was suspended with buffer A + 1% Triton X-100, incubated for 30 min on ice, and centrifuged at 17,400 x g for 20 min at 4 C. The supernatant was collected as membrane.

Immunofluorescence.
L6 cells were plated on glass coverslips previously coated with 1% gelatin (Sigma) and transfected with GFP-cyt-PTP{epsilon} and IR using lipofectamine 2000 (Invitrogen). Twenty-four hours after plating, cells were transferred to low glucose (4.5 mM), serum-free {alpha}MEM for 5 h and then treated with 100 nM insulin. Cells were washed twice with Ca+2/Mg+2-free PBS and fixed in 4% paraformaldehyde for 30 min. Subsequently cells were washed in PBS and blocked with staining buffer (1% BSA and 0.1% Triton X-100 in PBS) for 20 min. Cells were then stained with anti-IR antibody (1:50) and then with secondary antibody CY3-conjugated antirabbit IgG (1:100, Jackson ImmunoResearch, West Grove, PA). Stained cells were viewed and photographed using confocal microscopy at x400 magnification.

Glucose uptake.
Glucose transport was measured in triplicate samples in six-well plates with the use of [3H]2-deoxy-D-glucose (1 mCi/ml; American Radiolabeled Chemicals, St. Louis, MO). After insulin treatment, cells were washed three times with warm (37 C) PBS, the final wash being replaced immediately with 0.75 ml PBS containing 0.5µCi/ml [3H]2-deoxy-D-glucose and glucose at a concentration of 0.1 mM. Cells were then incubated for 10 min at 37 C, washed three times with cold (4–6 C) PBS, and then lysed by addition of 1 ml 0.1% SDS and incubated for 30 min in 37 C. The contents of each well were transferred to counting vials, and 3.5 ml scintillation fluid were added to each vial and vortexed. Samples were counted in the 3H window of a Tricarb scintillation counter. Values were normalized to the protein content of each well.

PTP{epsilon}-knockout mice.
Mice genetically lacking PTPe (PTP{epsilon}KO mice) were generated by removing exons 13–15 of the PTP{epsilon} gene as described (17). PTP{epsilon}KO mice do not express any PTP{epsilon} protein. They are viable and breed normally but exhibit delayed myelination of peripheral nerves (17), increased bone mass secondary to reduced bone resorption (11), and reduced Src activity (23).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Expression of RPTP{epsilon} and cytPTP{epsilon} in primary skeletal muscle and in L6 cell line
We first determined the expression of RPTP{epsilon} and cytPTP{epsilon} using by RT-PCR and Western blot analysis of primary cultures of skeletal muscle and of the L6 skeletal muscle cell line. A single PTP{epsilon} gene gives rise to both RPTP{epsilon} and cytPTP{epsilon} and forms via alternative promoters. These forms are identical throughout most of their sequence, including their two catalytic domains. The N termini are distinct and determine the unique subcellular localization of each form (8). In initial experiments we found that cytPTP{epsilon} is expressed strongly in L6 cells as well as in mouse skeletal muscle in culture (Fig. 1Go) and adult mice (not shown), whereas RPTP{epsilon} is expressed at lower levels and only in L6 cells.


Figure 1
View larger version (22K):
[in this window]
[in a new window]

  		FIG. 1. cytPTP{epsilon} is expressed in both L6 cells and mouse primary culture. A, RNA was extracted from L6 and mouse skeletal muscle cells in primary culture. RT-PCR was performed using primers for RPTP{epsilon} and cytPTP{epsilon} as described in Materials and Methods. B, Western blots of whole-cell lysates from L6 and mouse skeletal muscle in primary culture. The anti-PTP{epsilon} antibody recognizes both PTP{epsilon} and the closely related PTP{alpha}, which can be told apart according to their electrophoretic mobility: PTP{alpha}, 130 kDa; RPTP{epsilon}, 110 kDa; cytPTP{epsilon}, 70 kDa (9 10 ). The results are representative of three separate experiments that gave similar results.

 
Insulin induces translocation of cytPTP{epsilon} to the membrane.
IR is constitutively situated in the plasma membrane and when activated is rapidly internalized. Both RPTP{alpha} and RPTP{epsilon} are localized in the plasma membrane and can physically associate with IR (24). As mentioned, we investigated the involvement of the nonreceptor form of PTP{epsilon} (cytPTP{epsilon}), which is predominantly cytoplasmic. However, it can also be detected at the cell nucleus and cell membrane, providing it with physical opportunity to interact with membrane-associated molecules (8, 10). We first determined whether insulin may induce translocation of cytPTP{epsilon}. After stimulation with insulin, L6 cells were fractionated into cytoplasm and membrane fractions. The lysates were subjected to SDS-PAGE and immunoblotted with anti-PTP{epsilon} antibody. In each of the experiments, optical densitometry analysis showed that under basal conditions, the cytosol to membrane ration of cytPTP{epsilon} was approximately 7–8:1. Figure 2Go shows that insulin induces significant increase in cytPTP{epsilon} in the membrane fraction. There did not appear to be a corresponding decrease of cytPTP{epsilon} in the cytoplasm, probably because of the relatively large amount of cytPTP{epsilon} in the cytoplasm, compared with the membrane fraction; thus, a small change in the cytosolic fraction in response to insulin, although difficult to detect, would be capable of causing a significant increase in the membrane fraction, as we demonstrate. In contrast, neither PTP{alpha} nor RPTP{epsilon} was increased in the membrane fraction by insulin.


Figure 2
View larger version (39K):
[in this window]
[in a new window]

  		FIG. 2. Insulin induces translocation of cytPTP{epsilon} to the membrane fractions. L6 cells were treated with insulin (Ins; 10–7 M) for 5 and 15 min. A, Cells were fractionated to membrane (MEMB) and cytoplasm (CYTO) fractions as described in Materials and Methods. Equal amounts (20 µg) of total protein from each fraction were subjected to SDS-PAGE and Western blotting with anti-PTP{epsilon} antibody. Tubulin and IR protein levels were used as markers for the cytoplasmic and membrane fractions, respectively. IB, Immunoblot. B, Graph of densitometry measurements of cytPTP{epsilon} translocation, normalized to the levels of the appropriate marker. Each bar represents the mean ± SE of measurements made in at least three separate experiments that gave similar results (*, P < 0.05; **, P < 0.01; Student’s t test). Data are expressed as percent of control in each fraction.

 
Insulin increases association of cytPTP{epsilon} with IR
It was reported that RPTP{epsilon} associates with the IR in the basal state but is not increased with insulin stimulation in HEK293 cells (24). It remains unknown, however, whether PTP{epsilon} is associated with IR in insulin target tissues such as liver, skeletal muscle, and adipose cells and whether this association is affected by insulin stimulation. We investigated the association between IR and cytPTP{epsilon} in L6 muscle cells infected with FLAG-tagged pBABE D245AcytPTP{epsilon} (see Materials and Methods) and stimulated or not with insulin. IP was performed with anti-FLAG antibodies and the resulting immunoprecipitates were immunoblotted with anti-IR antibodies. As seen in Fig. 3AGo, IR and cytPTP{epsilon} appear to be associated with each another, and stimulation with insulin increased this association by 76%. In addition, we examined cells that had been stimulated with insulin for varying times by immunofluorescence confocal microscopy. Cells were cotransfected with GFP-cyt-PTP{epsilon} and IR. As can be seen in Fig. 3BGo, in the basal, unstimulated state, IR is mainly localized in the plasma membrane, whereas cytPTP{epsilon} appears to be distributed in the cytoplasm, nucleus, and plasma membrane. Some cytPTP{epsilon} in the plasma membrane also appears to colocalize with IR. Within 5 min of insulin stimulation, IR has internalized, probably via endosomes (25, 26, 27) and is associated with cytPTP{epsilon}. In addition, cytPTP{epsilon} is localized to internal membranes (see also Fig. 2BGo). At 15 min, IR appears to be completely internalized and concentrated in a perinuclear manner. Moreover, almost all IR is associated with cytPTP{epsilon}.


Figure 3
View larger version (31K):
[in this window]
[in a new window]

  		FIG. 3. Insulin increases association of cytPTP{epsilon} with IR. A, L6 muscle cells were infected with FLAG-tagged pBABE D245AcytPTP{epsilon} and stimulated or not with insulin (10–7 M) for 5 min. Immunoprecipitation (IP) was performed with anti-FLAG antibodies, and the resulting immunoprecipitates were immunoblotted (IB) with anti-IR antibodies. The graph below the Western blots shows densitometry measurements on Western blots from three experiments. Insulin increased the association of IR with cytPTP{epsilon} by (mean ± SE) 76 ± 12% (**, P < 0.01 by Student’s t test). –Ab, Negative control precipitation performed in the absence of primary anti-FLAG antibody. B, Confocal microscopy analysis of expression of cytPTP{epsilon} (green) and IR (red) in L6 cells. Cells were cotransfected with GFP-cyt-PTP{epsilon} and IR using lipofectamine 2000. Twenty-four hours later, cells were treated with insulin (10–7 M) for 5 and 15 min, after which cells were processed as desribed in Materials and Methods. Note in the control, unstimulated cells the exclusively membrane localization of IR as well as nuclear, cytosolic and membrane expression of cytPTP{epsilon}. Original magnification, x400. The results are representative of three separate experiments that gave similar results. DIC, Differential interference contrast microscopy.

 
cytPTP{epsilon} reduces IR phosphorylation
It has been reported that RPTP{epsilon} can reduce insulin-induced effects in cells such as BHK ectopically overexpressing IR (13, 14). To examine the role of cytPTP{epsilon} in insulin signaling in skeletal muscle, mouse skeletal muscle cells in primary culture were infected with either control vector-pBABE or pBABE cytPTP{epsilon}. On d 5 in culture, differentiated skeletal muscle cells were transferred to serum-free, low-glucose medium; stimulated or not with insulin; and lysed. IR was immunoprecipitated from cell lysates and immunoblotted with antiphosphotyrosine antibody. Figure 4AGo shows that insulin induced IR tyrosine phosphorylation; overexpression of cytPTP{epsilon} nearly completely abrogated this insulin-induced phosphorylation.


Figure 4
View larger version (31K):
[in this window]
[in a new window]

  		FIG. 4. cytPTP{epsilon} regulates insulin-induced tyrosine phosphorylation of IR. A, Mouse skeletal muscle cells in primary culture were infected with either control vector-pBABE or pBABE cytPTP{epsilon}. On d 5 in culture, differentiated skeletal muscle cells were transferred to serum-free, low-glucose medium; stimulated or not with insulin (Ins) as in Fig. 2Go; and lysed. IR was immunoprecipitated (IP) from cell lysates and immunoblotted (IB) with antiphosphotyrosine antibody (upper blot), anti-IR to show equal amounts of IR (middle blot), or anti-PTP{epsilon} to show overexpression (lower blot). B, Levels of cytPTP{epsilon} in L6 cells transfected with either control RNAi sequence or with RNAi PTP{epsilon} sequence. Cells were transferred to serum-free, low-glucose medium stimulated or not with insulin and lysed. After SDS-PAGE, immunoblotting was performed with anti-PTP{epsilon} antibody. C and D, Western blots of insulin-induced tyrosine phosphorylation in L6 cells infected with either control vector-pBABE or pBABE cytPTP{epsilon} or with either control RNAi sequence or RNAi PTP{epsilon} sequence. After transfection, cells were transferred to serum-free, low-glucose medium stimulated or not with insulin and lysed. Tyrosine phosphorylation was detected by immunoblotting with antiphospho-IRY972 or antiphospho-IRY1161/1162 antibodies (upper blots), anti-IR to show equal amounts of IR (middle blots), or anti-PTP{epsilon} to show overexpression or knockdown (lower blots). The results are representative of three separate experiments. E, Graph of densitometry measurements of IR tyrosine phosphorylation normalized to the protein levels. Each bar represents the mean ± SE of measurements made in three separate experiments that gave similar results (**, P < 0.01; Student’s t test).

 
In another series of experiments, L6 cells were transfected with either control RNAi sequence or RNAi directed against PTP{epsilon}. Transfection of cells with RNAi PTP{epsilon} resulted in an approximately 60% decrease in cytPTP{epsilon} protein levels (Fig. 4BGo). As can be seen, both RPTP{epsilon} and cytPTP{epsilon} are reduced. However, we focused our studies on the role of cytPTP{epsilon} in insulin signaling for the following reasons: 1) the expression of RPTP{epsilon} is very much less than that of cytPTP{epsilon}; 2) cytPTP{epsilon} but not RPTP{epsilon} is translocated by insulin (see Fig. 2Go); and 3) as mentioned with regard to Fig. 1Go, cytPTP{epsilon} but not RPTP{epsilon} is expressed in both L6 skeletal muscle and skeletal muscle from mice in primary culture. It is important to emphasize here that expression of the related PTP{alpha} was not reduced by RNA silencing.

We next examined which tyrosine residues on IR were affected by cytPTP{epsilon} by using phosphospecific IR antibodies. Phosphotyrosine residue 972 of human IR is located in the juxtamembrane domain and is essential for the association between IR and IRS-1 after insulin stimulation. Phosphotyrosine residues 1162 and 1163 of human IR are located in the kinase domain and undergo autophosphorylation as a result of the association between insulin and its receptor. L6 cells were infected with either control vector-pBABE or pBABE cytPTP{epsilon}. In addition, L6 cells were transfected with either control RNAi sequence or with RNAi directed against PTP{epsilon}. Cells were transferred to serum-free, low-glucose medium; stimulated or not with insulin; and lysed. Tyrosine phosphorylation was detected by immunoblotting with antiphospho-IR Y972 or antiphospho-IR Y1162/1163 antibodies. As shown in Fig. 4Go, C–E, in control cells insulin induced an increase in phosphorylation at tyrosine 972 as well as at tyrosines 1162/1163. In cells overexpressing cytPTP{epsilon} insulin-induced tyrosine phosphorylation on these residues was nearly completely blocked. In contrast, insulin-induced tyrosine phosphorylation of tyrosine 972 and 1162/1163 was increased in cells transfected with RNAi PTP{epsilon} by (mean ± SE) 75 ± 6% (P < 0.01) and 87 ± 12% (P < 0.01), respectively.

cyt-PTP{epsilon} regulates insulin-induced phosphorylation of proteins downstream of IR
The results so far show that insulin induces binding between cytPTP{epsilon} and IR, and this appears to be associated with dephosphorylation of IR after insulin stimulation. If, indeed, cytPTP{epsilon} is involved in regulation of IR phosphorylation state, then perturbations in cytPTP{epsilon} levels might alter IR signaling. Accordingly, we examined the effects of cytPTP{epsilon} on proteins downstream of the IR, such as IRS-1, PKB, and GSK-3, which are known to be phosphorylated after insulin stimulation. L6 cells were infected with either control vector-pBABE or pBABE cytPTP{epsilon}. In addition, L6 cells were transfected with either control RNAi sequence or RNAi PTP{epsilon} sequence. Cells were transferred to serum-free, low-glucose medium; stimulated or not with insulin; and lysed. IRS-1 was immunoprecipitated and immunoblotted with antiphosphotyrosine antibody. Phosphorylation of PKB and GSK-3 was detected by immunoblotting with phosphospecific antibodies. As shown in Fig. 5Go, in control cells insulin induced an increase in IRS-1 (Fig. 5AGo), PKB (Fig. 5BGo), and GSK-3 (Fig. 5CGo) phosphorylations. Overexpression of cytPTP{epsilon} (OE PTP{epsilon}) prevented these phosphorylations. In cells transfected with the PTP{epsilon} RNAi, insulin-induced phosphorylation of IRS-1 was increased by 47 ± 14%, PKB by 36 ± 10%, and GSK-3 by 53 ± 11% (all values are mean ± SE, with P < 0.01 by Student’s t test, n = 4).


Figure 5
View larger version (59K):
[in this window]
[in a new window]

  		FIG. 5. cytPTP{epsilon} regulates insulin-induced phosphorylation of IR downstream proteins. A–D, Western blots of effects of cytPTP{epsilon} overexpression or knockdown on insulin-induced activation of downstream proteins. L6 cells were infected with either control vector-pBABE or pBABE cytPTP{epsilon} or with either control RNAi sequence or RNAi PTP{epsilon} sequence, as in Fig. 4Go. After transfection, cells were transferred to serum-free, low-glucose medium stimulated or not with insulin (Ins) for 5 min and lysed. A, IRS-1 was immunoprecipitated (IP) and immunoblotted (IB) with anti-phosphotyrosine (PY) or anti-IRS-1 antibodies. B, Phosphorylation of PKB was detected by immunoblotting with antiphosphoThr308 or anti-PKB antibodies. C, Phosphorylation of GSK3 was detected by immunoblotting with ant-phosphoGSK-3 Ser9 or anti-GSK3 antibodies. D, Western blots showing protein levels of cytPTP{epsilon} and β-actin. The results are representative of three separate experiments that gave similar results. E, Graph of densitometry measurements of phosphorylation of IRS-1, PKB, and GSK3, normalized to the respective protein levels. Each bar represents the mean ± SE of measurements made in three separate experiments that gave similar results (**, P < 0.01; Student’s t test).

 
Basal phosphorylation of Src is regulated by cytPTP{epsilon}
Studies from our laboratory have shown that Src tyrosine kinase is an early upstream effector of IR activation. We found that insulin activates the Src tyrosine kinase as indicated by both measurements of Src activity and dephosphorylation of SrcY (529). We also found that insulin induces Src to associate with both IR and PKC{delta} (28). Molecular studies have shown that RPTP{epsilon} is an in vivo physiological activator of Src (23) and that RPTP{epsilon} and cytPTP{epsilon} activate also Fyn and Yes, two members of the Src tyrosine kinase family (29). In this study we investigated the possibility that cytPTP{epsilon} might be involved in insulin-induced dephosphorylation and activation of Src. L6 cells were infected with either control vector-pBABE or pBABE cytPTP{epsilon}. In addition, L6 cells were transfected with either control RNAi sequence or RNAi PTP{epsilon} sequence. Cells were transferred to serum-free, low-glucose medium; stimulated or not with insulin; and lysed. Tyrosine phosphorylation was detected by immunoblotting with antiphospho-Src Y529. As shown in Fig. 6AGo, in control cells (transfected with control vector-pBABE) insulin caused a 28% decrease in Src Y529 phosphorylation. Overexpression of cytPTP{epsilon} caused a significant decrease in basal phosphorylation of Src Y529 indicative of Src stimulation. However, insulin stimulation still induced a further dephosphorylation of Src Y529. Indeed the relative decrease in level of phosphorylation in response to insulin (~21%) in cells overexpressing cytPTP{epsilon} was similar to that in control cells.


Figure 6
View larger version (29K):
[in this window]
[in a new window]

  		FIG. 6. Basal phosphorylation of Src is regulated by cytPTP{epsilon}. A, L6 cells were infected with either control vector-pBABE or pBABE cytPTP{epsilon} (OE PTP{epsilon}). IB, Immunoblot; Ins, insulin. B, L6 cells were transfected with either control RNAi sequence or RNAi PTP{epsilon} sequence. Cells were transferred to serum-free, low-glucose medium; stimulated or not with insulin for 5 min; and lysed. Tyrosine phosphorylation was detected by Western blot analysis and immunoblotting with antiphospho-Src Y529 or anti-Src antibodies. The results are representative of three separate experiments. The graphs to the right of each blot are densitometry measurements made from Western blots. Each bar represents the mean ± SE of measurements made in at least three separate experiments that gave similar results (**, P < 0.01 by Student’s t test).

 
As shown in Fig. 6BGo, in control cells (transfected with control RNAi sequence), insulin caused a 37% decrease in Src Y529 phosphorylation. Cells in which cytPTP{epsilon} was knocked down exhibited an increase in basal phosphorylation as well as in insulin-induced Src Y529 dephosphorylation. However, the relative decrease in the level of phosphorylation in response to insulin (~33%) in cells expressing RNAi PTP{epsilon} was similar to that in control cells. These results show that cytPTP{epsilon} is involved in regulating Src phosphorylation but does not appear to affect this parameter in response to insulin stimulation.

cyt-PTP{epsilon} is involved in regulation of insulin-induced glucose uptake
Our results so far demonstrate that cytPTP{epsilon} is a negative regulator of insulin action in skeletal muscle. This suggests that cytPTP{epsilon} might affect the ability of insulin to induce an increase in glucose uptake. To investigate this, we infected L6 cells with either control vector-pBABE or pBABE cytPTP{epsilon}. In addition, L6 cells were transfected with either control RNAi sequence or RNAi PTP{epsilon} sequence. Cells were transferred to serum-free, low-glucose medium, and then they were stimulated or not with insulin. We measured 2-deoxyglucose uptake 25 min after insulin stimulation of these cells. Results of these studies are presented in Fig. 7Go. In cells overexpressing cytPTP{epsilon} (Fig. 7AGo), basal glucose uptake (in each of four experiments) was approximately 35% less than that in the pBABE controls. In addition, insulin-induced stimulation of glucose uptake was strongly reduced in cells overexpressing cytPTP{epsilon} (OE PTP{epsilon}), compared with the control cells. In accord with these findings, basal glucose uptake in cells transfected with cytPTP{epsilon}RNAi (in each of five experiments) was increased by about 30% over that in the corresponding control cells (Fig. 7BGo). However, the relative increase in glucose uptake induced by insulin appeared to be approximately the same in both RNAiC and RNAPTP{epsilon} cells, in both cases the increase being statistically significant.


Figure 7
View larger version (22K):
[in this window]
[in a new window]

  		FIG. 7. cytPTP{epsilon} is involved in regulation of insulin-induced glucose uptake. L6 cells were infected with either control vector-pBABE or pBABE cytPTP{epsilon} (A) or with either control RNAi sequence or RNAi PTP{epsilon} sequence (B). Cells were transferred to serum-free, low-glucose medium and stimulated or not with insulin Ins) for 25 min. The uptake of [3H]2-deoxyglucose into whole-cell cultures in response to insulin was determined as desribed in Materials and Methods. Each bar represents the mean ± SE of measurements made on three replicates in each of four experiments in A (n = 12) and five experiments in B (n = 15). *, P < 0.05; **, P < 0.01, insulin vs. corresponding control, by Student’s t test. Data are expressed as percent of basal uptake in appropriate control cells of each preparation.

 
Tyrosine phosphorylation of IR and IRS-1 is up-regulated in skeletal muscle from PTP{epsilon}KO mice
The findings on overexpression and knockdown of cytPTP{epsilon} so far demonstrate that this PTP is involved in regulation of insulin-induced activation of IR and IRS-1 as well as downstream signaling to glucose uptake. These studies have been performed on L6 myoblasts to facilitate transfection, which cannot readily be accomplished in mature myotubes in primary culture. We felt it important therefore to attempt to validate our findings in a model system of skeletal muscle. To this aim, we performed studies on primary cultures of skeletal muscle obtained from wild-type (WT) mice and mice lacking the cytPTP{epsilon} gene (PTP{epsilon}KO; see Materials and Methods). Western blot of CytPTP{epsilon} in skeletal muscle and liver from WT and PTP{epsilon}KO mice are shown in Fig. 8AGo. CytPTP{epsilon} was not detected in tissues from the PTP{epsilon}KO mice. The lack of the cytPTP{epsilon} gene did not appear to have any noticeable effect on the development of the mice or on the morphological properties of skeletal muscle cultures prepared from newborn pups. Cultures of skeletal muscle from both WT and PTP{epsilon}KO mice displayed large, branching myotubes (Fig. 8BGo) that were spontaneously contractile and were indistinguishable from mouse and rat skeletal muscle in culture used in our laboratory for study of hormonal regulation of membrane transport mechanisms in skeletal muscle. On d 5 in culture, myotubes were transferred to serum-free, low-glucose medium; stimulated or not with insulin; and lysed. Phosphorylation of IR was detected by immunoblotting with phosphospecific IR antibodies. IRS-1 was immunoprecipitated and immunoblotted with anti-phosphotyrosine antibody. As shown in Fig 9Go, A and B, both the basal and insulin-induced increase in IR tyrosine phosphorylation were significantly greater in PTP{epsilon}KO than in WT skeletal muscle cells. Similarly, Fig. 9Go, C and D, shows that basal and IRS-1 tyrosine phosphorylations were greater in the PTP{epsilon}KO than WT skeletal muscle.


Figure 8
View larger version (100K):
[in this window]
[in a new window]

  		FIG. 8. A, Western blots showing levels of cytPTP{epsilon} in liver and skeletal muscle for WT and cytPTP{epsilon} knockout ({epsilon}KO) mice. Liver and skeletal muscle were removed from anesthetized mice, washed with Ca+2/Mg+2-free PBS, and prepared for Western blotting as desribed in Materials and Methods. Preparations were subjected to immunoblotting (IB) with anti-PTP{epsilon} and β-actin antibodies. B, Phase-contrast photomicrographs showing fused branching myotubes in 5-d-old primary cultures of WT and PTP{epsilon}KO skeletal muscle. Horizontal bar, 50 µm and applies to both photographs.

 

Figure 9
View larger version (31K):
[in this window]
[in a new window]

  		FIG. 9. Insulin-induced tyrosine phosphorylation of IR and IRS-1 is increased in cultured skeletal muscle from cytPTP{epsilon} knockout ({epsilon}KO) mice. Primary cultures were prepared from WT and {epsilon}KO mice as desribed in Materials and Methods. On d 5 in culture, differentiated skeletal muscle cells were transferred to serum-free, low-glucose medium; stimulated or not with insulin (Ins) as in Fig. 2Go; and lysed. A, After SDS-PAGE and transfer, immunoblotting (IB) was performed with antiphospho-IR Y1161/1162 antibodies (upper blots) or anti-IR to show equal amounts of IR (lower blots). C, IRS-1 was immunoprecipitated (IP) and immunoblotted with anti-phosphotyrosine (PY) or anti-IRS1 antibodies. The results are representative of three separate experiments. B and D, Graphs of densitometry measurements of IR and IRS-1 tyrosine phosphorylation normalized to the respective protein levels. Each bar represents the mean ± SE of measurements made in three separate experiments that gave similar results (**, P < 0.01; Student’s t test).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The binding of insulin to its receptor initiates a cascade of events, the first critical step of which is activation of the insulin receptor intrinsic tyrosine kinase. The activated receptor phosphorylates endogenous substrate proteins, primarily members of the IRS family. Tyrosine-phosphorylated motifs in these substrates provide docking sites that facilitate the recruitment and activation of a number of signaling proteins (1, 2). An important regulatory step in this pathway is the dephosphorylation of tyrosine residues to return the activated IR to the basal state. The PTPs are a family consisting of more than 100 individual enzymes. PTP1B, the most investigated of PTPs in insulin signaling, is considered to be a negative regulator of insulin action. PTP1B is induced to associate with IR by insulin and to dephosphorylate IR on specific tyrosine residues (30, 31). In addition, both IR and IRS-1 have been shown to be substrates for PTP1B (31, 32, 33). In another study insulin (and IGF-I) was reported to stimulate PTP1B activity in L6 muscle cells after 30 min (34). Finally, mice lacking the PTP1B gene display increased IR and IRS-1 tyrosine phosphorylation and increased insulin sensitivity (5, 6). In contrast, in studies on isolated hepatic endosomes (an important site for IR signaling and dephosphorylation), the phosphotyrosine content of IR was similar in wild-type PTP1B and PTP1B null mice (35). It was concluded that PTP1B (as well as LAR and PTP{alpha}) may not be candidates for IR-associated PTP in hepatic endosomes and the dephosphorylation may result from activities of several PTPs. The involvement of other PTPs as negative regulators in IR signaling is not clear (4). Among those studied include LAR, shown by overexpression of LAR (36, 37) and antisense knockdown of LAR (38, 39), to be a potential negative regulator of insulin signaling in hepatoma cells. In addition, expression of a dominant-negative mutant of the PTP small heterodimer partner-2 in mice induced insulin resistance, suggesting that this phosphatase may be a positive regulator of insulin signaling (40).

In this study, we obtained evidence that strongly suggests that cytPTP{epsilon} serves as another major candidate negative regulator of IR signaling in skeletal muscle. We used techniques to investigate effects of knockdown and overexpression of cytPTP{epsilon} both upstream and downstream in the insulin pathway. We found that insulin induced both rapid translocation of cytPTP{epsilon} to the cell membrane fraction and association with IR. Interestingly, this association occurred in the plasma membrane and on stimulation with insulin the two proteins internalized together. Moreover, insulin stimulation increased the association of the two proteins, and it appeared that almost all internalized IR colocalized with cytPTP{epsilon}. In studies on insulin-induced tyrosine phosphorylation of IR, we found that knockdown of cytPTP{epsilon} by expression of RNAi increased the effect of insulin. Moreover, overexpression of WT cytPTP{epsilon} reduced insulin-induced tyrosine phosphorylation of IR. Similarly, tyrosine phosphorylation of IRS-1 as well as phosphorylation of PKB and GSK were increased in preparations in which cytPTP{epsilon} was knocked down. In preparations in which cytPTP{epsilon} was overexpressed, insulin signaling and stimulation of glucose uptake were significantly decreased, compared with the corresponding controls. Whereas basal glucose uptake was increased in cells in which cytPTP{epsilon} was knocked down, however, the relative incremental increase in glucose uptake in response to insulin was not significantly changed. Finally, we found in studies on skeletal muscle from WT and cytPTP{epsilon}KO mice that tyrosine phosphorylation of IR and IRS-1 in response to insulin was greater in the latter than in the former. Studies on other aspects of the insulin signaling cascade in cytPTP{epsilon}KO mice are currently in progress.

Our findings thus clearly show that overexpression of cytPTP{epsilon} significantly decreased insulin signaling and insulin-induced glucose uptake. In contrast, effects of RNA silencing of cytPTP{epsilon} were only slightly increased. This could be explained by at least two reasons. First, other PTPs are known to be involved in dephosphorylation of insulin-stimulated signaling proteins, such as PTP1B (41), and their activity is clearly not decreased by RNAi cytPTP{epsilon}. Second, cytPTP{epsilon} was reduced by 60%, thus leaving a significant amount of cytPTP{epsilon} to participate in the effects.

Another possible site of interaction of cytPTP{epsilon} is Src, which has been shown to be dephosphorylated on Y529 and activated by insulin (28 and Fig. 6Go). cytPTP{epsilon} and RPTP{epsilon} are reported to dephosphorylate Src and other Src family tyrosine kinases (23, 29). In this study we found that overexpression of cytPTP{epsilon} strongly reduced, and RNAi cytPTP{epsilon} increased, basal phosphorylation of SrcY (529). In contrast, insulin effects on SrcY (529) were not altered by cytPTP{epsilon}. Thus, cytPTP{epsilon} is not involved in insulin-induced dephosphorylation of Src in L6 skeletal muscle cells.

There have been few reports on the possible role of PTP{epsilon} in IR signaling. Most studies have been done by expression of PTPs in cells such as HEK293 and not in cells expressing native PTPs. When overexpressed in BHK cells expressing IR, RPTP{epsilon} was shown inhibit insulin-induced cell rounding and detachment, whereas cytPTP{epsilon} was reported to be a poor suppressor of these phenomena (13, 14). However, when cytPTP{epsilon} was targeted to the plasma membrane (using the Lck-dual acylation motif) this isoform was as effective as RPTP{epsilon} in reversing insulin-induced effects. We showed in L6 skeletal muscle cells, a model for insulin target cells, that insulin induces translocation of cytPTP{epsilon} to the membrane and association with IR. These results are consistent with the earlier reports on BHK cells. In hepatocytes RPTP{epsilon} was reported to regulate IR phosphorylation and subsequent downstream signaling (12). No information was available regarding cytPTP{epsilon} in that communication.

In a recent study on HEK293 cells, it was shown that PTP{alpha} and PTP{epsilon} interact with IR, even in the absence of insulin stimulation, and that insulin induces a rapid and dose-dependent increase in the interaction of these proteins as measured by bioluminescence resonance energy transfer (BRET;24). It was concluded that the effect of insulin was the result of a conformational change between IR and preassociated PTPs rather than recruitment of PTPs to the activated receptor. This conclusion would appear to be in disagreement with our study, performed both on intact skeletal muscle with natively expressed cytPTP{epsilon} and cells in which cytPTP{epsilon} was overexpressed. Thus, on the one hand, both Western blotting and confocal microscope studies indicate that IR and cytPTP{epsilon} may be constitutively associated. However, in disagreement with the above study, we found that insulin stimulation induces an increase in the association of cytPTP{epsilon} with IR. Furthermore, our data indicate that insulin induces translocation of cytPTP{epsilon} from the cytosol to the membrane fraction in which the two proteins associate, and the two proteins subsequently migrate together intracellularly. Moreover, the time course of association closely parallels that of IR dephosphorylation, thus indicating that the increase in association is of functional significance.

In summary, we have demonstrated the functional significance of cytPTP{epsilon} in insulin signaling in skeletal muscle. Thus, on overexpression of cytPTP{epsilon}, phosphorylation of these proteins in response to insulin was strongly reduced, if not entirely abrogated, and insulin-induced glucose uptake was significantly reduced. Moreover, we found that insulin-induced phosphorylation of IR, IRS-1, PKB, and GSK-3 were increased in preparations in which cytPTP{epsilon} was knocked down by PTP{epsilon} RNAi. Finally, insulin-induced tyrosine phosphorylation of IR and IRS-1 was higher in skeletal muscle from cytPTP{epsilon} knockout than wild-type mice. The results in this report thus strongly indicate that cytPTP{epsilon} is likely to be a major PTP involved in regulation of IR signaling in skeletal muscle.


   Footnotes
 
This work was supported in part by the Russell Berrie Foundation and D-Cure, Diabetes Care in Israel; grants from the Chief Scientist’s Office of the Israel Ministry of Health; and the Sorrell Foundation. This study represents an essential portion of the thesis submitted by S.A.-M. to Bar-Ilan University in partial fulfillment of the requirements for the Ph.D. degree.

Disclosure Statement: The authors have nothing to disclose.

First Published Online November 15, 2007

Abbreviations: cytPTP{epsilon}, Cytosolic PTP{epsilon}; GFP, green fluorescent protein; GSK, glycogen synthase kinase; IR, insulin receptor; IRS, IR substrate; LAR, Leukocyte common antigen-related PTP; OE, overexpressed; PKB, protein kinase B; PTP, protein tyrosine phosphatase; PTP{epsilon}KO, genetically lacking PTP{epsilon}; RNAi, RNA interference; RPTP{epsilon}, receptor-type PTP; SDS, sodium dodecyl sulfate; SHP, SH2 domain containing PTP; WT, wild type.

Received July 5, 2007.

Accepted for publication November 2, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. White MF 1997 The insulin signalling system and the IRS proteins. Diabetologia 40(Suppl 2):S2–S17
  2. Withers DJ, White M 2000 Perspective: the insulin signaling system—a common link in the pathogenesis of type 2 diabetes. Endocrinology 141:1917–1921[Free Full Text]
  3. Saltiel AR, Kahn CR 2001 Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414:799–806[CrossRef][Medline]
  4. Stoker AW 2005 Protein tyrosine phosphatases and signalling. J Endocrinol 185:19–33[Abstract/Free Full Text]
  5. Elchebly M, Payette P, Michaliszyn E, Cromlish W, Collins S, Loy AL, Normandin D, Cheng A, Himms-Hagen J, Chan CC, Ramachandran C, Gresser MJ, Tremblay ML, Kennedy BP 1999 Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene. Science 283:1544–1548[Abstract/Free Full Text]
  6. Klaman LD, Boss O, Peroni OD, Kim JK, Martino JL, Zabolotny JM, Moghal N, Lubkin M, Kim YB, Sharpe AH, Stricker-Krongrad A, Shulman GI, Neel BG, Kahn BB 2000 Increased energy expenditure, decreased adiposity, and tissue-specific insulin sensitivity in protein-tyrosine phosphatase 1B-deficient mice. Mol Cell Biol 20:5479–5489[Abstract/Free Full Text]
  7. Gil-Henn H, Volohonsky G, Elson A 2001 Regulation of protein-tyrosine phosphatases {alpha} and {epsilon} by calpain-mediated proteolytic cleavage. J Biol Chem 276:31772–31779[Abstract/Free Full Text]
  8. Gil-Henn H, Volohonsky G, Toledano-Katchalski H, Gandre S, Elson A 2000 Generation of novel cytoplasmic forms of protein tyrosine phosphatase epsilon by proteolytic processing and translational control. Oncogene 19:4375–4384[CrossRef][Medline]
  9. Elson A, Leder P 1995 Identification of a cytoplasmic, phorbol ester-inducible isoform of protein tyrosine phosphatase epsilon. Proc Natl Acad Sci USA 92:12235–12239[Abstract/Free Full Text]
  10. Elson A, Leder P 1995 Protein-tyrosine phosphatase epsilon. An isoform specifically expressed in mouse mammary tumors initiated by v-Ha-ras OR neu. J Biol Chem 270:26116–26122[Abstract/Free Full Text]
  11. Chiusaroli R, Knobler H, Luxenburg C, Sanjay A, Granot-Attas S, Tiran Z, Miyazaki T, Harmelin A, Baron R, Elson A 2004 Tyrosine phosphatase {epsilon} is a positive regulator of osteoclast function in vitro and in vivo. Mol Biol Cell 15:234–244[Abstract/Free Full Text]
  12. Nakagawa Y, Aoki N, Aoyama K, Shimizu H, Shimano H, Yamada N, Miyazaki H 2005 Receptor-type protein tyrosine phosphatase epsilon (PTP{epsilon}M) is a negative regulator of insulin signaling in primary hepatocytes and liver. Zool Sci 22:169–175[CrossRef][Medline]
  13. Andersen JN, Elson A, Lammers R, Romer J, Clausen JT, Moller KB, Moller NP 2001 Comparative study of protein tyrosine phosphatase-{epsilon} isoforms: membrane localization confers specificity in cellular signalling. Biochem J 354:581–590[CrossRef][Medline]
  14. Moller NP, Moller KB, Lammers R, Kharitonenkov A, Hoppe E, Wiberg FC, Sures I, Ullrich A 1995 Selective down-regulation of the insulin receptor signal by protein-tyrosine phosphatases {alpha} and {epsilon}. J Biol Chem 270:23126–23131[Abstract/Free Full Text]
  15. Toledano-Katchalski H, Kraut J, Sines T, Granot-Attas S, Shohat G, Gil-Henn H, Yung Y, Elson A 2003 Protein tyrosine phosphatase {epsilon} inhibits signaling by mitogen-activated protein kinases. Mol Cancer Res 1:541–550[Abstract/Free Full Text]
  16. Kraut J, Volohonsky G, Toledano-Katchalski H, Elson A 2002 Nuclear localization of non-receptor protein tyrosine phosphatase {epsilon} is regulated by its unique N-terminal domain. Exp Cell Res 281:182–189[CrossRef][Medline]
  17. Peretz A, Gil-Henn H, Sobko A, Shinder V, Attali B, Elson A 2000 Hypomyelination and increased activity of voltage-gated K(+) channels in mice lacking protein tyrosine phosphatase epsilon. EMBO J 19:4036–4045[CrossRef][Medline]
  18. Flint AJ, Tiganis T, Barford D, Tonks NK 1997 Development of "substrate-trapping" mutants to identify physiological substrates of protein tyrosine phosphatases. Proc Natl Acad Sci USA 94:1680–1685[Abstract/Free Full Text]
  19. Morgenstern JP, Land H 1990 Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Res 18:3587–3596[Abstract/Free Full Text]
  20. Braiman L, Alt A, Kuroki T, Ohba M, Bak A, Tennenbaum T, Sampson SR 1999 Protein kinase C{Delta} mediates insulin-induced glucose transport in primary cultures of rat skeletal muscle. Mol Endocrinol 13:2002–2012[Abstract/Free Full Text]
  21. Braiman L, Sheffi-Friedman L, Bak A, Tennenbaum T, Sampson SR 1999 Tyrosine phosphorylation of specific protein kinase C isoenzymes participates in insulin stimulation of glucose transport in primary cultures of rat skeletal muscle. Diabetes 48:1922–1929[Abstract]
  22. Rosenzweig T, Braiman L, Bak A, Alt A, Kuroki T, Sampson SR 2002 Differential effects of tumor necrosis factor-{alpha} on protein kinase C isoforms {alpha} and {Delta} mediate inhibition of insulin receptor signaling. Diabetes 51:1921–1930[Abstract/Free Full Text]
  23. Gil-Henn H, Elson A 2003 Tyrosine phosphatase-{epsilon} activates Src and supports the transformed phenotype of Neu-induced mammary tumor cells. J Biol Chem 278:15579–15586[Abstract/Free Full Text]
  24. Lacasa D, Boute N, Issad T 2005 Interaction of the insulin receptor with the receptor-like protein tyrosine phosphatases PTP{alpha} and PTP{epsilon} in living cells. Mol Pharmacol 67:1206–1213[Abstract/Free Full Text]
  25. Hori SS, Kurland IJ, DiStefano III JJ 2006 Role of endosomal trafficking dynamics on the regulation of hepatic insulin receptor activity: models for Fao cells 1. Ann Biomed Eng 34:879–892[CrossRef][Medline]
  26. Foti M, Moukil MA, Dudognon P, Carpentier JL 2004 Insulin and IGF-1 receptor trafficking and signalling. Novartis Found Symp 262:125–141; discussion 141–147, 265–268[Medline]
  27. Bergeron JJ, Di Guglielmo GM, Baass PC, Authier F, Posner BI 1995 Endosomes, receptor tyrosine kinase internalization and signal transduction. Biosci Rep 15:411–418[CrossRef][Medline]
  28. Rosenzweig T, Aga-Mizrachi S, Bak A, Sampson SR 2004 Src tyrosine kinase regulates insulin-induced activation of protein kinase C (PKC) {Delta} in skeletal muscle. Cell Signal 16:1299–1308[CrossRef][Medline]
  29. Granot-Attas S, Elson A 2004 Protein tyrosine phosphatase epsilon activates Yes and Fyn in Neu-induced mammary tumor cells. Exp Cell Res 294:236–243[CrossRef][Medline]
  30. Seely BL, Staubs PA, Reichart DR, Berhanu P, Milarski KL, Saltiel AR, Kusari J, Olefsky JM 1996 Protein tyrosine phosphatase 1B interacts with the activated insulin receptor. Diabetes 45:1379–1385[Abstract]
  31. Bandyopadhyay D, Kusari A, Kenner KA, Liu F, Chernoff J, Gustafson TA, Kusari J 1997 Protein-tyrosine phosphatase 1B complexes with the insulin receptor in vivo and is tyrosine-phosphorylated in the presence of insulin. J Biol Chem 272:1639–1645[Abstract/Free Full Text]
  32. Dadke S, Kusari J, Chernoff J 2000 Down-regulation of insulin signaling by protein-tyrosine phosphatase 1B is mediated by an N-terminal binding region. J Biol Chem 275:23642–23647[Abstract/Free Full Text]
  33. Goldstein BJ, Bittner-Kowalczyk A, White MF, Harbeck M 2000 Tyrosine dephosphorylation and deactivation of insulin receptor substrate-1 by protein-tyrosine phosphatase 1B. Possible facilitation by the formation of a ternary complex with the Grb2 adaptor protein. J Biol Chem 275:4283–4289[Abstract/Free Full Text]
  34. Kenner KA, Hill DE, Olefsky JM, Kusari J 1993 Regulation of protein tyrosine phosphatases by insulin and insulin-like growth factor I. J Biol Chem 268:25455–25462[Abstract/Free Full Text]
  35. Li C, Baquiran G, Gu F, Tremblay ML, Fazel A, Bergeron JJ, Posner BI 2006 Insulin receptor kinase-associated phosphotyrosine phosphatases in hepatic endosomes: assessing the role of phosphotyrosine phosphatase-1B. Endocrinology 147:912–918[Abstract/Free Full Text]
  36. Li PM, Zhang WR, Goldstein BJ 1996 Suppression of insulin receptor activation by overexpression of the protein-tyrosine phosphatase LAR in hepatoma cells. Cell Signal 8:467–473[CrossRef][Medline]
  37. Zhang WR, Li PM, Oswald MA, Goldstein BJ 1996 Modulation of insulin signal transduction by eutopic overexpression of the receptor-type protein-tyrosine phosphatase LAR. Mol Endocrinol 10:575–584[Abstract/Free Full Text]
  38. Kulas DT, Zhang WR, Goldstein BJ, Furlanetto RW, Mooney RA 1995 Insulin receptor signaling is augmented by antisense inhibition of the protein tyrosine phosphatase LAR. J Biol Chem 270:2435–2438[Abstract/Free Full Text]
  39. Mooney RA, Kulas DT, Bleyle LA, Novak JS 1997 The protein tyrosine phosphatase LAR has a major impact on insulin receptor dephosphorylation. Biochem Biophys Res Commun 235:709–712[CrossRef][Medline]
  40. Maegawa H, Hasegawa M, Sugai S, Obata T, Ugi S, Morino K, Egawa K, Fujita T, Sakamoto T, Nishio Y, Kojima H, Haneda M, Yasuda H, Kikkawa R, Kashiwagi A 1999 Expression of a dominant negative SHP-2 in transgenic mice induces insulin resistance. J Biol Chem 274:30236–30243[Abstract/Free Full Text]
  41. Nieto-Vazquez I, Fernandez-Veledo S, de Alvaro C, Rondinone CM, Valverde AM, Lorenzo M 2007 Protein-tyrosine phosphatase 1B-deficient myocytes show increased insulin sensitivity and protection against tumor necrosis factor-{alpha}-induced insulin resistance. Diabetes 56:404–413[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Mol. Biol. CellHome page
E. Vafiadaki, D. A. Arvanitis, S. N. Pagakis, V. Papalouka, D. Sanoudou, A. Kontrogianni-Konstantopoulos, and E. G. Kranias
The Anti-apoptotic Protein HAX-1 Interacts with SERCA2 and Regulates Its Protein Levels to Promote Cell Survival
Mol. Biol. Cell, January 1, 2009; 20(1): 306 - 318.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Aga-Mizrachi, S.
Right arrow Articles by Sampson, S. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Aga-Mizrachi, S.
Right arrow Articles by Sampson, S. R.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals