help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2007-1234
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van der Laan, S.
Right arrow Articles by Meijer, O. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van der Laan, S.
Right arrow Articles by Meijer, O. C.
Endocrinology Vol. 149, No. 2 725-732
Copyright © 2008 by The Endocrine Society

Nuclear Receptor Coregulators Differentially Modulate Induction and Glucocorticoid Receptor-Mediated Repression of the Corticotropin-Releasing Hormone Gene

S. van der Laan, S. B. Lachize, E. Vreugdenhil, E. R. de Kloet and O. C. Meijer

Division of Medical Pharmacology, Leiden/Amsterdam Centre for Drug Research and Leiden University Medical Centre, 2300 RA Leiden, The Netherlands

Address all correspondence and requests for reprints to: S. van der Laan, Division of Medical Pharmacology, Leiden/Amsterdam Centre for Drug Research and Leiden University Medical Centre, P.O. Box 9502, 2300 RA Leiden, The Netherlands. E-mail: s.van.der.laan{at}lacdr.leidenuniv.nl.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nuclear receptor coregulators are proteins that modulate the transcriptional activity of steroid receptors and may explain cell-specific effects of glucocorticoid receptor action. Based on the uneven distribution of a number of coregulators in CRH-expressing cells in the hypothalamus of the rat brain, we tested the hypothesis that these proteins are involved as mediators in the glucocorticoid-induced repression of the CRH promoter. Therefore, we assessed the role of coregulator proteins on both induction and repression of CRH in the AtT-20 cell line, a model system for CRH repression by glucocorticoids. The steroid receptor coactivator 1a (SRC1a), SRC-1e, nuclear corepressor (N-CoR), and silencing mediator of the retinoid and thyroid hormone receptor (SMRT) were studied in this system. We show that the concentration of glucocorticoid receptor and the type of ligand, i.e. corticosterone or dexamethasone, determines the repression. Furthermore, overexpression of SRC1a, but not SRC1e, increased both efficacy and potency of the glucocorticoid receptor-mediated repression of the forskolin-induced CRH promoter. Unexpectedly, cotransfection of the corepressors N-CoR and SMRT did not affect the corticosterone-dependent repression but resulted in a marked decrease of the forskolin stimulation of the CRH gene. Altogether, our data demonstrate that 1) the concentration of the receptor, 2) the type of ligand, and 3) the coregulator recruited all determine the expression and the repression of the CRH gene. We conclude that modulation of coregulator activity may play a role in the control of the hypothalamus-pituitary-adrenal axis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CRH IS CRITICALLY involved in regulation of hypothalamus-pituitary-adrenal (HPA) axis activity and in diverse stress-related behavioral responses involving fear and anxiety (1). The 41-amino-acid-long neuropeptide is expressed in multiple brain areas (2, 3), and regulation of its expression is considered crucial for appropriate adaptation to stressors (4). Peripheral administration of glucocorticoids decreases CRH mRNA expression levels in the paraventricular nucleus of the hypothalamus (PVN) but concurrently increases CRH transcript levels in the central nucleus of the amygdala (CeA). Accordingly, adrenalectomy has opposite effects on CRH gene expression in the CeA and PVN (5). The molecular mechanism by which the glucocorticoid receptor (GR) simultaneously mediates opposing effects on the same promoter, dependent on the cellular context, so far remains unknown.

Numerous coregulator proteins interact with nuclear receptors such as the GR to regulate the transcription of target genes (6, 7). The interactions of these proteins with the DNA-bound steroid receptor form an essential mechanism in the modulation of the genomic response. Coregulators are typically divided in two different classes, coactivators and corepressors (8). The coactivator proteins such as members of the well-documented family of p160 steroid receptor coactivator (SRCs) possess intrinsic histone acetyltransferase activity (HAT) and contain distinct regions and motifs for the recruitment of other proteins with enzymatic activities, including CREB-binding protein (CBP)/p300 and coactivator-associated arginine methyltransferase 1 (CARM-1). Acetylation of histones is important in maintaining an open chromatin structure, thereby facilitating the access of the ligand-activated GR to the proximal promoter of a target gene (9). Conversely, corepressors such as nuclear corepressor (N-CoR) and silencing mediator of the retinoid and thyroid hormone receptor (SMRT) proteins have intrinsic histone deacetyltransferase activity that catalyzes the deacetylation of the chromatin. They form docking surfaces for the recruitment of additional components of corepressor complexes, resulting in a reduction of the transcriptional activity (10). The importance of coregulators for GR-mediated transcriptional regulation has been studied mainly in the context of transactivated target genes. The ratio of coactivators and corepressors expressed in the cell has been proposed to determine the nature and the magnitude of the GR-mediated transcriptional response, particularly at subsaturating levels of corticosterone (CORT) (11).

The activity of coregulators depends on their expression levels as well as posttranslational modifications of the proteins. Recently, we have mapped in the rat brain the expression of the coregulators SRC1a, SRC1e, N-CoR, and SMRT (12, 13), which are all known to interact with the ligand-activated GR in vitro (14, 15). These coregulators are abundantly expressed in brain tissue and have distinct expression patterns. In line with the proposed models of steroid action, we hypothesized that their different distribution in brain and their specific contribution to nuclear receptor activity possibly define in part the cell-specific responses elicited by glucocorticoids. The most compelling observation in this respect is that SRC1a is highly abundant in the PVN, coinciding with the site-specific glucocorticoid-dependent repression of the CRH gene (16).

A well-established model to study GR-mediated repression of the CRH gene is the AtT-20 cell line (17). The proximal promoter of this gene contains among others an inducible CRE and a negative glucocorticoid-responsive element (nGRE). To characterize the role of the coregulators in both forskolin induction and glucocorticoid-dependent repression of the CRH gene, we performed transient transfections in AtT-20 cells. We show that SRC1a (but not SRC1e) specifically enhances GR-mediated repression at physiologically relevant concentrations of the naturally occurring ligand CORT. In addition, corepressors do not affect gene repression by GR, but reduce CREB-mediated CRH expression.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids
The pCRH(–918) luciferase reporter was kindly provided by Dr. R. I. Dorin (Albuquerque Veterans Administration Medical Centre, Albuquerque, NM). Expression plasmids pCMX-N-CoR and p-CMX-mSMRTa were kindly provided by, respectively, Dr. M. G. Rosenfeld (Howard Hughes Medical Institute) and Dr. R. M. Evans (Howard Hughes Medical Institute). As a positive control for CREB activation, the 5XCRE-TATA-pgl2 reporter plasmid was used (kindly provided by T. Schouten, Leiden University Medical Centre). The expression plasmids of wild-type SRC1 splice variants and rGR were previously tested and described (14, 18).

Small interference RNA (siRNA) constructs
Small interference RNA (siRNA) expression vector and mismatch control directed against the consensus sequence of human, rat, and mouse GR were designed. The sequence for siRNA against mouse GR (NM_008173) was GATCCCCGAAAGCATTGCAAACCTCATTCAAGAGATGAGGTTTGCAATGCTTTCTTTTTGGAAA for the perfect match and GATCCCCGACAGCATTGCACACCTCATTCAAGAGATGAGGTGTGCAATGCTGTCTTTTTGGAAA the mismatch control. The sense and antisense oligonucleotides of 64 bp long were annealed and cloned in BglII and HindIII sites of p-super vector (The Netherlands Cancer Institute, Amsterdam, The Netherlands). Insertion of the oligonucleotides was confirmed by sequencing. The knockdown of the GR was tested by Western blot and quantitative PCR in rat PC12 cells (van Hooijdonk, L., V. Brinks, O. C. Meijer, E. R. de Kloet, T. Schouten, T. F. Dijkmans, A. C. A. Vellinga, M. S. Oitzl, C. P. Fitzsimons, and E. Vreugdenhil, in preparation) and functionally tested in AtT-20 cells on a 3x-containing GRE reporter TAT-3-luc.

Cell culture and transient transfections
AtT-20/D-16V mouse tumor cells (kindly provided by Dr. J. van der Hoek, Erasmus Medical Centre, Rotterdam, The Netherlands) were grown and maintained in DMEM containing 4.5 g/liter glucose supplemented with 0.5% penicillin/streptomycin, 10% horse serum, and 10% fetal bovine serum (Invitrogen Life Technologies, Breda, The Netherlands) in a humidified atmosphere of 5% CO2 at 37 C. A day before transfection, 0.1 x 106 cells per well were plated in a 24-well plate (Greiner Bio-One, Alphen aan den Rijn, The Netherlands). For each well, the cells were transfected using 1,6 µl Lipofectamine 2000 (Invitrogen Life Technologies) per 0.8 µg plasmid according to the manufacturer’s instructions. To induce the CRH promoter, the cells were treated with 10 µM forskolin (Calbiochem, Darmstadt, Germany), which leads to an increase of intracellular cAMP. Subsequent protein kinase A activation results in CREB phosphorylation (19). Repression of the forskolin-induced CRH promoter was performed with the synthetic glucocorticoid dexamethasone (DEX) or the naturally occurring glucocorticoid CORT cotreatment. The cells were harvested and assayed according to the luciferase kit instructions (Promega, Madison, WI) using a luminometer (LUMAT LB 9507; Berthold, Bad Wildbad, Germany).

First, we further validated the AtT-20 cells as a model for glucocorticoid-dependent repression of the CRH promoter. For the GR knockdown, 400 ng siRNA expression plasmid, 200 ng CRH reporter, and 200 ng empty vector plasmid were transfected. After transfection, the cells were allowed to recover for 48 h before treatment. For the dose-response curves of DEX and CORT, serial 10x dilutions were prepared from a 10–6 M solution. To characterize the role of the coregulators, 200 ng reporter, 400 ng expression, and 200 ng empty vector plasmid were transfected per well. For the dose-response curves of corepressors, 200 ng reporter and a varying amount of corepressor expression plasmid were transfected. The total amount of DNA for each transfection was kept constant using empty vector.

Data analysis
Two different renilla reporters were tested (pRL-TK and pRL-CMV) for normalization. Both were found responsive to forskolin and DEX treatment in AtT-20 cells (data not shown). Consequently, the data were normalized against basal activity of the CRH promoter (fold induction) or expressed as a percentage of maximal induction of the CRH promoter after forskolin stimulation (percentage of maximal induction).

Statistics
The values are expressed as the average of four parallel transfections within one experiment, and the error bars represent the SD. All transfection experiments were performed at least twice, yielding similar results. Overall statistical analysis was performed using one-way ANOVA, and statistical significance was determined with Tukey’s multiple comparison tests with P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CRH promoter activity and glucocorticoid-induced repression in AtT-20
Forskolin treatment for 4 and 24 h led to a marked increase of the CRH promoter activity in transiently transfected AtT-20 cells (93 ± 6- and 68 ± 8-fold induction at, respectively, 4 and 24 h). The sustained 24-h treatment resulted in a lower luciferase signal compared with the 4-h treatment. Furthermore, cotreatment with 10–7 M DEX strongly reduced the forskolin-induced stimulation of the CRH promoter in both groups. The repression caused by the cotreatment with 10–7 M DEX was 66% at 4 h and 44% at 24 h (Fig. 1AGo). Unless stated otherwise, all subsequent data were generated after 4 h of treatment, the time point at which the most robust DEX-induced repression of the CRH promoter activity was observed.


Figure 1
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 1. GR-mediated repression of the forskolin-induced CRH promoter activity. A, Dexamethasone-induced CRH repression after 4 and 24 h cotreatment with forskolin (FSK). Data are expressed as the fold induction over basal activity of the promoter in untreated cells. The average values ± SD (n = 4) are shown. The DEX-induced repression of the CRH promoter was higher after 4 h of incubation compared with 24 h. B, Role of the GR in the DEX-induced repression. The CRH promoter activity was measured after 4 h of incubation and normalized against the maximal effect of forskolin without steroid in each group. ev, Empty vector; mm, mismatch siRNA control; rGR, rat GR expression plasmid; siGR, siRNA against GR. The average values ± SD (n = 4) are shown. *, Significantly different from the repression induced by DEX in the empty vector group (P < 0.001). The level of repression of CRH promoter activity is GR dependent.

 
To confirm the specific role of GR in the DEX-induced repression, and to assess whether the GR is a limiting factor in the present setting, GR was either overexpressed or knocked down in the AtT-20 cells. The overexpression of the GR protein resulted in a significant increase of the repression induced by DEX (Fig. 1BGo). In this condition, DEX cotreatment resulted in 90% repression, almost completely silencing the forskolin-induced stimulation of the CRH promoter. Conversely, the siRNA-mediated knockdown of the GR completely abolished the DEX-induced repression. The mismatch control did not significantly differ from the empty vector group indicating a specific knockdown of the GR. These data together indicate that the concentration of GR protein in the AtT-20 cells determines the magnitude of the DEX-induced CRH repression. The present setting forms a suitable model to assess coregulator protein function in the GR-mediated repression of the CRH promoter activity.

DEX- and CORT-induced CRH repression
The aim of our study was to address whether brain-expressed coregulator proteins play a role in the regulation of the CRH gene expression. Although it is known that the GR activity depends on the type of ligand (20), so far, the synthetic glucocorticoid DEX has been the treatment of choice in most studies on glucocorticoid-mediated CRH repression in AtT-20 cells (21, 22, 23). To approach to a maximal extent the in vivo situation, we tested whether the naturally occurring ligand of the GR in rodents, i.e. CORT, resulted in similar repression of the CRH gene. We generated a time curve of CRH promoter activity and compared the repressive effects of 10–7 M DEX with 10–7 M CORT cotreatment (Fig. 2AGo). Both the natural and the synthetic glucocorticoid suppressed CRH promoter activity, although not to the same extent. A maximal repression of 40 and 70% was achieved after 4–5 h with 10–7 M CORT and 10–7 M DEX cotreatment, respectively.


Figure 2
View larger version (15K):
[in this window]
[in a new window]

 
FIG. 2. CORT-dependent repression of the CRH-induced gene. A, Time course of CRH promoter activity after forskolin (FSK) treatment with or without DEX or CORT cotreatment. The effects of forskolin ({blacksquare}), cotreatment with 10–7 M DEX ({blacktriangleup}) or 10–7 M CORT ({blacktriangledown}) on CRH promoter activity are shown over 8 h. The average values ± SD (n = 4) are shown and represent the fold induction. B, Dose-response curve of DEX and CORT cotreatment. The luciferase activity at each steroid concentration was measured after 4 h incubation and normalized against the maximal effect of forskolin without steroid. The average values ± SD (n = 4) are shown and represent the fold repression mediated by the two different cotreatments on CRH promoter activity. DEX is more potent in suppressing CRH promoter activity.

 
Additionally, we generated dose-response curves of DEX and CORT cotreatment for the GR-mediated repression of CRH promoter activity. As shown in Fig. 2BGo, both efficacy and potency were higher for DEX cotreatment compared with CORT cotreatment. The effective concentration of DEX [EC50(DEX)] was 0.46 ± 0.004 nM, and the maximal repression of 75% was achieved at 10–7 M. Cotreatment with CORT was less effective, and the maximal repression of 55% was observed at 10–6 M CORT cotreatment. This was significantly lower compared with the DEX-induced maximal repression. The EC50 of the CORT-induced repression [EC50(CORT)] was 52 ± 1 nM, approximately 100 times higher than for DEX cotreatment.

Differential effects of SRC1 isoforms on GR-mediated CRH repression
In the next experiments, we tested the effect of SRC1a and SRC1e overexpression on GR-mediated repression of the CRH promoter activity. Cotransfection of SRC1a resulted in a significant GR-mediated repression at 10–8 M CORT (Fig. 3BGo). The potency of CORT to induce repression was approximately three times higher in the presence of SRC1a [EC50(SRC1a) = 18 ± 0.3 nM] when compared with the control situation [EC50(CORT) = 52 ± 1 nM]. On the other hand, overexpression of SRC1e tended to shift the dose-response curve to the right and resulted in a two times higher EC50 [EC50(SRC1e) = 109 ± 0.3 nM] compared with the control group (Fig. 3CGo). These data indicate that SRC1a and SRC1e have opposing effects on the CORT-induced repression (Fig. 3DGo). Moreover, the maximal repression by GR in the presence of both SRC1 isoforms significantly differed from the control group. SRC1a overexpression resulted in a maximal repression of 67%, which was higher than both the maximal repression in the control group (maximal repression 55%) and in presence of SRC1e (maximal repression 45%). In summary, both the efficacy and potency of the GR-mediated repression of the CRH promoter were higher in presence of SRC1a and tended to be reduced in presence of SRC1e.


Figure 3
View larger version (20K):
[in this window]
[in a new window]

 
FIG. 3. Differential effect of SRC1 isoforms on GR-mediated CRH repression. CRH promoter activity is expressed as fold induction (normalized against basal activity of the promoter). The luciferase activity was measured after 4 h incubation. The average values ± SD (n = 4) are shown. *, Significantly different from the group with 10–10 M CORT (P < 0.001). A, Control group was cotransfected with the empty vector plasmid; B, SRC1a modulates the CORT-induced repression of the CRH promoter, and overexpression of SRC1a resulted in a significant repression at 10–8 M CORT; C, SRC1e overexpression resulted in a significant repression at 10–7 M CORT; D, CORT-induced repression as percentage of maximal induction by forskolin. Cotransfection of SRC1a results in a left shift of the dose-response curve.

 
N-CoR and SMRT do not affect GR-mediated CRH repression
Subsequently, we tested whether corepressor expression would affect the GR-mediated repression of the CRH promoter. Interestingly, forskolin treatment led to a reduced maximal induction of the CRH gene expression when N-CoR or SMRT were cotransfected (Fig. 4Go, B and C), suggesting that CREB-directed transcription of the CRH gene is suppressed by both corepressors (30-fold compared with a typically 100-fold as observed in the absence of overexpressed coregulators, Fig 4AGo). Surprisingly, N-CoR and SMRT overexpression resulted in a similar dose-response curve for transrepression compared with the control situation (Fig. 4DGo). A maximal repression of approximately 55% for both situations was observed at 10–6 M CORT and a highly similar potency. The effective concentration in presence of N-CoR or SMRT was EC50(N-CoR) = 47 ± 1 nM and EC50(SMRT) = 49 ± 1 nM, respectively. Although both corepressors have been shown to interact with agonist-activated GR on positively regulated genes (15, 24), they do not modulate the GR-mediated repression of the CRH promoter at the nGRE. The effects of the coactivators and the corepressors on the GR-mediated repression of CRH gene expression are summarized in Table 1Go.


Figure 4
View larger version (20K):
[in this window]
[in a new window]

 
FIG. 4. Corepressors N-CoR and SMRT do not affect GR-mediated CRH repression. CRH promoter activity is expressed as fold induction (normalized against basal activity of the promoter). The luciferase activity was measured after 4 h incubation. The average values ± SD (n = 4) are shown. *, Significantly different from the group with 10–10 M CORT (P < 0.001). A, Control group was cotransfected with the empty vector plasmid; B and C, overexpression of the corepressors N-CoR (B) and SMRT (C) suppresses the forskolin-induced promoter activity; D, neither N-CoR nor SMRT changes the dose-response curve of CORT. This suggests that N-CoR and SMRT repress CREB activity but do not interact with the GR-mediated repression.

 

View this table:
[in this window]
[in a new window]

 
TABLE 1. Effect of coregulator overexpression on the GR-mediated repression of the CRH-promoter

 
N-CoR and SMRT dose-dependently suppress CREB-mediated transcription
To further examine the role of the corepressors N-CoR and SMRT on CREB-mediated transcription, we compared the effect of increasing amounts of the corepressors on two different CRE-containing reporter constructs, i.e. the composite CRH promoter and the simple 5xCRE-containing promoter (Fig. 5AGo). We found that both N-CoR and SMRT dose-dependently suppressed the CREB-mediated transcription of the CRH promoter (Fig. 5BGo). On the simple 5xCRE-containing reporter, both N-CoR and SMRT suppressed CREB-mediated transcription even more potently, with a maximal inhibition of the forskolin-induced stimulation after cotransfection of 100 ng expression plasmid (Fig. 5CGo). These data together suggest a direct interaction of CREB with both N-CoR and SMRT at multiple CRE-containing promoters. DEX cotreatment did not affect the forskolin induction of the 5xCRE-containing promoter, indicating that the GR-mediated repression of the CRH promoter is not mediated via the CRE and/or CRE-related proteins (Fig. 6Go) but more likely is the result of a direct interaction of the GR with the nGRE of the CRH promoter.


Figure 5
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 5. CREB-mediated transcription is suppressed by N-CoR and SMRT. A, Schematic representation of the CRH-luciferase reporter, with both the nGRE and the CRE and the synthetic 5xCRE-containing reporter; B and C, dose-dependent effects of N-CoR and SMRT overexpression on the CRH-luc reporter (B) or the 5xCRE-luc reporter (C). The luciferase activity was measured after 24 h forskolin incubation. The average values ± SD (n = 4) are shown.

 

Figure 6
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 6. Promoter-specific effects of DEX cotreatment. Cotreatment with 10–7 M DEX suppresses forskolin-induced CRH promoter activity, whereas it does not affect the promoter activity of the forskolin-induced 5xCRE-containing promoter. The GR-mediated repression is promoter dependent and is not likely to involve cross-talk with CRE-related proteins. The average values ± SD (n = 4) are shown. The luciferase activity was measured after 24 h treatment. *, Significantly different from the forskolin-induced promoter activity (P < 0.05).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we tested the hypothesis that the repression of the CRH gene by glucocorticoids is determined by the type of coregulator recruited. The hypothesis is based on the observation that both SRC1 splice variants and corepressors have distinct functional effects on transcription by nuclear receptors and are differentially expressed in rat brain (12, 13). The overexpression of the coactivator SRC1a increased both efficacy and potency of the CORT-dependent repression of forskolin-induced CRH expression. Conversely, the corepressors N-CoR and SMRT did not affect the GR-mediated repression but significantly reduced the forskolin stimulation of the CRH promoter. The data suggest that the high expression of SRC1a in the PVN is likely to be involved in the GR-mediated repression of the CRH gene. Moreover, the expression levels and the modulation of the activity of the coregulators may change the extent of both induction and repression of the CRH gene as well as other genes that are regulated by similar CREB- and GR-dependent mechanisms.

Recently, the coactivators SRC1 and SRC2 have been shown to act also as a corepressor of ligand-activated GR at certain GREs (25, 26), whereas the corepressor SMRT has been reported to be essential for full estrogen receptor (ER) activation (27). We have shown that the SRC1a splice variant also acted as a corepressor of ligand-activated GR on the CRH promoter. Although the mechanisms of repression remain unclear, an increasing amount of literature shows that nonreceptor factors such as coregulators determine not only the magnitude but also the nature of the transcriptional outcome.

So far, coregulator recruitment by ligand-activated GR has mainly been studied in the context of positively regulated genes. In that context, a differential potentiation of the ER- and GR-mediated transcription by the SRC1 isoforms was previously observed (14, 28). We now show that the splice variants also differentially affect the GR-mediated repression of the CRH reporter. The SRC1 splice variants are highly similar. They contain an identical centrally located nuclear receptor box with a triplet of {alpha}-helical LXXLL motifs for binding to the nuclear receptors, two activation domains, AD1 (interacts with CBP/p300) and AD2 (interacts with CARM1), and differ only in their C-terminal sequences. The C-terminal part of SRC1a contains an additional LXXLL motif, which was found to exhibit a strong interaction with the ligand-binding domain of the GR in a yeast two-hybrid system (29). Additionally, it also has been shown to possess a repression domain in the context of ER- and GR-mediated gene transactivation on a simple reporter (14, 28). Therefore, the differences in transrepression may be caused either by differential recruitment of SRC1a and SRC1e to the DNA-bound GR and/or by the SRC1a-specific C-terminal repression domain.

It is still a topic of debate whether the GR-mediated repression on the CRH promoter occurs via the CRE and/or CRE-related proteins (e.g. CBP), via cross-talk with activator protein 1 or by direct binding of the GR to a putative nGRE in the promoter region (17, 21, 23, 30). In the neuronal BE(2)C cell line, point mutation and deletion of the putative nGRE did not affect DEX-induced repression (30). However, Dorin and colleagues (21) convincingly showed that the putative nGRE in the AtT-20 cell line is necessary for GR-mediated repression of the CRH promoter. Additionally, an argument against interaction of GR with the CREB signaling pathway (on or off the DNA) is our observation that forskolin stimulation of a simple reporter containing 5xCRE was not affected by DEX cotreatment in the same cells (Fig. 6Go). Furthermore, taking into consideration the sequential and combinatorial assembly of protein complexes at the promoter by DNA-bound steroid receptors (31, 32), the effects of SRC1a suggests that the binding of GR to the response element of the CRH gene is necessary. We propose that the GR-mediated repression of the CRH gene expression is promoter specific and cannot be explained by squelching of rate-limiting factors such as CBP or CRE-related proteins.

Both CRH and proopiomelanocortin (POMC) genes can be directly repressed by GR and are part of the negative feedback regulation of glucocorticoids on HPA axis activity. Interestingly, the 5'-flanking region of both CRH and the POMC genes contain a putative nGRE (21, 33). Winnay et al. (34) reported that, as opposed to the situation in wild-type mice, DEX was ineffective in suppressing pituitary POMC mRNA levels in the SRC1 knockout mice. This indicates that SRC1 expression is necessary for adequate GR-mediated repression of the POMC gene. These observations suggest that the glucocorticoid repression of HPA axis activity at the level of both the hypothalamic CRH- and pituitary POMC-expressing cells is dependent on SRC1a recruitment by the GR at a nGRE.

The corepressors N-CoR and SMRT are ubiquitously expressed in brain and show moderate differences in expression in the PVN (13). Previously, Szapary et al. (11) established a model based on the observations that coactivators and corepressors have opposing effects on the dose-response curve of agonist-bound GR-regulated gene expression. The model describes that the GR dose-response curve can be modified by coactivators and corepressors in a gene- and promoter-independent fashion. Surprisingly, our data showed no effect of the corepressors N-CoR and SMRT on the GR-mediated repression of the CRH gene. We find that coactivators and corepressors did not mediate opposing effects on a negatively regulated gene, indicating a clear promoter-dependent effect of coactivators and corepressors. It is likely that the binding of the agonist-activated GR to the nGRE induces conformational changes that disfavor corepressor recruitment.

Although N-CoR and SMRT did not affect the GR-mediated repression, they both repressed CREB-mediated induction of the CRH gene. This is in line with the observation that N-CoR can directly modulate the activity of the cointegrator CBP by binding to the same complexes (35). Interestingly, although N-CoR and SMRT can associate with distinct corepressor complexes, overexpression resulted in a very similar inhibition of CREB-mediated transcription (36). We examined promoter-specific effects of the corepressors and tested overexpression of N-CoR and SMRT on CREB-mediated transcription on the CRH-luc reporter and a simple 5xCRE-containing reporter. Both corepressors dose-dependently suppressed the CREB-mediated transcription, clearly indicating that the effects are mediated through a similar mechanism (Fig. 5Go).

Taken together, coregulators may play different roles in the control of hypothalamic CRH expression. The brainstem catecholaminergic system projects to the PVN and releases norepinephrine that binds to the G protein-coupled {alpha}1 adrenergic receptors and activates CREB-mediated gene expression. Additionally, glutamatergic and GABAergic interneurons also regulate the activity of the PVN and in turn expression of CRH (37, 38, 39, 40, 41). The fact that N-CoR and SMRT are expressed in the PVN, and our present finding that they inhibit the CREB-mediated transcription of the CRH gene, indicate that the corepressor activity may in part determine CRH gene expression. In addition, Shepard et al. (42) recently provided evidence for the role of the CRE modulator (CREM) and inducible cAMP early repressor (ICER) in limiting the CRH surge in the context of restraint stress. Thus, repression of the CRH gene expression after stress is likely to involve a set of different mechanisms. We provide evidence that coregulator proteins have specific roles in both induction and repression of CRH gene expression.

Paradoxically, glucocorticoids repress CRH expression in the PVN but stimulate expression in the CeA (5). The current data are based on overexpression of coregulators; the exact ratio of receptor to coregulators is difficult to ascertain. However, the data provide evidence that SRC1a, highly abundant in the PVN, increases both potency and efficacy of the GR-mediated repression of forskolin-induced CRH expression. In addition, SRC1e, which was previously found to be relatively abundant in the CeA (12), significantly reduced the CORT-dependent repression (see Table 1Go). Moreover, SRC1e tended to increase forskolin-induced CREB-driven transcription of the CRH gene (Fig. 3CGo). These observations are in line with the site-specific effects of glucocorticoids on CRH gene expression previously described in vivo. In view of the chromatin-modifying properties of the coregulators, more functional studies in stably transfected AtT-20 cells and chromatin immunoprecipitation assays would provide valuable insights on their role in the regulation of CRH expression.

In conclusion, we have shown that 1) the availability and the type of ligand, 2) the expression level of the receptor in the cells, and 3) the coregulator recruited are three determinants of glucocorticoid signaling. More specifically, the coactivator SRC1a increased GR-mediated repression, whereas the corepressors N-CoR and SMRT were found to inhibit CREB-dependent induction of the CRH gene.


    Acknowledgments
 
We thank Drs. Nicole Datson and Thomas Dijkmans for critical review of the manuscript.


    Footnotes
 
This study was supported by NWO VIDI Grant 016.036.381 (O.C.M.) and the Royal Netherlands Academy for Arts and Sciences (E.R.d.K.).

Disclosure Statement: The authors have nothing to disclose.

First Published Online November 15, 2007

Abbreviations: CeA, Central nucleus of the amygdala; CBP, CREB-binding protein; CORT, corticosterone; CRE, cAMP-responsive element; CREB, CRE-binding protein; DEX, dexamethasone; ER, estrogen receptor; GR, glucocorticoid receptor; HPA, hypothalamus-pituitary-adrenal; N-CoR, nuclear corepressor; nGRE, negative glucocorticoid-responsive element; POMC, proopiomelanocortin; PVN, paraventricular nucleus of the hypothalamus; siRNA, small interference RNA; SMRT, silencing mediator of the retinoid and thyroid hormone receptor; SRC, steroid receptor coactivator.

Received September 6, 2007.

Accepted for publication November 8, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Schulkin J, Gold PW, Mcewen BS 1998 Induction of corticotropin-releasing hormone gene expression by glucocorticoids: implication for understanding the states of fear and anxiety and allostatic load. Psychoneuroendocrinology 23:219–243[CrossRef][Medline]
  2. Suda T, Tomori N, Tozawa F, Mouri T, Demura H, Shizume K 1984 Distribution and characterization of immunoreactive corticotropin-releasing factor in human tissues. J Clin Endocrinal Metab 59:861–866[Abstract/Free Full Text]
  3. Thompson RC, Seasholtz AF, Herbert E 1987 Rat corticotropin-releasing hormone gene: sequence and tissue-specific expression. Mol Endocrinol 1:363–370[Abstract/Free Full Text]
  4. de Kloet ER, Joels M, Holsboer F 2005 Stress and the brain: from adaptation to disease. Nat Rev Neurosci 6:463–475[CrossRef][Medline]
  5. Makino S, Gold PW, Schulkin J 1994 Corticosterone effects on corticotropin-releasing hormone messenger RNA in the central nucleus of the amygdala and the parvocellular region of the paraventricular nucleus of the hypothalamus. Brain Res 640:105–112[CrossRef][Medline]
  6. Grenier J, Trousson A, Chauchereau A, Cartaud J, Schumacher M, Massaad C 2006 Differential recruitment of p160 coactivators by glucocorticoid receptor between Schwann cells and astrocytes. Mol Endocrinol 20:254–267[Abstract/Free Full Text]
  7. Fonte C, Grenier J, Trousson A, Chauchereau A, Lahuna O, Baulieu EE, Schumacher M, Massaad C 2005 Involvement of β-catenin and unusual behavior of CBP and p300 in glucocorticosteroid signaling in Schwann cells. Proc Natl Acad Sci USA 102:14260–14265[Abstract/Free Full Text]
  8. Rosenfeld MG, Lunyak VV, Glass CK 2006 Sensors and signals: a coactivator/corepressor/epigenetic code for integrating signal-dependent programs of transcriptionaf response. Genes Dev 20:1405–1428[Abstract/Free Full Text]
  9. Lonard DM, O’Malley BW 2006 The expanding cosmos of nuclear receptor coactivators. Cell 125:411–414[CrossRef][Medline]
  10. Privalsky ML 2004 The role of corepressors in transcriptional regulation by nuclear hormone receptors. Annu Rev Physiol 66:315–360[CrossRef][Medline]
  11. Szapary D, Huang Y, Simons SS 1999 Opposing effects of corepressor and coactivators in determining the dose-response curve of agonists, and residual agonist activity of antagonists, for glucocorticoid receptor-regulated gene expression. Mol Endocrinol 13:2108–2121[Abstract/Free Full Text]
  12. Meijer OC, Steenbergen PJ, de Kloet ER 2000 Differential expression and regional distribution of steroid receptor coactivators SRC-1 and SRC-2 in brain and pituitary. Endocrinology 141:2192–2199[Abstract/Free Full Text]
  13. van der Laan S, Lachize SB, Schouten TG, Vreugdenhil E, de Kloet ER, Meijer OC 2005 Neuroanatomical distribution and colocalisation of nuclear receptor corepressor (N-CoR) and silencing mediator of retinoid and thyroid receptors (SMRT) in rat brain. Brain Res 1059:113–121[CrossRef][Medline]
  14. Meijer OC, Kalkhoven E, van der Laan S, Steenbergen PJ, Houtman SH, Dijkmans TF, Pearce D, de Kloet ER 2005 Steroid receptor coactivator-1 splice variants differentially affect corticosteroid receptor signaling. Endocrinology 146:1438–1448[Abstract/Free Full Text]
  15. Wang DQ, Simons SS 2005 Corepressor binding to progesterone and glucocorticoid receptors involves the activation function-1 domain and is inhibited by molybdate. Mol Endocrinol 19:1483–1500[Abstract/Free Full Text]
  16. Meijer OC, van der Laan S, Lachize S, Steenbergen PJ, de Kloet ER 2006 Steroid receptor coregulator diversity: what can it mean for the stressed brain? Neuroscience 138:891–899[CrossRef][Medline]
  17. Malkoski SP, Dorin RI 1999 Composite glucocorticoid regulation at a functionally defined negative glucocorticoid response element of the human corticotropin-releasing hormone gene. Mol Endocrinol 13:1629–1644[Abstract/Free Full Text]
  18. Pearce D, Yamamoto KR 1993 Mineralocorticoid and glucocorticoid receptor activities distinguished by nonreceptor factors at a composite response element. Science 259:1161–1165[Abstract/Free Full Text]
  19. Delghandi MP, Johannessen M, Moens U 2005 The cAMP signalling pathway activates CREB through PKA, p38 and MSK1 in NIH 3T3 cells. Cell Signal 17:1343–1351[CrossRef][Medline]
  20. Schaaf MJM, Cidlowski JA 2003 Molecular determinants of glucocorticoid receptor mobility in living cells: the importance of ligand affinity. Mol Cell Biol 23:1922–1934[Abstract/Free Full Text]
  21. Malkoski SP, Handanos CM, Dorin RI 1997 Localization of a negative glucocorticoid response element of the human corticotropin releasing hormone gene. Mol Cell Endocrinol 127:189–199[CrossRef][Medline]
  22. King BR, Smith R, Nicholson RC 2002 Novel glucocorticoid and cAMP interactions on the CRH gene promoter. Mol Cell Endocrinol 194:19–28[CrossRef][Medline]
  23. GuardiolaDiaz HM, Kolinske JS, Gates LH, Seasholtz AF 1996 Negative glucocorticoid regulation of cyclic adenosine 3',5'-monophosphate-stimulated corticotropin-releasing hormone-reporter expression in AtT-20 cells. Mol Endocrinol 10:317–329[Abstract/Free Full Text]
  24. Wang D, Wang Q, Awasthi S, Simons SS 2007 Amino-terminal domain of TIF2 is involved in competing for corepressor binding to glucocorticoid and progesterone receptors. Biochemistry 46:8036–8049[CrossRef][Medline]
  25. Li GY, Heaton JH, Gelehrter TD 2006 Role of steroid receptor coactivators in glucocorticoid and transforming growth factor β regulation of plasminogen activator inhibitor gene expression. Mol Endocrinol 20:1025–1034[Abstract/Free Full Text]
  26. Rogatsky I, Luecke HF, Leitman DC, Yamamoto KR 2002 Alternate surfaces of transcriptional coregulator GRIP1 function in different glucocorticoid receptor activation and repression contexts. Proc Natl Acad Sci USA 99:16701–16706[Abstract/Free Full Text]
  27. Peterson TJ, Karmakar S, Pace MC, Gao T, Smith CL 2007 The silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) corepressor is required for full estrogen receptor {alpha} transcriptional activity. Mol Cell Biol 27:5933–5948[Abstract/Free Full Text]
  28. Kalkhoven E, Valentine JE, Heery DM, Parker MG 1998 Isoforms of steroid receptor co-activator 1 differ in their ability to potentiate transcription by the oestrogen receptor. EMBO J 17:232–243[CrossRef][Medline]
  29. Needham M, Raines S, McPheat J, Stacey C, Ellston J, Hoare S, Parker M 2000 Differential interaction of steroid hormone receptors with LXXLL motifs in SRC-1a depends on residues flanking the motif. J Steroid Biochem Mol Biol 72:35–46[CrossRef][Medline]
  30. Yamamori E, Iwasaki Y, Taguchi T, Nishiyama M, Yoshida M, Asai M, Oiso Y, Itoi K, Kambayashi M, Hashimoto K 2007 Molecular mechanisms for corticotropin-releasing hormone gene repression by glucocorticoid in BE(2)C neuronal cell line. Mol Cell Endocrinol 264:142–148[CrossRef][Medline]
  31. Metivier R, Penot G, Hubner MR, Reid G, Brand H, Kos M, Gannon F 2003 Estrogen receptor-{alpha} directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115:751–763[CrossRef][Medline]
  32. Liu Z, Wong JM, Tsai SY, Tsai MJ, O’Malley BW 2001 Sequential recruitment of steroid receptor coactivator-1 (SRC-1) and p300 enhances progesterone receptor-dependent initiation and reinitiation of transcription from chromatin. Proc Natl Acad Sci USA 98:12426–12431[Abstract/Free Full Text]
  33. Drouin J, Trifiro MA, Plante RK, Nemer M, Eriksson P, Wrange O 1989 Glucocorticoid receptor binding to a specific DNA sequence is required for hormone-dependent repression of pro-opiomelanocortin gene transcription. Mol Cell Biol 9:5305–5314[Abstract/Free Full Text]
  34. Winnay JN, Xu JM, O’Malley BW, Hammer GD 2006 Steroid receptor coactivator-1-deficient mice exhibit altered hypothalamic-pituitary-adrenal axis function. Endocrinology 147:1322–1332[Abstract/Free Full Text]
  35. Cowger JJM, Torchia J 2006 Direct association between the CREB-binding protein (CBP) and nuclear receptor corepressor (N-CoR). Biochemistry 45:13150–13162[CrossRef][Medline]
  36. Lavinsky RM, Jepsen K, Heinzel T, Torchia J, Mullen TM, Schiff R, Del Rio AL, Ricote M, Ngo S, Gemsch J, Hilsenbeck SG, Osborne CK, Glass CK, Rosenfeld MG, Rose DW 1998 Diverse signaling pathways modulate nuclear receptor recruitment of N-CoR and SMRT complexes. Proc Natl Acad Sci USA 95:2920–2925[Abstract/Free Full Text]
  37. Cole RAL, Sawchenko PE 2002 Neurotransmitter regulation of cellular activation and neuropeptide gene expression in the paraventricular nucleus of the hypothalamus. J Neurosci 22:959–969[Abstract/Free Full Text]
  38. Han F, Ozawa H, Matsuda KI, Lu H, de Kloet ER, Kawata M 2007 Changes in the expression of corticotrophin-releasing hormone, mineralocorticoid receptor and glucocorticoid receptor mRNAs in the hypothalamic paraventricular nucleus induced by fornix transection and adrenalectomy. J Neuroendocrinol 19:229–238[CrossRef][Medline]
  39. Itoi K, Horiba N, Tozawa F, Sakai Y, Sakai K, Abe K, Demura H, Suda T 1996 Major role of 3',5'-cyclic adenosine monophosphate-dependent protein kinase A pathway in corticotropin-releasing factor gene expression in the rat hypothalamus in vivo. Endocrinology 137:2389–2396[Abstract]
  40. Itoi K, Helmreich DL, Lopez-Figueroa MO, Watson SJ 1999 Differential regulation of corticotropin-releasing hormone and vasopressin gene transcription in the hypothalamus by norepinephrine. J Neurosci 19:5464–5472[Abstract/Free Full Text]
  41. Bali B, Kovacs KJ 2003 GABAergic control of neuropeptide gene expression in parvocellular neurons of the hypothalamic paraventricular nucleus. Eur J Neurosci 18:1518–1526[CrossRef][Medline]
  42. Shepard JD, Liu Y, Sassone-Corsi P, Aguilera G 2005 Role of glucocorticoids and cAMP-mediated repression in limiting corticotropin-releasing hormone transcription during stress. J Neurosci 25:4073–4081[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Lachize, E. M. Apostolakis, S. van der Laan, A. M. I. Tijssen, J. Xu, E. R. de Kloet, and O. C. Meijer
Steroid receptor coactivator-1 is necessary for regulation of corticotropin-releasing hormone by chronic stress and glucocorticoids
PNAS, May 12, 2009; 106(19): 8038 - 8042.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Vreugdenhil, C. S. L. Verissimo, R. Mariman, J. T. Kamphorst, J. S. Barbosa, T. Zweers, D. L. Champagne, T. Schouten, O. C. Meijer, E. Ron de Kloet, et al.
MicroRNA 18 and 124a Down-Regulate the Glucocorticoid Receptor: Implications for Glucocorticoid Responsiveness in the Brain
Endocrinology, May 1, 2009; 150(5): 2220 - 2228.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. M. Keenan, S. Alexander, C. Irvine, and J. D. Veldhuis
Quantifying Nonlinear Interactions within the Hypothalamo-Pituitary-Adrenal Axis in the Conscious Horse
Endocrinology, April 1, 2009; 150(4): 1941 - 1951.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van der Laan, S.
Right arrow Articles by Meijer, O. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van der Laan, S.
Right arrow Articles by Meijer, O. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals