help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2007-0968
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dov, A.
Right arrow Articles by Nesher, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dov, A.
Right arrow Articles by Nesher, R.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Diabetes
Hazardous Substances DB
*GLUCOSE
Endocrinology Vol. 149, No. 2 741-748
Copyright © 2008 by The Endocrine Society

Diminished Phosphodiesterase-8B Potentiates Biphasic Insulin Response to Glucose

Avital Dov, Eva Abramovitch, Nasim Warwar and Rafael Nesher

Endocrinology and Metabolism Service, Department of Medicine, Hadassah, the Hebrew University Medical Center, 91120 Jerusalem, Israel

Address all correspondence and requests for reprints to: Dr. R. Nesher, Endocrinology and Metabolism Service, Department of Medicine, Hadassah, the Hebrew University Medical Center, P.O. Box 12000, 91120 Jerusalem, Israel. E-mail: rafael.nesher{at}huji.ac.il.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
cAMP activates multiple signal pathways, crucial for the pancreatic β-cells function and survival and is a major potentiator of insulin release. A family of phosphodiesterases (PDEs) terminate the cAMP signals. We examined the expression of PDEs in rat β-cells and their role in the regulation of insulin response. Using RT-PCR and Western blot analyses, we identified PDE3A, PDE3B, PDE4B, PDE4D, and PDE8B in rat islets and in INS-1E cells and several possible splice variants of these PDEs. Specific depletion of PDE3A with small interfering (si) RNA (siPDE3A) led to a small (67%) increase in the insulin response to glucose in INS-1E cells but not rat islets. siPDE3A had no effect on the glucagon-like peptide-1 (10 nmol/liter) potentiated insulin response in rat islets. Depletion in PDE8B levels in rat islets using similar technology (siPDE8B) increased insulin response to glucose by 70%, the potentiation being of similar magnitude during the first and second phase insulin release. The siPDE8B-potentiated insulin response was further increased by 23% when glucagon-like peptide-1 was included during the glucose stimulus. In conclusion, PDE8B is expressed in a small number of tissues unrelated to glucose or fat metabolism. We propose that PDE8B, an 3-isobutyl-1-methylxanthine-insensitive cAMP-specific phosphodiesterase, could prove a novel target for enhanced insulin response, affecting a specific pool of cAMP involved in the control of insulin granule trafficking and exocytosis. Finally, we discuss evidence for functional compartmentation of cAMP in pancreatic β-cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GLUCOSE METABOLISM IS the primary initiator of secretory processes in pancreatic β-cells and controls multiple key functions including cellular ion levels, protein synthesis (in particular insulin) and processing, granular trafficking and exocytosis, the activity of numerous genes, cell division and apoptosis, etc. (for review see Refs. 1 ,2). These cellular functions are mediated by a host of signal pathways downstream to glucose metabolism; each must be independently regulated to coordinate optimal β-cell function. cAMP is an important signal messenger in pancreatic β-cells and is the strongest potentiator of insulin secretion (3, 4). Glucose stimulus leads to a small increase in cAMP, the latter plays a critical role in the glucose competence of the secretory mechanism of the pancreatic β-cell (5, 6, 7, 8, 9, 10). Several neuronal and hormonal stimuli affect cAMP levels, via G protein-mediated activation of at least six isoforms of adenylate cyclase (4, 11). Until the mid-1990s, it was believed that all cAMP effects are mediated by the activation of a number of isoforms of protein kinase A (PKA), although not all cAMP effects could be blocked by inhibitors of PKA. The different combinations of three isoforms of the catalytic subunit with four isoforms of the regulatory subunit could be one way to account for the versatility of cAMP actions (12); a large number of PKA anchoring proteins targeting the kinase to the selected effector could be another way (13). In 1998, with the identification of a family of cAMP binding proteins that directly activate Rap1 (a member of the Ras superfamily oncogenes, a guanine nucleotide binding protein), Kawasaki et al. (14) discovered new, PKA-independent pathways that transduce cAMP signals. Four years later, Kashima et al. (15) reported the role of cAMP-GEFII (guanine nucleotide exchange factors-II) Rim2 (a target of the small G protein Rab3 that mediates cAMP-dependent, PKA-independent exocytosis in a reconstituted system), also known as Epac2 (exchange protein activated by cAMP-2), in the control of insulin secretion, thus introducing new pathways for cAMP-dependent regulatory signals.

At present, the multiplicity of cAMP actions in pancreatic β-cells still raises the question of by which mechanisms the independent coordination is achieved. Indeed, the cellular localization, timing, and duration of each of these signals must be independently controlled. cAMP-dependent phosphodiesterase (PDE) is the only known degrading enzyme that hydrolyzes the nucleotide to its inactive 5'-AMP form and hence switches off its signal (4). The PDE superfamily is functionally and structurally grouped into 21 gene-families that contain more than 50 splice variant isoenzymes, several of which use cyclic GMP as substrate, whereas a number are less cyclic nucleotide specific, adapted to hydrolyze both cAMP as well as cyclic GMP (16). The fact that some PDE isoforms were reported to be associated with a specific cell compartment (17) makes them more attractive as possible regulators of specific cAMP functions. Indeed, PDE3B, the isoenzyme long considered the primary phosphodiesterase involved in the exocytotic process in pancreatic β-cells, was recently shown to function primarily in the most distal steps the granule fusion (18), an observation that raised the possibility that other cAMP activities may be controlled by additional, undefined PDE isoforms. Finally, the fact that an increasing number of soluble, family-selective inhibitors of PDE have been recently reported, may make one or more PDE isoenzyme an attractive drug target for enhanced insulin response in type 2 diabetes mellitus.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Male Wistar rats weighing 175–250 g were anesthetized by ip injection of 100 mg/kg thiopentone sodium. Pancreata were removed and islets isolated as previously described (19) using 2.5 mg Collagenase P (Roche, Roche Molecular Biochemicals, Mannheim, Germany) per pancreas. Animal use was with full adherence to Institutional Ethical Committee Guidelines of the Hebrew University.

Cultures
INS-1E β-cells were generously provided by Dr. Pierre Maechler (University Medical Center, Geneva, Switzerland) and were grown as specified in (20). Freshly isolated islets were cultured in RPMI 1640 medium supplemented with 10% fetal calf serum, 10 mmol/liter HEPES, 100 U/ml penicillin, and 100 mg/ml streptomycin (Biological Industries, Bet Haemek, Israel).

PDE mRNA expression
Islet or β-cell RNA was extracted with Trizol (Invitrogen, Carlsbad, CA) and washed with chloroform on ice. After 15 min centrifugation at 12,000 rpm, 4 C, the top layer was washed with 0.5 ml ice-cold isopropanol for 10 min and centrifuged as before for 10 min, and the pellet was washed again with cold 75% ethanol, spun at 4700 rpm for 5 min and suspended in RNase-free water. RNA concentration was determined by NanoDrop (NanoDrop Technologies, Wilmington, DE) and its integrity assessed on 1% SeaKem LE agarose (BioScience, Rockland, ME) and ethidium bromide (Continental Lab Products, San Diego, CA,) under UV light. Five hundred nanograms RNA were used to produce cDNA in a reaction containing 40 U Rnasin, 200 U reverse transcription enzyme, and 1 mmol/liter deoxynucleotide triphosphates (all from Promega, Madison, WI), and 50 µl Rnase-free water. PDE primer sequences were either obtained from published literature or from National Center for Biotechnology Information (NCBI; Bethesda, MD) GenBank using Emboss Eprimer3 (Whitehead Institute, Cambridge, MA). Cyclophilin was used as reference gene product. Table 1Go lists primer sequences used to identify PDE expression in this study. For RT-PCR, 0.025 U/µl Taq polymerase (Applied Biosystems, Foster City, CA,) and 15 pmol primer in a final volume of 20 µl were used. The mix was preheated for 5 min at 94 C and then underwent 40 cycles of 45 sec at 94 C followed by 1 min at 53–59 C according to the primer’s melting temperature and 1 min at 72 C, followed by an additional 5 min at 72 C using a thermal cycler PCR machine (T3 Thermocycler; Biometra, Biomedizinische Analytik, Goettingen, Germany).


View this table:
[in this window]
[in a new window]

 
TABLE 1. Primer sequences used to identify the expression of rat pancreatic β-cell PDE gene products

 
For real-time PCR (ABI Prism 7000; Applied Biosystems), Syber Green PCR master mix was used with 8 pmol of the following primers: for cyclophilin, the control gene, the sense sequence was TGAATATCTGAAGCACAATGTTCGA; the antisense sequence was TGCTTGCCATAGGTGATGAAGA. For PDE3A, we used TGAGACCAACAACAACAGTGA for sense and GAGTATAGGTGCCACAAGCC for antisense. The amplification program included 10 min of hot strat at 95 C, followed by 40 cycles of 15 sec at 95 C and 1 min at 60 C.

Protein blots and PDE imaging
Where quality antibodies were available, the expression of PDE isoenzyme was confirmed by Western blot. Isolated islets or INS-1E cells were homogenized in 24 mg/ml sucrose, 10 mmol/liter HEPES, 1.0 ml protease inhibitor set (Roche Diagnostics, Mannheim, Germany). Protein concentration was determined using a protein assay (Bio-Rad, Munich, Germany) on the postnuclear fraction (3200 rpm, 10 min, Beckman JA-5) and mixed with 2x Laemmli sample buffer. After a brief heating (2 min, 98 C), samples were run on 7% SDS-PAGE, blotted onto nitrocellulose filters, imaged with horseradish peroxidase-conjugated antirabbit IgG (H+L) (Promega), and developed with EZ-ECL (Biological Industries). The PDE isoenzymes were blotted using the following antisera: polyclonal PDE3A and PDE8B antibodies were from FabGennix (Frisco TX); polyclonal PDE3B antibody was a gift from Dr. Vincent Maganiello (National Institutes of Health, Bethesda, MD); polyclonal PDE4B antibody was from Santa Cruz Biotechnologies (Santa Cruz, CA); and monoclonal PDE4D antibody was from ICOS Corp. (Bothell, WA).

Small interfering RNA (siRNA) constructs and transfection
Most recent sequence entries of the NCBI GenBank were used to design 21 oligomer (mer) or 27 mer double-stranded siRNA nucleotide constructs. For PDE3A we used: (sense) GCCUAGGUGGCGCGACAUGGCUGdGdT; (antisense) ACCAGCCAUGUCGCGCCACCUAGGCAG. For PDE8B we used: (sense) GCCAUAGAAAUAACAAGUGAUGAdCdC; (antisense) GGUCAUCACUUGUUAUUUCUAUGGCUU. Lipofectamine 2000 was used as vehicle for transfection, following the protocol recommended by Invitrogen. Reagent ratios were precalibrated by transfecting INS-1E cells with fluorescent, scrambled 21 mer construct (siGLO RISC-Free; Dharmacon, Lafayette, CO) and assessment by fluorescence-activated cell sorter (FACSCalibur; Becton Dickinson, Franklin Lakes, NJ). Scrambled negative control siRNA was from Integrated DNA Technologies (Coralville, IA). The transfection efficiency routinely exceeded 90%. The same conditions were then used for isolated islets, and homogeneity and penetration were evaluated by sequential confocal microscopic imaging at 5 µm z-plane sections.

Insulin secretion studies
One to 2 million INS-1E cells per well were grown in 6-well plates (BD Falcon, Franklin Lakes, NJ) as described (20). Cells were replated 24 h before transfection in antibiotic-free medium and the medium exchanged with the regular growth medium 6 h after transfection. Insulin response to stimuli was studied 3 d after transfection using HEPES (10 mmol/liter)-Krebs-Ringer bicarbonate buffer, pregassed with O2/CO2 (95%/5%) (pH 7.4) and supplemented with 0.5% BSA (Fraction V; Sigma-Aldrich, Rehovot, Israel). Basal buffer for INS-1E cells contained 1.0 mmol/liter glucose, and 7.0 mmol/liter glucose were used for stimulation. Experiments were performed in a 37 C incubator supplemented with 5% CO2 and usually extended for 60 min. Medium was carefully aspirated for determination of rat insulin (Linco Research, St. Louis, MO), and cells were lifted with trypsin (Biological Industries) for counting or for DNA determination (Sigma-Aldrich).

Freshly isolated islets were washed with Hanks’ buffer and then with sterile RPMI 1640 medium, transfected, and cultured as INS-1E cells. Perifusion studies were done on d 3 or 4 after transfection, using 50 islets placed in a 25-mm Swinnex chamber (Millipore Corp., Billerica, MA) at a rate of 1.0 ml/min, in a 37 C bath, under continuous O2/CO2 (95%/5%) bubbling. Perifusion medium contained HEPES (10 mmol/liter)-Krebs-Ringer bicarbonate buffer (pH 7.4) and supplemented with 0.5% BSA and 2.5 mmol/liter glucose. After 60 min preequilibration, two samples were collected at 5-min intervals and then every minute during glucose stimulus (16.7 mmol/liter) for the first 20 min, followed by collection every 5 min for additional 35 min and then every minute for the rest of the experiment. Insulin was determined using rat RIA kit (Linco Research Laboratories); mean interassay coefficient of variation was 4.5%. Insulin release was expressed as fold basal release rate (see Figs. 4Go and 5Go) or as net area under the curve during the first phase (initial 10 min) and second phase (subsequent 50 min) of stimulation with 16.7 mmol/liter glucose (Table 2Go).


Figure 4
View larger version (21K):
[in this window]
[in a new window]

 
FIG. 4. Insulin response to glucose was enhanced in islets transfected with siPDE8B but not PDE3A. The dynamics of first- and second-phase insulin response to 16.7 mmol/liter glucose was potentiated by 2-fold in isolated perifused rat islets 3–5 d after transfection with siPDE8B (n = 8) but not siPDE3A (n = 6). Control islets were transfected with scrambled 21 mer siRNA.

 

Figure 5
View larger version (29K):
[in this window]
[in a new window]

 
FIG. 5. GLP-1 potentiated the insulin response to glucose in isolated rat islets but not the effects of siPDE3A (A; n = 9) or siPDE8B (B; n = 8). GLP-1 (10 nmol/liter) was added to the perifusion medium together with the stimulating concentrations (16.7 mmol/liter) of glucose. Control islets were transfected with scrambled 21 mer siRNA.

 

View this table:
[in this window]
[in a new window]

 
TABLE 2. Phasic insulin response to glucose in combination with GLP-1 and diminished PDE levels in perifused rat islets

 
Statistical analysis
Data from cultured INS1-E cells was analyzed by paired, two-tailed Student’s t test; phasic insulin response was analyzed using ANOVA and Tukey-Kramer multiple comparisons test. Confidence level was set at 95%.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PDE families expression in rat pancreatic β-cells
To identify the PDE isoenzymes expressed in rat pancreatic β-cells, we designed primers based on most recent data reported in the NCBI GenBank (Table 1Go), selecting sequences that cover all presently known splice variances. Using two or more different primers, we identified the expression of 11 PDE isoenzymes in INS-1E cells, only six of which were also expressed in Wistar rat islets (Fig. 1Go). Using similar amount of cDNA from both preparations, we identified strong mRNA signals for PDE3B, PDE4D, and PDE8B in rat islets as well as INS-1E cells. Weaker signals were detected in rat islets for PDE3A and PDE4B, whereas the corresponding mRNA expression in INS-1E cells was rather strong. Of even greater contrast was the expression of PDE4A mRNA: using similar amounts of cDNA and 40 cycles for both preparations, in rat islets the expression of this isoform was very weak, whereas in INS-1E cells, the signal was quite pronounced. We were unable to detect mRNA or observed an extremely weak signal for PDE1B, PDE2A, PDE5A, PDE8A, or PDE9A in rat islets, whereas INS-1E cells displayed a clear expression of these isoenzymes. No mRNA was detected in either preparation for PDE1A, PDE1C, PDE7B, PDE10A, and PDE11A (Fig. 1Go).


Figure 1
View larger version (41K):
[in this window]
[in a new window]

 
FIG. 1. PDE isoenzymes expressed in rat pancreatic β-cells. A, PDE mRNA from isolated rat islets and INS-1E cells as determined by RT-PCR blot. Two or three different sets of primers were used for conserved regions of all splice variants of each gene product. B, PDE proteins as determined by Western blot on 7% SDS-PAGE. Shown are examples from four studies.

 
Identification of PDE proteins is considerably more difficult and limited by the availability of high-quality antibodies. Using the antisera we consider as of adequate quality, Fig. 1BGo lists the expression of PDE isoenzymes and splice variants identified by Western blot, based on conserved antigenic motifs. With consideration for these limitations and using similar concentrations of protein (40 µg/lane), we observed four bands of PDE3A in INS-1E cells, at approximately 60, 80, 120, and 140 kDa, whereas in rat islets, only the two lower-molecular-weight isoforms of PDE3A were observed. Using polyclonal antibodies (kindly provided by Dr. Vincent Maganiello, NIH), we observed only one protein band at approximately 135 kDa of the cyclic GMP-inhibitable PDE3B in both INS-1E cells and rat islets. Four clear bands of PDE4B were observed in INS-1E cells, at approximately 66, 78, 90, and 105 kDa, with the 90-kDa band being the predominant band. Similar quantity of rat islets protein (100 µg/lane) displayed only two of these PDE4B isoforms: the 90- and 66-kDa isoenzymes. Three variants of PDE8B were observed in INS-1E cells, producing heavy bands in 7% SDS-PAGE at approximately 68, 80-, and 85 kDa, whereas in rat islets, four such bands were observed; the additional clear band showing at approximately 64 kDa. Whereas it is impossible to completely rule out that the low-molecular-weight band consists of breakdown products of the larger proteins, the stringent extraction conditions, and the reproducibility of the bands’ sizes suggests the presence of an additional PDE8B isoenzyme.

Role of PDE3A and PDE8B in insulin secretion
The multiplicity of PDE isoenzyme expression in β-cells prompted us to use siRNA methodology to define the specific contribution of PDE3A and PDE8B, two isoenzymes previously not explored for their role in the cAMP-potentiated insulin response. Figure 2AGo shows the efficiency of siPDE3A, a 27-mer siRNA, in diminishing PDE3A mRNA levels as determined by real-time PCR 48 h after transfection of INS-1E cells. Routinely, we observed 75–90% decline in mRNA levels in INS-1E cells transfected with 100 nmol/liter of siPDE3A. Figure 2BGo shows a corresponding small increase (67%) in insulin response to glucose stimulus in these cells 3 d after transfection with siPDE3A.


Figure 2
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 2. Diminished PDE3A levels enhance insulin response in INS-1E cells. A, PDE3A mRNA levels were diminished by 78% 2 d after transfection with siPDE3A, an RNAi duplex designed to identify the conserved region of the PDE3A subfamily (n = 4, P = 0.029). B, Insulin response to glucose (fold = 7.0 vs. 1 mmol/liter) was increased by 67% in cells transfected with siPDE3A (n = 5, P = 0.0079).

 
Figure 3AGo shows the efficiency of siPDE8B, a 27-mer siRNA, in diminishing PDE8B protein levels as determined by Western blot analysis 72 h after transfection of INS-1E cells. When normalized for glyceraldehyde-3-phosphate dehydrogenase levels as a reference housekeeping enzyme, a 40% decline was observed in the 80/85-kDa isoenzyme and 50% decline was detected in the 68-kDa isoenzyme (Fig. 3BGo, n = 3). siPDE8B increased the insulin response of the INS-1E cells to glucose by more than 2-fold (Fig. 3CGo). We next examined the effects of the diminished PDE3A and PDE8B levels on the dynamics of insulin response to glucose in isolated rat islets (Fig. 4Go and Table 2Go). Transfection with siPDE3A, which resulted in a small effect on glucose-induced insulin response in INS-1E cells, resulted in a small decrease in insulin response to glucose (16.7 mmol/liter) in perifused rat islets: the first-phase insulin response was 45% lower and the second-phase insulin response was 33% lower; both phases were significantly lower as compared with rates observed in islets transfected with inactive siRNA (srmb-siRNA) (Table 2Go). On the other hand, transfection with siPDE8B resulted in 70% increase in both phases of insulin response to glucose (Fig. 4Go and Table 2Go). Islets insulin contents was not affected by the procedure: 3 d after transfection, nontransfected control islets contained 11.4 ± 1.8 ng insulin/islet; islets transfected with scrambled siRNA duplex contained 10.3 ± 1.3 ng insulin/islet; islets transfected with siR-PDE8B contained 9.5 ± 0.4 ng insulin/islet (n = 8, eight and seven studies, respectively). Rates of basal insulin release were also unaffected by transfection with siRNA: 3 d after transfection, these rates were 0.26 ± 0.06 ng per 50 islets · min in nontransfected islets, (n = 14); 0.30 ± 0.07 ng per 50 islets · min in islets transfected with scrambled siRNA (n = 11); 0.27 ± 0.09 ng per 50 islets · min in islets transfected with siR-PDE8B (n = 16); 0.29 ± 0.04 ng per 50 islets · min in islets transfected with siR-PDE3A (n = 15).


Figure 3
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 3. Diminished PDE8B levels enhance insulin response in INS-1E cells. A, All protein bands detected by anti-PDE8B were diminished 3 d after transfection with siPDE8B, an RNAi duplex designed to identify the conserved region of the PDE8B subfamily. For quantifying PDE8B levels, short SDS-PAGE was used for Western blot. B, Densitometric evaluation of the two major protein bands of A, expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as reference (n = 3). C, Insulin response to glucose (fold = 7.0 vs. 1 mmol/liter) was increased by more than 2-fold in cells transfected with siPDE8B (n = 4, P = 0.006).

 
Do either PDE3A or PDE8B affect insulin response to glucagon-like peptide (GLP-1)? Application of 10 nmol/liter GLP-1 to perifused rat islets subjected to glucose (16.7 mmol/liter) stimulus increased both phases of insulin response significantly (Fig. 5Go and Table 2Go); first phase increased by 77–82% and second phase by 32–48%. However, application of GLP-1 to islets previously transfected with siPDE3A failed to further stimulate the insulin response above that of the incretin alone (Fig. 5AGo and Table 2Go). Similarly, whereas prior transfection with siPDE8B dramatically increased the insulin response to glucose alone (Figs. 4Go and 5BGo and Table 2Go), application of GLP-1 to islets transfected with siPDE8B had no further effect (Fig. 5BGo and Table 2Go).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The cAMP signal pathways can be considered the second most important pathways affecting the pancreatic β-cell’s phenotype, second only to glucose metabolism. In these cells, cAMP is generated by at least six different adenylate cyclase isoenzymes, localized at different cellular compartments (4, 11) and involved in the regulation of a diverse spectrum of β-cell functions, including replication, apoptosis (21, 22, 23), and the cooperative control of numerous genes (e.g. Refs. 24, 25, 26, 27). In this study, our focus was cAMP’s role in the control of insulin secretion. The potentiating effect of cAMP on insulin secretion has been known, and was of major interest, since 1973 (5, 6, 7, 8, 9, 10). cAMP rapidly initiates downstream signal pathways, and isoenzymes of the PDE gene family are the primary means the cell uses to terminate these signals. Pharmacological targeting of the cAMP pathway(s) potentiating insulin production or release, is a difficult undertaking, mostly because of the diversity of the nucleotide’s actions in pancreatic β-cells, albeit nearly all being beneficial for the cell’s function (3, 4). Isoform-selective activators of adenylate cyclase isoenzymes are not available as yet, and nonselective activators, such as forskolin, are clearly of major risk for the organism. On the other hand, the concept of potentiation of insulin production and release is of major clinical interest and therefore prompted flourishing research over the ability of the incretin GLP-1, or its analogs, to amplify the insulin response of the diabetic pancreas via the cAMP pathways (e.g. Refs. 28, 29, 30, 31, 32, 33). However, whereas the GLP-1 is already at the stage of clinical evaluation in several centers, its inherited drawback would still be the need to inject the therapeutic peptide.

Attempting to identify all PDE isoforms expressed in rat pancreatic β-cells, in this study we used primers for RT-PCR, using family-conserved sequences. We clearly identified the expression of five PDE isoenzymes in rat islets: PDE3A, PDE3B, PDE4B, PDE4D, and PDE8B. INS-1E cells expressed similar isoenzymes with the addition of six others: PDE1B, PDE2A, PDE4A, PDE5A, PDE8A, and PDE 9A. This was unexpected because INS-1E is a homogeneous rat β-cell preparation (13), whereas isolated rat islets contain numerous non-β-cells. We must therefore conclude that the process of transformation of these cells induced the expression of a number of otherwise silent genes. This observation should stand as a precaution against attempts for unwarranted physiological conclusions in studies using exclusively cell lines.

To date, only PDE3B has been seriously explored as a potential target for enhanced cAMP-induced insulin release (18, 34, 35). However, its wide expression, and its extrapancreatic role in glucose and lipid metabolism, inevitably makes this isoenzyme unattractive for pharmacological manipulation (4). PDE3A was strongly expressed in INS-1E cells and somewhat weaker in rat islets and was selected as the second isoenzyme for reference. PDE4B and PDE4D were also observed and their function should also be explored. Han et al. (36) used pharmacological manipulation to conclude that the calcium/calmodulin PDE1C was involved glucose mediated insulin response in a mouse cell line. Using three different primer sets, we were unable to trace PDE1C in rat islets or rat cell line. This difference in expression may be attributed to species differences and/or the process of transformation involved in immortalizing the βTc cells as was observed in INS-1E cells (see above). Importantly, the PDE8 gene family is known to be expressed only in limited number of tissues (37, 38, 39, 40, 41) and therefore was selected for this study. In this study, we chose to use siRNA technology to diminish the enzyme’s activity for its unquestionable specificity and selectivity, as compares with pharmacological approaches, which often require cross-confirmation by another inhibitory method. Importantly, partial diminution of PDE8B levels led to a dramatic potentiation of insulin response to glucose in the perifused rat islets preparation. The enhancement was similar during both first- and second-phase insulin response, which suggests that it affects a pool of cAMP involved in recruitment and trafficking of insulin granules and not merely a pool that potentiates the first phase of insulin release (18).

Data in this study suggest that PDE3A plays no significant role in the glucose-mediated insulin response as well as in the GLP-1-potentiated insulin response in the perifused rat islets. On the other hand, partially diminished activity of PDE8B (30–50%), resulted in dramatic potentiation of insulin response to glucose, well above that was observed in response to 10 nmol/liter GLP-1. The fact that the two effects were not additive in their potentiation of the dynamics of insulin response to glucose may suggests the involvement of one common pool of cAMP, which enhances the trafficking and exocytosis of insulin granules. Also, whereas GLP-1’s primary effect in pancreatic β-cells is mediated via the cAMP signal pathways, this incretin is known to initiate additional cAMP-independent pathways (42). One possible implication of this study is that the cAMP pools of pancreatic β-cells are functionally compartmentalized in relationship to exocytosis and affected by two phosphodiesterase isoforms (PDE8B and PDE3B) and not by others. This is consistent with multiple, unrelated functions of cAMP (21, 22, 23, 24, 25, 26, 27), compartmented adenylate cyclase isoenzymes (4, 11, 43, 44), and compartmented PKA subunits and their A kinase anchoring proteins (45, 46, 47) as well as compartmented PDEs (4, 18).

Data on PDE8B are limited; even more so is the role of this isoenzyme in pancreatic β-cells. As an 3-isobutyl-1-methylxanthine-insensitive enzyme (33), PDE8B could account for the approximately 10% remaining islet PDE activity after the addition of maximal concentration of that nonselective PDE inhibitor (4). Using polyclonal antibodies (FabGennix) and stringent protease-inhibitory conditions, we routinely identified four bands of protein in SDS-PAGE, at approximately 85, 80, 68, and 64 kDa. Using several primer sets designed for different regions of the enzyme, Kobayashi et al. (38) reported only one mRNA signal in rat brain, corresponding to a 760-amino acid protein. In contrast, the human PDE8B gene expresses at least three splice variants in different tissues, encoding for proteins of 885, 838, and 788 amino acids (37). Despite the stringent conditions used in this study, we cannot rule out that one or more of the 80-, 68-, or 64-kDa peptide bands were degradative products of the 760-amino acid PDE8B. On the other hand, to date, of the 21 PDE gene families, more than 50 splice variant enzyme products were described. The different isoenzymes show unique tissue expression, subcellular localization, alternative enzymatic regulation, or unique protein-protein interaction. Thus, the possibility that pancreatic β-cells express new PDE8B splice variants could be an interesting objective for investigation, especially because one or more of these isoforms may prove to be a highly selective target for enhancement of the normal dynamics of insulin response to glucose.

Integrating our data of multiple cAMP-PDE isoenzymes in pancreatic β-cells with different functions, with data from other laboratories demonstrating multiple cAMP functions, as well as multiple subunits or isofrms of adenylate cyclase, PKA, and Epacs, the conclusion should be that cAMP is functionally compartmentalized in β-cells, each pool independently regulated by one or more PDE isoenzymes. Therefore, selective inhibition of a specific PDE isoenzyme may prove a useful approach to target a specific function mediated by β-cell cAMP.


    Footnotes
 
This work was supported by D-Cure, Diabetes Care in Israel, and the Russell Berrie Foundation. The authors are grateful to Erol Cerasi for his critical review.

Presented at the Annual Meeting of the Israel Diabetes Association, Airport City, Israel, May 5, 2007.

Disclosure Statement: The authors have nothing to disclose.

First Published Online November 8, 2007

Abbreviations: GLP 1, Glucagon-like peptide; mer, oligomer; PDE, phosphodiesterase; PKA, protein kinase A; siRNA, small interfering RNA.

Received July 16, 2007.

Accepted for publication November 1, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Deeney JT, Prentki M, Corkey BE 2000 Metabolic control of β-cell function. Semin Cell Dev Biol 11:267–275[CrossRef][Medline]
  2. Rutter GA 2001 Nutrient-secretion coupling in the pancreatic islet β-cell: recent advances. Mol Aspects Med 22:247–284[CrossRef][Medline]
  3. Furman B, Pyne N 2006 Modulation of cyclic nucleotides and cyclic nucleotide phosphodiesterases in pancreatic islet β-cells and intestinal L-cells as targets for treating diabetes mellitus. Curr Opin Investig Drugs 7:898–905[Medline]
  4. Furman B, Pyne N, Flatt P, O’Harte F 2004 Targeting β-cell cyclic 3'5' adenosine monophosphate for the development of novel drugs for treating type 2 diabetes mellitus. A review. J Pharm Pharmacol 56:1477–1492[CrossRef][Medline]
  5. Grill V, Cerasi E 1973 Activation by glucose of adenyl cyclase in pancreatic islets of the rat. FEBS Lett 33:311–314[CrossRef][Medline]
  6. Grill V, Cerasi E 1974 Stimulation by D-glucose of cyclic adenosine 3':5'-monophosphate accumulation and insulin release in isolated pancreatic islets of the rat. J Biol Chem 249:4196–4201[Abstract/Free Full Text]
  7. Nesher R, Abramovitch E, Cerasi E 1989 Reduced early and late phase insulin response to glucose in isolated spiny mouse (Acomys cahirinus) islets: a defective link between glycolysis and adenylate cyclase. Diabetologia 32:644–648[Medline]
  8. Hatakeyama H, Kishimoto T, Nemoto T, Kasai H, Takahashi N 2006 Rapid glucose sensing by protein kinase A for insulin exocytosis in mouse pancreatic islets. J Physiol 570:271–282[Abstract/Free Full Text]
  9. Salehi A, Qader SS, Ekblad E, Ekelund M 2004 Defective insulin secretion during total parenteral nutrition in rat and its normalization by pituitary adenylate cyclase-activating polypeptide 27. Regul Pept 119:83–91[CrossRef][Medline]
  10. Serre V, Dolci W, Schaerer E, Scrocchi L, Drucker D, Efrat S, Thorens B 1998 Exendin-(9–39) is an inverse agonist of the murine glucagon-like peptide-1 receptor: implications for basal intracellular cyclic adenosine 3',5'-monophosphate levels and β-cell glucose competence. Endocrinology 139:4448–4454[Abstract/Free Full Text]
  11. Leech CA, Castonguay MA, Habener JF 1999 Expression of adenylyl cyclase subtypes in pancreatic β-cells. Biochem Biophys Rese Commun 254:703–706[CrossRef]
  12. Gao Z, Young RA, Trucco MM, Greene SR, Hewlett EL, Matschinsky FM, Wolf BA 2002 Protein kinase A translocation and insulin secretion in pancreatic β-cells: studies with adenylate cyclase toxin from Bordetella pertussis. Biochem J 368:397–404[CrossRef][Medline]
  13. Beene DL, Scott JD 2007 A-kinase anchoring proteins take shape. Curr Opin Cell Biol 19:192–198[CrossRef][Medline]
  14. Kawasaki H, Springett GM, Mochizuki N, Toki S, Nakaya M, Matsuda M, Housman DE, Graybiel AM 1998 A family of cAMP-binding proteins that directly activate Rap1. Science 282:2275–2279[Abstract/Free Full Text]
  15. Kashima Y, Miki T, Shibasaki T, Ozaki N, Miyazaki M, Yano H, Seino S 2001 Critical role of cAMP-GEFII-Rim2 complex in incretin-potentiated insulin secretion. J Biol Chem 276:46046–46053[Abstract/Free Full Text]
  16. Omori K, Kotera J 2007 Overview of PDEs and their regulation. Circ Res 100:309–327[Abstract/Free Full Text]
  17. Mehats C, Andersen CB, Filopanti M, Jin SL, Conti M 2002 Cyclic nucleotide phosphodiesterases and their role in endocrine cell signaling. Trends Endocrinol Metab 13:29–35[CrossRef][Medline]
  18. Walz HA, Wierup N, Vikman J, Manganiello VC, Degerman E, Eliasson L, Holst LS 2007 β-Cell PDE3B regulates Ca(2+)-stimulated exocytosis of insulin. Cell Signal 19:1505–1513[CrossRef][Medline]
  19. Gadot M, Leibowitz G, Shafrir E, Cerasi E, Gross DJ, Kaiser N 1994 Hyperproinsulinemia and insulin deficiency in the diabetic Psammomas obesus. Endocrinology 135:610–616[Abstract]
  20. Merglen A, Theander S, Rubi B, Chaffard G, Wollheim CB, Maechler P 2004 Glucose sensitivity and metabolism-secretion coupling studied during two-year continuous culture in INS-1E insulinoma cells. Endocrinology 145:667–678[Abstract/Free Full Text]
  21. Costes S, Longuet C, Broca C, Faruque O, Hani EH, Bataille D, Dalle S 2004 Cooperative effects between protein kinase A and p44/p42 mitogen-activated protein kinase to promote cAMP-responsive element binding protein activation after β cell stimulation by glucose and its alteration due to glucotoxicity. Ann NY Acad Sci 1030:230–242[CrossRef][Medline]
  22. Granata R, Settanni F, Biancone L, Trovato L, Nano R, Bertuzzi F, Destefanis S, Annunziata M, Martinetti M, Catapano F, Ghe C, Isgaard J, Papotti M, Ghigo E, Muccioli G 2007 Acylated and unacylated ghrelin promote proliferation and inhibit apoptosis of pancreatic β-cells and human islets: involvement of 3',5'-cyclic adenosine monophosphate/protein kinase A, extracellular signal-regulated kinase 1/2, and phosphatidyl inositol 3-kinase/Akt signaling. Endocrinology 148:512–529[Abstract/Free Full Text]
  23. Koh G, Suh KS, Chon S, Oh S, Woo JT, Kim SW, Kim JW, Kim YS 2005 Elevated cAMP level attenuates 2-deoxy-d-ribose-induced oxidative damage in pancreatic β-cells. Arch Biochem Biophys 438:70–79[CrossRef][Medline]
  24. Ding WQ, Dong M, Ninova D, Holicky EL, Stegall MD, Miller LJ 2003 Forskolin suppresses insulin gene transcription in islet β-cells through a protein kinase A-independent pathway. Cell Signal 15:27–35[CrossRef][Medline]
  25. Lawrence MC, Bhatt HS, Easom RA 2002 NFAT regulates insulin gene promoter activity in response to synergistic pathways induced by glucose and glucagon-like peptide-1. Diabetes 51:691–698[Abstract/Free Full Text]
  26. Schofl C, Waring M, Bergwitz C, Arseniev L, von zur Muhlen A, Brabant G 2002 Cyclic-adenosine 3',5'-monophosphate-stimulated c-fos gene transcription involves distinct calcium pathways in single β-cells. Mol Cell Endocrinol 186:121–131[CrossRef][Medline]
  27. Wang R, Li J, Rosenberg L 2001 Factors mediating the transdifferentiation of islets of Langerhans to duct epithelial-like structures. J Endocrinol 171:309–318[Abstract]
  28. Arulmozhi DK, Portha B 2006 GLP-1 based therapy for type 2 diabetes. Eur J Pharm Sci 28:96–108[CrossRef][Medline]
  29. Briones M, Bajaj M 2006 Exenatide: a GLP-1 receptor agonist as novel therapy for type 2 diabetes mellitus. Expert Opin Pharmacother 7:1055–1064[CrossRef][Medline]
  30. Choukem SP, Gautier JF 2006 How do different GLP-1 mimetics differ in their actions? Curr Diab Rep 6:365–372[CrossRef][Medline]
  31. Combettes MM 2006 GLP-1 and type 2 diabetes: physiology and new clinical advances. Curr Opin Pharmacol 6:598–605[CrossRef][Medline]
  32. Levy JC 2006 Therapeutic intervention in the GLP-1 pathway in type 2 diabetes. Diabet Med 23(Suppl 1):14–19
  33. Vilsboll T 2007 Liraglutide: a once-daily GLP-1 analogue for the treatment of type 2 diabetes mellitus. Expert Opin Investig Drugs 16:231–237[CrossRef][Medline]
  34. Harndahl L, Wierup N, Enerback S, Mulder H, Manganiello VC, Sundler F, Degerman E, Ahren B, Holst LS 2004 β-Cell-targeted overexpression of phosphodiesterase 3B in mice causes impaired insulin secretion, glucose intolerance, and deranged islet morphology. J Biol Chem 279:15214–15222[Abstract/Free Full Text]
  35. Walz HA, Harndahl L, Wierup N, Zmuda-Trzebiatowska E, Svennelid F, Manganiello VC, Ploug T, Sundler F, Degerman E, Ahren B, Holst LS 2006 Early and rapid development of insulin resistance, islet dysfunction and glucose intolerance after high-fat feeding in mice overexpressing phosphodiesterase 3B. J Endocrinol 189:629–641[Abstract/Free Full Text]
  36. Han P, Werber J, Surana M, Fleischer N, Michaeli T 1999 The calcium/calmodulin-dependent phosphodiesterase PDE1C down-regulates glucose-induced insulin secretion. J Biol Chem 274:22337–22344[Abstract/Free Full Text]
  37. Hayashi M, Matsushima K, Ohashi H, Tsunoda H, Murase S, Kawarada Y, Tanaka T 1998 Molecular cloning and characterization of human PDE8B, a novel thyroid-specific isozyme of 3',5'-cyclic nucleotide phosphodiesterase. Biochem Biophys Res Commun 250:751–756[CrossRef][Medline]
  38. Kobayashi T, Gamanuma M, Sasaki T, Yamashita Y, Yuasa K, Kotera J, Omori K 2003 Molecular comparison of rat cyclic nucleotide phosphodiesterase 8 family: unique expression of PDE8B in rat brain. Gene 319:21–31[CrossRef][Medline]
  39. Soderling SH, Bayuga SJ, Beavo JA 1998 Cloning and characterization of a cAMP-specific cyclic nucleotide phosphodiesterase. Proc Natl Acad Sci USA 95:8991–8996[Abstract/Free Full Text]
  40. Soderling SH, Bayuga SJ, Beavo JA 1998 Identification and characterization of a novel family of cyclic nucleotide phosphodiesterases. J Biol Chem 273:15553–15558[Abstract/Free Full Text]
  41. Vasta V, Shimizu-Albergine M, Beavo JA 2006 Modulation of Leydig cell function by cyclic nucleotide phosphodiesterase 8A. Proc Natl Acad Sci USA 103:19925–19930[Abstract/Free Full Text]
  42. Li L, El-Kholy W, Rhodes CJ, Brubaker PL 2005 Glucagon-like peptide-1 protects beta cells from cytokine-induced apoptosis and necrosis: role of protein kinase B. Diabetologia 48:1339–1349[CrossRef][Medline]
  43. Cooper DM 2005 Compartmentalization of adenylate cyclase and cAMP signalling. Biochem Soc Trans 33:1319–1322[CrossRef][Medline]
  44. Tian Y, Laychock SG 2001 Protein kinase C and calcium regulation of adenylyl cyclase in isolated rat pancreatic islets. Diabetes 50:2505–2513[Abstract/Free Full Text]
  45. Doyle ME, Egan JM 2003 Pharmacological agents that directly modulate insulin secretion. Pharmacol Rev 55:105–131[Abstract/Free Full Text]
  46. McConnachie G, Langeberg LK, Scott JD 2006 AKAP signaling complexes: getting to the heart of the matter. Trends Mol Med 12:317–323[CrossRef][Medline]
  47. Wong W, Scott JD 2004 AKAP signalling complexes: focal points in space and time. Nature Rev 5:959–970[CrossRef]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dov, A.
Right arrow Articles by Nesher, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dov, A.
Right arrow Articles by Nesher, R.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Diabetes
Hazardous Substances DB
*GLUCOSE


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals