help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2007-0657
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by De Alvaro, C.
Right arrow Articles by Lorenzo, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by De Alvaro, C.
Right arrow Articles by Lorenzo, M.
Endocrinology Vol. 149, No. 2 793-801
Copyright © 2008 by The Endocrine Society

Nuclear Exclusion of Forkhead Box O and Elk1 and Activation of Nuclear Factor-{kappa}B Are Required for C2C12-RasV12C40 Myoblast Differentiation

Cristina De Alvaro, Iria Nieto-Vazquez, Jose Maria Rojas and Margarita Lorenzo

Departamento de Bioquimica y Biologia Molecular II (C.D.A., I.N.-V., M.L.), Facultad de Farmacia, Universidad Complutense, 28040 Madrid, Spain; and Unidad de Biologia Celular (J.M.R.), Centro Nacional de Microbiologia, Instituto de Salud Carlos III, 28220 Majadahonda, Madrid, Spain

Address all correspondence and requests for reprints to: Margarita Lorenzo, Departamento de Bioquimica y Biologia Molecular II, Facultad de Farmacia, Universidad Complutense, 28040 Madrid, Spain. E-mail: mlorenzo{at}farm.ucm.es.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activating ras point mutations are frequently found in skeletal muscle tumors such as rhabdomyosarcomas. In this study we investigated the impact of two different H-ras mutants in skeletal muscle differentiation: RasV12, a constitutively active form, and RasV12C40, a mutant deficient in Raf1 activation. Stably transfected C2C12-RasV12 myoblasts actively proliferated as indicated by the sustained expression of proliferating cell nuclear antigen and retinoblastoma at the hyperphosphorylated state and failed to express differentiation markers. This differentiation-defective phenotype was a consequence of the chronic p44/p42MAPK phosphorylation and the inability of the cells to activate AKT. Moreover, we observed that p44/p42MAPK activation in C2C12-RasV12 myoblasts phosphorylated the ETS-like transcription factor (ELK) 1, which translocates to the nuclei and seemed to be involved in maintaining myoblast proliferation. C2C12-RasV12C40 myoblasts cultured in low serum repressed phosphorylation of p44/p42MAPK and ELK1, resulting in cell cycle arrest and myogenic differentiation. Under this condition, activation of AKT, p70S6K, and p38MAPK was produced, leading to formation of myotubes in 3 d, 1 d earlier than in control C2C12-AU5 cells. Moreover, the expression of muscle-specific proteins, mainly the terminal differentiation markers caveolin-3 and myosin heavy chain, also occurred 1 d earlier than in control cells. Furthermore, AKT activation produced phosphorylation of Forkhead box O that led to nuclear exclusion and inactivation, allowing myogenesis. In addition, we found an induction of nuclear factor-{kappa}B activity in the nucleus in C2C12-RasV12C40 myotubes attributed to p38MAPK activation. Accordingly, muscle differentiation is associated with a pattern of transcription factors that involves nuclear exclusion ELK1 and Forkhead box O and the increase in nuclear factor-{kappa}B DNA binding.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DIFFERENTIATION OF SKELETAL muscle is a precisely orchestrated process that involves three major steps: committed but proliferating myoblasts irreversibly exit from the cell cycle, subsequently acquire an apoptosis-resistant phenotype, and finally express muscle-specific genes and form multinucleated myotubes (1). Most murine skeletal muscle cell lines proliferate in high serum conditions, and postconfluent cells spontaneously differentiate after several days in low serum. This is due in part to the autocrine expression of IGF-II acting through the IGF-I receptor (2, 3). Moreover, myogenic differentiation can be accelerated by including insulin, IGF-I or IGF-II in the culture medium (4). Studies of signaling through insulin/IGF-I receptors have revealed two main pathways by which these signals might be transmitted: the phosphatidylinositol 3 kinase (PI3K) cascade and the Ras/Raf/p44/p42 MAPK cascade (5). PI3K is one of the primary signaling pathways leading to skeletal muscle differentiation, as demonstrated by pharmacological and genetic approaches (6). Downstream of PI3K, several Ser/Thr kinases including AKT, p70S6K, and p38MAPK are involved in the myogenic differentiation program (7, 8, 9). On the other hand, activation of the Ras/Raf/p44/p42MAPK cascade seems to be detrimental to the differentiation process (4). We previously outlined the signaling pathways that accompany the formation of myotubes in C2C12 cells after treatment with insulin: sequential activation of PI3K, AKT, p70S6K, and p38MAPK is parallel to the induction of muscle-specific proteins, with a concomitant inhibition of p44/p42MAPK and growth arrest (10, 11). In this regard, it has been shown that AKT activation inhibited the Raf/MAPK signaling pathway in differentiated myotubes but not in myoblasts (12).

Skeletal myogenesis involves the expression of muscle-specific transcription factors of the MyoD family and also early and terminal differentiation markers such as myogenin and myosin heavy chain (MHC) (1). Other non-tissue-specific transcription factors such as nuclear factor-{kappa}B (NF{kappa}B), ELK1, and Forkhead box O (FOXO) could also be involved in myogenic differentiation. The phosphorylation of these transcription factors by the kinases expressed along the differentiation process might control their nuclear location and their transcriptional activities. In this regard, translocation of NF{kappa}B to the nuclei seems to be dependent on p38MAPK activation and has been observed in skeletal muscle cells differentiated by IGF-II and insulin (9, 11, 13). However, other groups have reported that NF{kappa}B was involved in the inhibition of myogenesis in response to cyclic mechanical strain in C2C12 cells (14). Moreover, ELK1, a transcription factor that is phosphorylated by p42/p44MAPK, has been found to be inhibited in L6E9 myotubes (15, 16). The contribution of FOXO to myogenesis is the subject of controversy: a constitutively active FOXO1 mutant prevented differentiation induced by constitutively active AKT in C2C12 cells (17), but a similar mutant augmented myotube fusion in neonatal primary myoblasts (18).

Myoblast differentiation is inhibited by culturing myoblasts with fibroblast growth factor (FGF)-2 or TGFβ or by the expression of proteins encoded by a number of viral and cellular oncogenes (including Src, oncogenic Ras, viral proteins E1A, and SV40 T antigen) as well as the transcription factors Myc, Fos, and Jun. In this regard FGF2 repression of myogenic differentiation involves activation of p44/p42MAPK and lack of activation of AKT, and overexpression of Sprouty-2, a protein that inhibits p44/p42MAPK activation by FGF2, allows C2C12 cell myotube formation in the presence of this growth factor (19). Furthermore, it has been reported that ectopic expression of oncogenic N-ras and H-ras genes in myogenic cell lines prevented terminal differentiation by inhibiting the expression of MyoD1 gene and NF-{kappa}B (20, 21). In these cells activation of p44/p42MAPK seems to be necessary to achieve a transformed morphology (22). However, a constitutively active AKT construct induces differentiation in the presence of PD98059 in H-Ras transformed C2C12 myoblasts (23). Because up to 35% of rhabdomyosarcomas, the most common soft tissue sarcomas in children and adolescents, contain activating Ras point mutations, these proteins seem to play an important role in skeletal muscle tumors (24, 25). Various mutations in the ras genes family that affect to a different extent the activation of downstream effectors, including Raf1 kinase, PI3K, Ral-guanine-nucleotide dissociation stimulation factor, and Rac/Rho GTPases, have been identified (26).

Accordingly, we undertook the present study to investigate the impact of two different H-ras mutants, a constitutively active form (RasV12) and another mutant bearing a second mutation (RasV12C40) that compromise the interaction of Ras with Raf1 but not PI3K, in muscle differentiation. Stably transfected C2C12-RasV12 myoblasts display a differentiation-defective phenotype, whereas C2C12-RasV12C40 cells form myotubes and express myogenic markers. Nuclear exclusion of the transcription factors ELK1 and FOXO and induction of NF{kappa}B, dependent on p44/p42MAPK inhibition and AKT and p38MAPK activation, respectively, seem to be involved in C2C12-RasV12C40 myogenic differentiation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Serum and culture media were from Life Technologies, Inc. (Paisley, UK). Geneticin was purchased from Invitrogen (Carlsbad, CA). Insulin, epidermal growth factor (EGF), myelin basic protein (MBP), and anti-{alpha}-actin antibody were from Sigma Chemical Co. (St. Louis, MO). Antibodies against MyoD (sc-760), p38MAPK{alpha} (sc-535), inhibitory-{kappa}B (I{kappa}B)-β (sc-945), p21CIP (sc-397-G), myogenin (sc-576), glutathione-S-transferase (GST), MHC, and p38MAPKβ (sc-6187) were from Santa Cruz (Palo Alto, CA); against Rb from Pharmigen (Heidelberg, Germany); against caveolin-3 from Transduction Laboratories (Lexington, KY); against proliferating cell nuclear antigen (PCNA), HA and protein A-agarose from Roche Molecular Biochemicals (Mannheim, Germany); against AU5 from Berkeley Antibody Co. (Berkeley, CA); against phospho- and total p44/p42MAPK, p38MAPK, AKT, p70S6K, cAMP response element-binding protein (CREB), FOXO, and ELK1 from Cell Signaling (Beverly, MA); against p38MAPK{gamma} from Upstate Biotechnology (Lake Placid, NY). The NF{kappa}B antibody for supershift experiments was from Pharmacia oligonucleotide synthesizer (Piscataway, NJ). LY294002 and PD169316 were supplied by Calbiochem (San Diego, CA). Autoradiographic films, ({gamma}32P)ATP, and ({alpha}32P)dCTP were supplied by GE Healthcare (Rainham, UK). All other reagents used were of the purest grade available.

DNA constructs
The plasmids used for stable transfections were pCEFL-KZ-AU5, pCEFL-KZ-AU5-H-RasV12 (a full-length ras gene mutated in G12V residue of the GTPase activity leading to a hyperactive form, with the AUG tag), and pCEFL-KZ-AU5-H-RasV12C40 (a full-length ras gene mutated in G12V with a second dominant mutation T40C in the Ras effector domain, with the AUG tag) previously described (26). The construct used for transient transfections were Myr-EGFP-AKT-HA (the N-myristylated fusion protein of EGFP and mouse AKT1 with the HA tag) and the constitutive active GST-MKK6 construct cloned into pCEFL-KZ-HA and pCEFL-KZ-AU5, respectively, as previously described (23).

Cell line generation
Mouse C2C12 myoblasts (American Type Culture Collection, Manassas, VA) (27) were maintained in DMEM supplemented with 10% fetal serum (FS) and antibiotics, at 37 C and 5% CO2. C2C12 cells were stably transfected with 4 µg of the hyperactive form H-Ras-V12 or the effector dominant mutant H-Ras-V12C40 to generate the cell lines C2C12-RasV12 and C2C12-RasV12C40, respectively. The C2C12-AU5 cell line was the negative control from cells transfected with the empty vector. After transfection according to the calcium phosphate-mediated protocol (Stratagene, La Jolla, CA), cell lines were selected by geneticin (0.5 mg/ml) for 3 wk. Four clones were obtained from each construct for this procedure and then clones were analyzed for p21Ras and AU5 overexpression. Cells showed stable p21Ras expression after several passages. All cell lines were grown to confluence in 10% FS-DMEM before the differentiation protocol, which consisted of culturing cells in low serum medium, DMEM supplemented with 2% horse serum (HS) for up to 3 or 4 d. No significant phenotypic differences (detected by the ability or not to form myotubes) among the four clones were observed in any group of cell lines. Accordingly, a representative clone from each group, C2C12-RasV12, C2C12-RasV12C40, and C2C12-AU5, was used in this study, although a second clone for each construct was shown as supplementary material. In some experiments, cells were differentiated in the presence or absence of the inhibitors LY294002 and PD169316. In other experiments overnight serum-starved myoblasts were acutely stimulated with insulin or EGF for 10 min. Furthermore, C2C12 myoblasts were also submitted to transient transfection with constitutively active forms of either AKT (C2C12-Myr-AKT) or MKK6 (C2C12-GST-MKK6). These cells were differentiated in 2% HS-DMEM for 4 d in the absence or presence of inhibitors.

Immunoprecipitations and in vitro kinase assays
Cells were lysed as previously described and equal amounts of protein (1 mg) were immunoprecipitated at 4 C anti-p38MAPK{alpha} or anti-p38MAPKβ antibodies (23). Then the immune complexes were used for in vitro phosphorylation of MBP as described (28). Samples were resolved on a 12% SDS-PAGE, gels were fixed in 20% methanol-10% acetic acid, and the incorporation of (32P)-phosphate into protein was visualized by autoradiography and quantifies by scanning laser densitometry.

Western blot
Cellular proteins (30 µg) were submitted to SDS-PAGE, transferred to Immobilon membranes, and immunodetected as previously described (23). Briefly, membranes were blocked using 5% nonfat dried milk in 10 mM Tris-HCl and 150 mM NaCl (pH 7.5) and incubated overnight with several antibodies as indicated in each case in 0.05% Tween 20, 1% nonfat dried milk in the same buffer. Immunoreactive bands were visualized using the enhanced chemiluminescence (ECL-Plus) Western blot protocol from GE Healthcare. In experiments using x-ray films, different exposure times were used to ensure that bands were not saturated.

Extraction of cytosolic and nuclear proteins
Cytosolic and nuclear extracts were prepared as previously described (23). Briefly, cells were resuspended at 4 C in buffer A [10 mM HEPES-KOH (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol, 0.2 mM phenylmethylsulfonyl fluoride], allowed to swell on ice for 10 min, and then vortexed for 10 sec. Samples were centrifuged and the supernatant contained the cytosol fraction. The pellet was resuspended in cold buffer C [20 mM HEPES-KOH (pH 7.9), 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM dithiothreitol, 0.2 mM phenylmethylsulfonyl fluoride, and 0.75 µg/ml each of leupeptin and aprotinin] and incubated on ice 20 min for high salt extraction. Cellular debris was removed by centrifugation for 2 min at 4 C, and the supernatant contained the nuclear proteins. Both fractions were stored at –70 C until ready for use.

Gel shift assay
The gel mobility shift assay was performed essentially as previously described (23). The double-stranded oligonucleotide used as NF{kappa}B probe was composed of the sequence TGCTAGGGGGATTTTCCCTCTCTCTGT and was labeled by using Klenow polymerase and ({alpha}32P) dCTP. The binding reaction was performed at 4 C for 15 min in a buffer containing 0.5 ng doubled-stranded oligonucleotide probe, 2 µg of poly(dIdC), and 10 µg of protein in buffer C, supplemented with 35 mM MgCl2. For supershift and competition assays, nuclear extracts were previously incubated 15 min at 4 C with 1 µl of the corresponding antibodies or 100-fold excess of cold probe. DNA-protein complexes were resolved on a 6% SDS-PAGE. The gel was dried and exposed to film at –70 C as well as being quantified directly with a radioimaging device.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation and characterization of C2C12 myoblasts that overexpress H-ras mutants
Ras genes can negatively modulate myogenic differentiation. To investigate the contribution of ras genes to this process, we generated stable muscle cell lines that overexpress two different H-ras mutants: RasV12 in which the Gly in position 12 has been replaced by Val, which compromises the intrinsic GTPase activity of Ras maintaining Ras constitutively active in the Ras.GTP form and another mutant H-RasV12C40 with a second mutation at position 40 in which Tyr has been substituted by Cys. This mutation on the effector domain can compromise the interaction of Ras with downstream effectors such as Raf1 and Ras-guanine-nucleotide dissociation stimulation factor but not with PI3K, as indicated in experiments in COS cells (supplementary Fig. S1, published as supplemental data on The Endocrine Society’s Journals Online Web site at http://endo.endojournals.org) and as previously described (26). Mouse C2C12 myoblasts were stably transfected with H-RasV12 or H-RasV12C40 DNA constructs or with the empty vector to generate cell lines, as described in Materials and Methods. Four clones were obtained from each construct for this procedure, analyzed for p21Ras overexpression and AU5 epitope ectopic expression, and submitted to differentiation in 2% HS-DMEM for up to 4 d. No significant phenotypic differences (detected by the ability or not to form myotubes) among the four clones were observed in any group of cell lines. Accordingly, a representative clone from each group, named C2C12-RasV12 and C2C12-RasV12C40, was selected because they expressed similar levels of the AU5-Ras protein (Fig. 1AGo). A representative C2C12-AU5 cell line was the negative control from cells transfected with the empty vector. The complete study was performed with these three clones, although a complementary analysis was done with a second clone for each construct (supplementary Fig. S2, published as supplemental data on The Endocrine Society’s Journals Online Web site at http://endo.endojournals.org).


Figure 1
View larger version (27K):
[in this window]
[in a new window]

 
FIG. 1. Characterization of mouse C2C12 myoblasts that overexpress different H-ras mutants. A, Mouse C2C12 myoblasts were stably transfected with the hyperactive form H-RasV12 or the effector dominant mutant H-RasV12C40 to generate the cell lines C2C12-RasV12 and C2C12-RasV12C40, respectively. The C2C12-AU5 cell line was the negative control from cells transfected with the empty vector. Cell lines were selected by treatment with geneticin for several weeks. Representative clones obtained for this procedure were analyzed for p21Ras and AU5 expression by immunoblotting. B, Myoblasts from the clones described above cultured in 10% FS-DMEM were serum starved overnight and then incubated in the absence (C) or presence of 50 nM insulin (Ins) or 100 ng/ml EGF for 10 min. Cells were lysed and total protein was submitted to SDS-PAGE and immunodetected with antibodies against phospho- and total AKT and p44/p42MAPK. C, Histograms from densitometric analysis of EGF activation of AKT and p44/p42MAPK phosphorylation expressed as percentage of stimulation over C2C12 cells (100) are means ± SEM. Representative experiments of four are shown.

 
The capacity of C2C12-RasV12 and C2C12-RasV12C40 cells lines to phosphorylate and activate p44/p42MAPK and AKT in response to growth factors was studied in Fig. 1BGo. Overnight serum starved cells were stimulated for 10 min with either EGF or insulin, compared with C2C12-AU5 control cells. As expected, insulin produces the activation of AKT, whereas EGF failed to activate this enzyme in C2C12-AU5 cells. However, EGF was able to activate AKT in both H-Ras cell lines, although in a lower extent than insulin. Moreover, EGF increased p44/p42MAPK phosphorylation to a higher extent than insulin in the three lines studied, with more elevated activation of p44/p42MAPK in C2C12-RasV12 cells (Fig. 1BGo). These results indicate that although both mutants seem to activate AKT to a similar extent, H-RasV12 produced a higher activation of p44/p42MAPK in skeletal muscle cells on acute EGF stimulation (Fig. 1CGo).

Overexpression of H-RasV12C40 but not H-RasV12 induces formation of myotubes because it allows growth arrest
Mouse C2C12 cells can be induced to differentiate by the withdrawal of mitogens, such as serum. We compared the differentiation of C2C12-RasV12 and C2C12-RasV12C40 myoblasts with control C2C12-AU5 myoblasts by culturing cells in low serum (Fig. 2Go). The cell lines were grown to confluence in 10% FS-DMEM before the differentiation protocol that consisted of maintaining cells in 2% HS-DMEM for several days. The myogenic differentiation of C2C12 cells was observed morphologically under the microscope after 4 d of culture for the alignment, elongation, and fusion of mononucleated myoblasts into multinucleated myotubes, as shown in Fig. 2AGo. Moreover, C2C12-RasV12C40 myoblasts fully differentiated in low serum in a similar extent than control C2C12 cells, but myotubes were observed after 3 d in differentiation medium, 1 d earlier than in control cells. By contrast, C2C12-RasV12 cells failed to form myotubes either after 3 or 4 d in low serum.


Figure 2
View larger version (44K):
[in this window]
[in a new window]

 
FIG. 2. Overexpression of H-RasV12C40 but not H-RasV12 induces formation of myotubes because it allows growth arrest. Myoblasts from the cell lines C2C12-AU5, C2C12-RasV12, and C2C12-RasV12C40 were grown in 10% FS-DMEM until confluence and then were further cultured in 2% HS-DMEM for 3 or 4 d to induce differentiation, as indicated. A, Phase-contrast images of the cells after these treatments for detection of multinucleated myotubes. Magnification, x10. Representative experiments of four are shown. B, At different days of culture (0–4), cells were lysed and total protein submitted to SDS-PAGE and immunodetected with anti-MHC, -{alpha}-actin, -caveolin-3, -myogenin, -MyoD, -p21CIP, -PCNA, or -Rb antibodies. β-Actin expression was used for protein loading control. Results show representative blots of four. C, Graphs show densitometric analysis of MyoD, myogenin, p21CIP, and PCNA protein content after standardization using β-actin content. Values are means ± SEM, n = 4, and are expressed in arbitrary units.

 
Differentiation of skeletal muscle cells involves the sequential expression of muscle-specific proteins such as MyoD, myogenin, and MHC, respectively (1). In control C2C12 myoblasts, MyoD, myogenin, and {alpha}-actin, early differentiation markers, started to accumulate on the first day of differentiation (although maximal levels were reached on d 2–3). Caveolin-3 started to accumulate after 2 d in differentiation medium, and MHC expression was detectable at d 3 of differentiation (Fig. 2Go, B and C). Overexpression of RasV12C40 accelerated the differentiation program, and most of these proteins, including the terminal differentiation markers caveolin-3 and MHC, were detectable 1 d earlier than in the control cells. However, cells defective in phenotypic differentiation (C2C12-RasV12) did not express any of the skeletal muscle characteristic proteins after 3 or 4 d in low serum (Fig. 2Go, B and C). A similar behavior in myogenic differentiation than that found in Fig. 2Go was observed in a second clone for each construct (supplementary Fig. S2).

Myoblast differentiation requires growth arrest, so in parallel to the differentiation markers, we checked the expression of several genes controlling the cell cycle such as p21CIP, a cell cycle inhibitor; PCNA, an essential marker for DNA replication; and retinoblastoma (Rb), a tumor suppressor gene controlling the entrance to the cell cycle by its phosphorylation level (Fig. 2BGo). Proliferating C2C12 myoblasts expressed PCNA protein and Rb in the hyperphosphorylated state. Differentiation for 4 d in low serum produced sequential growth arrest with down-regulation of the expression of PCNA, up-regulation of the expression of p21CIP, and reduction of Rb phosphorylation (Fig. 2Go, B and C). This profile was detected 1 d earlier in differentiated C2C12-RasV12C40 cells. By contrast, C2C12-RasV12 myoblasts failed to produce growth arrest because they did not express p21CIP and maintained a high expression of PCNA and hyperphosphorylated Rb (Fig. 2Go, B and C). Again, a similar profile on expression of PCNA and p21CIP than that found in Fig. 2Go was observed in a second clone for each construct (supplementary Fig. S2).

Activation of AKT and p38MAPK and inhibition of p42/p44MAPK is an essential requirement for C2C12-RasV12C40 cell myogenic differentiation
Specific intracellular signaling pathways control the differentiation process. Accordingly, we studied the main signaling cascades in these cells. Phosphorylation of p44/p42MAPK decreases, whereas phosphorylation of AKT, p70S6K, and p38MAPK increases during differentiation of C2C12 cells maintained in low serum (Fig. 3AGo), in agreement with our previous observations (11). Both Ras-overexpressing cell lines showed constitutive phosphorylation of AKT, p70S6K, and p44/p42MAPK before differentiation. However, C2C12-RasV12C40 cells display a similar phosphorylation profile as C2C12 cells along the differentiation process, although these effects were detected 1 d earlier than in C2C12 cells. In an opposite manner, a sustained phosphorylation of p44/p42MAPK was detected in undifferentiated C2C12-RasV12 myoblasts, and phosphorylation of AKT and p38MAPK was hardly detectable. The changes observed in the amount of phospho-(AKT, p44/p42MAPK and p38MAPK{alpha}/β) in the three cell lines reflected changes in the kinase activities because the total protein levels of these kinases remained essentially unmodified through the days of differentiation (Fig. 3Go, A and B). An inverse activation of AKT and p38MAPK vs. p44/p42MAPK was also observed in a second clone for each construct (supplementary Fig. S2). However, the amount of the p38MAPK{gamma} isoform was increasing along the differentiation process in both C2C12-AU5 and C2C12-RasV12C40, whereas no changes were detected in C2C12-RasV12 myoblasts, which shows a differentiation-defective phenotype. Furthermore, the p38MAPK{alpha} isoform rather than the p38MAPKβ seems to be activated along the differentiation process in C2C12-RasV12C40 (Fig. 3CGo), as also observed in C2C12 cells (data not shown).


Figure 3
View larger version (40K):
[in this window]
[in a new window]

 
FIG. 3. Ectopic expression of H-RasV12C40 but not H-RasV12 produces activation of AKT and p38MAPK and inhibition of p44/p42MAPK. Myoblasts were cultured as described in Fig. 2Go. A, At different days of culture, cells were lysed and total protein submitted to SDS-PAGE and immunodetected with anti-phospho-AKT, -P70S6K, -p44/p42MAPK, or -p38MAPK antibodies and with total anti-AKT, -p44/p42MAPK, -p38MAPK{gamma},or -p38MAPK{alpha}/β antibodies. Results show representative blots of four. B, Graphs show densitometric analysis of phosphorylated vs. total AKT, p44/p42MAPK, and p38MAPK protein content after standardization using β-actin content. Values are means ± SEM, n = 4, and are expressed in arbitrary units. C, Myoblasts from C2C12-RasV12C40 cell line were collected at different days of culture in 2% HS-DMEM and cell lysates were immunoprecipitated (IP) with either anti-p38MAPK{alpha} or -β antibodies. Then p38MAPK activity was assayed in the resulting immune complexes for MBP phosphorylation and autoradiography. Histograms from the densitometric analysis of the autoradiograms represent phosphorylated MBP levels expressed as percentage over control (100) and are means ± SEM (n = 4).

 
We have shown above that the lack of inhibition of p44/p42MAPK in C2C12-RasV12 precludes differentiation, whereas the activation of both AKT and p38MAPK in C2C12-RasV12C40 allows myogenic differentiation. The contribution of these pathways to the differentiation process was tested by using chemical inhibitors; PI3K/AKT activation was inhibited with LY294002 (LY) (29) and the {alpha}- and β-isoforms of p38MAPK were inhibited with the pyridinyl imidazole compound PD169316 (PD*) (30). Myotubes formation in C2C12-RasV12C40 cells was completely impaired when cells were cultured for 3 d in 2% HS-DMEM in the presence of either LY or PD* (Fig. 4AGo) in a fashion similar to the negative effects produced by LY and PD* in C2C12-AU5 differentiation (data not shown). Furthermore, we transiently expressed active forms of AKT or p38MAPK in C2C12 myoblasts in the absence or presence of chemical inhibitors of the complementary pathway (Fig. 4Go, B–E). To activate AKT, a constitutively active AKT construct (Myr-AKT) was used, whereas to maintain activated p38MAPK, we used a constitutively active MKK6 construct. As a negative control of transfection, myoblasts were transiently transfected with the empty vector pCEFL-KZ-AU5, and these cells did not differentiate in low serum when the inhibitors were present (data not shown). C2C12-Myr-AKT myoblasts differentiated after 4 d in low serum as demonstrated phenotypically by the formation of myotubes and by the expression of caveolin-3 and myogenin (Fig. 4Go, B and D). Under these experimental conditions, both AKT and p38MAPK (monitored by phosphorylation of CREB) were active. However, cells expressing active AKT failed to differentiate in the presence of PD* (Fig. 4Go, B and D). On the other hand, C2C12-GST-MKK6 myoblast differentiation also required the activation of AKT because in the presence of LY, cells expressing active p38MAPK failed to differentiate (Fig. 4Go, C and E). These data indicate that the activation of both AKT and p38MAPK is an absolute requirement to reach a fully differentiated phenotype.


Figure 4
View larger version (65K):
[in this window]
[in a new window]

 
FIG. 4. Activation of AKT and p38MAPK are essential requirements for C2C12-RasV12C40 myoblast differentiation. A, C2C12-RasV12C40 myoblasts were differentiated for 3 d in 2% HS-DMEM in the absence or presence of 10 µM LY or 10 µM PD*. Phase-contrast images of the cells were used for detection of multinucleated myotubes. Magnification, x10. C2C12 myoblasts were transiently transfected with constitutively active forms of either AKT (C2C12-Myr-AKT) (B and D) or MKK6 (C2C12-GST-MKK6) (C and E). Cells were grown in 10% FS-DMEM until confluence and then further cultured for 4 d in DMEM supplemented with 2% HS to induce differentiation, in the absence or presence of LY or PD*. B and C, Phase-contrast images of the cells for detection of multinucleated myotubes. Magnification, x10. D and E, At the end of the culture time, cells were lysed and total protein was submitted to SDS-PAGE and immunodetected with antibodies against HA; GST; phospho-AKT, -CREB, and -p38MAPK; AKT; p38MAPK; myogenin; and caveolin-3. Representative experiments of four are shown in all the panels.

 
Nuclear exclusion of FOXO and ELK1 and activation of NF{kappa}B allow myogenic differentiation of C2C12-RasV140 myoblasts
Besides the muscle-specific transcription factors from the MyoD family, other non-tissue-specific transcription factors such as NF{kappa}B, FOXO, and ELK1 have recently been implicated in the myogenic process. These transcription factors can be modulated by the kinases expressed along the myogenic process, which control their nuclear location and transcriptional activities. In this regard, active AKT has been reported to translocate to the nucleus in which it can phosphorylate FOXO and produce nuclear exclusion (17). Active p44/p42MAPK also translocates to the nucleus in which it phosphorylates and activates ELK1 (15). We have previously proposed a p38MAPK/MAPKAPK-2 cascade that stimulates translocation of NF{kappa}B to the nucleus after I{kappa}B degradation (23). Accordingly, we determined the phosphorylation of FOXO and ELK1 as well as the degradation of I{kappa}B-β in C2C12-RasV12 and C2C12-RasV12C40 cells along the myogenic process, using C2C12-AU5 myoblasts as a control (Fig. 5AGo). Phosphorylation of FOXO was observed along the differentiation protocol in C2C12-RasV12C40 and in control cells together with an inhibition of the phosphorylation of ELK1. In parallel, Western blot analysis with an anti-I{kappa}B-β antibody showed that I{kappa}B-β was highly expressed in myoblasts, but the protein degraded after myotube formation in C2C12-RasV12C40 as well as control cells. An inverse behavior in the pattern of FOXO and ELK1 phosphorylation and in I{kappa}B-β degradation was observed in the cell line C2C12-RasV12 defective in differentiation (Fig. 5AGo). Moreover, phosphorylation of FOXO caused nuclear exclusion and cytoplasm localization, as detected in differentiated myoblasts from C2C12-RasV12C40 and control cell lines. However, FOXO was located in the nucleus mainly in a nonphosphorylated state in C2C12-RasV12 cells (Fig. 5BGo). In contrast, phosphorylation of ELK1, as detected in C2C12-RasV12 myoblasts, allows ELK1 detection in the nucleus, whereas differentiated myotubes maintained ELK1 at the cytoplasmic compartment (Fig. 5BGo). Finally, NF{kappa}B transcriptional activity was determined by EMSA in the three cell lines before and after a differentiation protocol in low serum (Fig. 5CGo). The nuclear extracts were tested in gel mobility shift assays using a consensus NF{kappa}B site oligonucleotide as a probe. C2C12-RasV12C40 cells after 3 d of differentiation in low serum showed a dramatic induction of NF{kappa}B DNA binding activity (p50/p65 complexes), in a similar fashion as detected in C2C12 myotubes (Fig. 5CGo). By contrast, C2C12-RasV12 myoblasts with a defective phenotype on differentiation did not show NF{kappa}B DNA binding activity.


Figure 5
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 5. Myogenesis involves the inactivation of FOXO and ELK1 transcription factors and the induction of NF{kappa}B DNA binding in C2C12 muscle cells. Myoblasts were cultured as described in Fig. 2Go. A, At different days of culture, cells were lysed and total protein was submitted to SDS-PAGE and analyzed by immunoblotting with antibodies against phospho-FOXO, phospho-ELK1, and I{kappa}B-β. β-Actin expression was used for protein loading control. B, At different days of culture, cells were collected and subjected to cytosol and nuclear fractionation. Cytosolic and nuclear extracts were prepared and proteins submitted to Western blot with anti-phospho-FOXO, anti-FOXO, and anti-ELK1 antibodies. C, Nuclear extracts were incubated for 20 min with 32P-labeled double-strand oligonucleotide corresponding to NF{kappa}B consensus sequence. The mixture was then electrophoresed through a 6% (wt/vol) polyacrylamide gel. Representative experiments of four are shown in A–C.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Members of the Ras family of proteins that are constitutively activated by point mutations play a major role in the onset of a large number of human cancers, including those originating from skeletal muscle tissue. Rhabdomyosarcomas are the most common soft tissue sarcomas in children and adolescents, as recently reviewed (31). These skeletal muscle tumors secrete IGFs, FGF-2, EGF, and TGF{alpha} and are incapable of differentiation because they do not withdraw from the cell cycle (32). Frequently these tumors contain activating Ras point mutations, suggesting a significant involvement of Ras in rhabdomyosarcomas (24, 25). However, other Ras isoforms, such as R-Ras, resulted in positive regulation of skeletal myogenesis (33). In the present study, we investigated the impact of two different H-Ras mutants, RasV12 and RasV12C40, in C2C12 myoblast differentiation, characterizing the signaling pathways and the transcription factors modulated by these mutants.

C2C12 or COS cells bearing H-RasV12 and H-RasV12C40 constructs activated AKT to a similar extent under acute EGF stimulation. However, p44/p42MAPK activation was significantly higher in cells bearing the RasV12 mutant than in cells with the double-mutant RasV12C40 in which the second mutation on the effector domain compromises the interaction of H-Ras with downstream effectors such as Raf1 and Ral-GDS but not with PI3K (26). Accordingly, stably transfected C2C12-RasV12 myoblasts actively proliferate as indicated by the sustained expression of PCNA and Rb at the hyperphosphorylated state and fail to express differentiation markers. This differentiation-defective phenotype may be a consequence of the chronic p44/p42MAPK phosphorylation and the inability of the cells to activate the AKT pathway. In this regard, prolonged activation of p44/p42MAPK by oncogenic forms of N-ras and H-ras genes has been reported to prevent skeletal myoblast differentiation in C2C12, MM14, and Sol 8 myocytes (21, 23, 32). This indicates negative cross talk between p44/p42MAPK and AKT, as has been shown in C2C12 myoblasts in the presence of FGF2 (19). Furthermore, we observed that p44/p42MAPK activation in C2C12-RasV12 myoblasts phosphorylates and activates the transcription factor ELK1, which translocates to the nuclei and seems to be involved in maintaining myoblasts proliferation, as has been described (15, 16).

C2C12-RasV12C40 myoblasts cultured in low serum repressed phosphorylation of p44/p42MAPK and ELK1, resulting in cell cycle arrest and myogenic differentiation. This effect was accompanied by ELK1 nuclear exclusion. Under this condition, AKT, p70S6K, and p38MAPK activation was produced, leading to the formation of myotubes in 3 d, 1 d earlier than in control C2C12-AU5 cells. A reciprocal negative cross talk, this time between AKT and p44/p42MAPK, was observed as has been described in differentiated myotubes (12). In addition, AKT negatively regulated the ELK1 transcription factor (34, 35). Moreover, the expression of muscle-specific proteins, mainly the terminal differentiation markers caveolin-3 and MHC, also occurred 1 d earlier than in control cells. This could be due to the early activation of p38MAPK detected because this kinase has been proposed as an upstream regulator of the expression of caveolin-3 (36), and the kinetic detection of p38MAPK vs. caveolin-3 expression follows this idea. Furthermore, p38MAPK{alpha} is very likely to be the isoform involved in the induction of myogenesis in C2C12-RasV12C40 cells as has recently been demonstrated in primary myoblasts from mice deficient in the different p38MAPK isoforms (37). Our data are in agreement with the proposed role for p38MAPK in myocyte fusion possibly by affecting the expression of cytoskeletal elements such as vimentin (38). It has been reported that p38MAPK{gamma} is preferentially expressed in skeletal muscle, and forced expression of this isoform could accelerate myoblasts differentiation (39). Accordingly, we detected an increase in the expression of this isoform along with the differentiation of C2C12-RasV12C40 cells.

In addition to repression of p44/p42MAPK as an absolute requirement for growth arrest, we and others (10, 40) observed that myogenic terminal differentiation is dependent on AKT and p38MAPK activation. Blocking the AKT pathway results in the inhibition of myogenesis, whereas constitutive activation of AKT results in hypertrophy of the formed myotubes (41). In a previous study, we found that to restore differentiation of Ras-transformed myoblasts in addition to pharmacological repression of p44/p42MAPK, it was necessary to activate AKT either with insulin or by transfection of a constitutively active AKT form (23). In this study, after transient expression of constitutively active AKT or MKK6 in C2C12 myoblasts in the absence or presence of chemical inhibitors of the complementary pathway, we found that the activation of both AKT and p38MAPK was absolutely required to reach a fully differentiated phenotype. In this regard, forced activation of p38MAPK and PI3K/AKT can induce skeletal myoblast differentiation only when the reciprocal pathway is functional. It has been hypothesized that in myogenesis, cross-activation of the above-mentioned pathways is necessary and that each pathway activates unique myogenic targets (42). The expression of the transcription factor FOXO seems to be negatively associated with myogenesis because reduced skeletal muscle mass and altered fiber distribution were found in transgenic mice (43). However, a constitutively active FOXO mutant was reported to augment myotube fusion in neonatal primary myoblasts (18). In our study we found that AKT activation along with the differentiation protocol in C2C12-RasV12C40 cells produced phosphorylation of FOXO that leads to its nuclear exclusion and inactivation, allowing myogenesis. This event seems to be essential for expression of muscle creatine kinase and MHC, terminal markers of differentiation (44), and the formation of multinucleated myotubes. Our data are in agreement with the prevention of C2C12 differentiation by a constitutively active FOXO1 mutant and with the opposite effect when inhibiting FOXO expression by small interfering RNA observed by others (17). On the other hand, induction of NF{kappa}B has been positively associated with myogenic differentiation (11, 13, 45), although other studies reported a negative role for NF{kappa}B in this process (14). In our study we found an induction of NF{kappa}B activity in the nucleus in C2C12-RasV12C40 myotubes as a consequence of I{kappa}B-β degradation, attributed to p38MAPK activation, as proposed by Baeza-Raja and Munoz-Canoves (9).

In summary, our results indicate that myogenic differentiation of C2C12-RasV12C40 cells requires a pattern of transcription factors that involves nuclear exclusion of ELK1 and FOXO and induction of NF{kappa}B, effects that are dependent on p44/p42MAPK inhibition and AKT and p38MAPK activation, respectively.


    Acknowledgments
 
We are grateful for the support of the networks Redimet (ISCIII-RETIC RD06/0015/0009, Ministerio de Sanidad y Consumo, Spain), Insinet-CM (S-SAL-0159-2006, Comunidad de Madrid, Spain), and COST Action BM0602 from the European Commission.


    Footnotes
 
This work was supported by Grants BFU2005-03054 from Ministerio de Educacion y Ciencia (MEC) and PR27/05 from Santander/Universidad Complutense, Spain. C.D.A. and I.N.-V. were recipients of postgraduate fellowships from MEC, Spain.

Disclosure Statement: The authors have nothing to disclose.

First Published Online October 25, 2007

Abbreviations: CREB, cAMP response element-binding protein; EGF, epidermal growth factor; ELK, ETS-like transcription factor; FGF, fibroblast growth factor; FOXO, Forkhead box O; FS, fetal serum; GST, glutathione-S-transferase; HS, horse serum; I{kappa}B, inhibitory-{kappa}B; LY, LY294002; MBP, myelin binding protein; MHC, myosin heavy chain; NF{kappa}B, nuclear factor-{kappa}B; PCNA, proliferating cell nuclear antigen; PD*, PD169316; PI3K, phosphatidylinositol 3 kinase; Rb, retinoblastoma.

Received May 17, 2007.

Accepted for publication October 16, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Weintraub H 1993 The MyoD family and myogenesis: redundancy, networks, and thresholds. Cell 75:1241–1244[CrossRef][Medline]
  2. Ewton DZ, Roof SL, Magri KA, McWade FJ, Florini JR 1994 IGF-II is more active than IGF-I in stimulating L6A1 myogenesis: greater mitogenic actions of IGF-I delay differentiation. J Cell Physiol 161:277–284[CrossRef][Medline]
  3. Bach LA, Salemi R, Leeding KS 1995 Roles of insulin-like growth factor (IGF) receptors and IGF-binding proteins in IGF-II-induced proliferation and differentiation of L6A1 rat myoblasts. Endocrinology 136:5061–5069[Abstract]
  4. Coolican SA, Samuel DS, Ewton DZ, McWade FJ, Florini JR 1997 The mitogenic and myogenic actions of insulin-like growth factors utilize distinct signaling pathways. J Biol Chem 272:6653–6662[Abstract/Free Full Text]
  5. White MF 2003 Insulin signaling in health and disease. Science 302:1710–1711[Abstract/Free Full Text]
  6. Kaliman P, Canicio J, Shepherd PR, Beeton CA, Testar X, Palacin M, Zorzano A 1998 Insulin-like growth factors require phosphatidylinositol 3-kinase to signal myogenesis: dominant negative p85 expression blocks differentiation of L6E9 muscle cells. Mol Endocrinol 12:66–77[Abstract/Free Full Text]
  7. Calera MR, Pilch PF 1998 Induction of Akt-2 correlates with differentiation in Sol8 muscle cells. Biochem Biophys Res Commun 251:835–841[CrossRef][Medline]
  8. Cuenda A, Cohen P 1999 Stress-activated protein kinase-2/p38 and a rapamycin-sensitive pathway are required for C2C12 myogenesis. J Biol Chem 274:4341–4346[Abstract/Free Full Text]
  9. Baeza-Raja B, Munoz-Canoves P 2004 p38 MAPK-induced nuclear factor-{kappa}B activity is required for skeletal muscle differentiation: role of interleukin-6. Mol Biol Cell 15:2013–2026[Abstract/Free Full Text]
  10. Conejo R, Lorenzo M 2001 Insulin signaling leading to proliferation, survival, and membrane ruffling in C2C12 myoblasts. J Cell Physiol 187:96–108[CrossRef][Medline]
  11. Conejo R, Valverde AM, Benito M, Lorenzo M 2001 Insulin produces myogenesis in C2C12 myoblasts by induction of NF-{kappa}B and downregulation of AP-1 activities. J Cell Physiol 186:82–94[CrossRef][Medline]
  12. Rommel C, Clarke BA, Zimmermann S, Nunez L, Rossman R, Reid K, Moelling K, Yancopoulos GD, Glass DJ 1999 Differentiation stage-specific inhibition of the Raf-MEK-ERK pathway by Akt. Science 286:1738–1741[Abstract/Free Full Text]
  13. Canicio J, Ruiz-Lozano P, Carrasco M, Palacin M, Chien K, Zorzano A, Kaliman P 2001 Nuclear factor {kappa}B-inducing kinase and I{kappa}B kinase-{alpha} signal skeletal muscle cell differentiation. J Biol Chem 276:20228–20233[Abstract/Free Full Text]
  14. Kumar A, Murphy R, Robinson P, Wei L, Boriek AM 2004 Cyclic mechanical strain inhibits skeletal myogenesis through activation of focal adhesion kinase, Rac-1 GTPase, and NF-{kappa}B transcription factor. FASEB J 18:1524–1535[Abstract/Free Full Text]
  15. Khurana A, Dey CS 2002 Involvement of Elk-1 in L6E9 skeletal muscle differentiation. FEBS Lett 527:119–124[CrossRef][Medline]
  16. Iyer D, Chang D, Marx J, Wei L, Olson EN, Parmacek MS, Balasubramanyam A, Schwartz RJ 2006 Serum response factor MADS box serine-162 phosphorylation switches proliferation and myogenic gene programs. Proc Natl Acad Sci USA 103:4516–4521[Abstract/Free Full Text]
  17. Hribal ML, Nakae J, Kitamura T, Shutter JR, Accili D 2003 Regulation of insulin-like growth factor-dependent myoblast differentiation by Foxo forkhead transcription factors. J Cell Biol 162:535–541[Abstract/Free Full Text]
  18. Bois PR, Grosveld GC 2003 FKHR (FOXO1a) is required for myotube fusion of primary mouse myoblasts. EMBO J 22:1147–1157[CrossRef][Medline]
  19. de Alvaro C, Martinez N, Rojas JM, Lorenzo M 2005 Sprouty-2 overexpression in C2C12 cells confers myogenic differentiation properties in the presence of FGF2. Mol Biol Cell 16:4454–4461[Abstract/Free Full Text]
  20. Konieczny SF, Drobes BL, Menke SL, Taparowsky EJ 1989 Inhibition of myogenic differentiation by the H-ras oncogene is associated with the down regulation of the MyoD1 gene. Oncogene 4:473–481[Medline]
  21. Mitin N, Kudla AJ, Konieczny SF, Taparowsky EJ 2001 Differential effects of Ras signaling through NF{kappa}B on skeletal myogenesis. Oncogene 20:1276–1286[CrossRef][Medline]
  22. Weyman CM, Ramocki MB, Taparowsky EJ, Wolfman A 1997 Distinct signaling pathways regulate transformation and inhibition of skeletal muscle differentiation by oncogenic Ras. Oncogene 14:697–704[CrossRef][Medline]
  23. Conejo R, de Alvaro C, Benito M, Cuadrado A, Lorenzo M 2002 Insulin restores differentiation of Ras-transformed C2C12 myoblasts by inducing NF-{kappa}B through an AKT/P70S6K/p38-MAPK pathway. Oncogene 21:3739–3753[CrossRef][Medline]
  24. Garcia JM, Gonzalez R, Silva JM, Dominguez G, Vegazo IS, Gamallo C, Provencio M, Espana P, Bonilla F 2000 Mutational status of K-ras and TP53 genes in primary sarcomas of the heart. Br J Cancer 82:1183–1185[CrossRef][Medline]
  25. Stratton MR, Fisher C, Gusterson BA, Cooper CS 1989 Detection of point mutations in N-ras and K-ras genes of human embryonal rhabdomyosarcomas using oligonucleotide probes and the polymerase chain reaction. Cancer Res 49:6324–6327[Abstract/Free Full Text]
  26. Oliva JL, Zarich N, Martinez N, Jorge R, Castrillo A, Azanedo M, Garcia-Vargas S, Gutierrez-Eisman S, Juarranz A, Bosca L, Gutkind JS, Rojas JM 2004 The P34G mutation reduces the transforming activity of K-Ras and N-Ras in NIH 3T3 cells but not of H-Ras. J Biol Chem 279:33480–33491[Abstract/Free Full Text]
  27. Blau HM, Pavlath GK, Hardeman EC, Chiu CP, Silberstein L, Webster SG, Miller SC, Webster C 1985 Plasticity of the differentiated state. Science 230:758–766[Abstract/Free Full Text]
  28. de Alvaro C, Teruel T, Hernandez R, Lorenzo M 2004 Tumor necrosis factor {alpha} produces insulin resistance in skeletal muscle by activation of inhibitor {kappa}B kinase in a p38 MAPK-dependent manner. J Biol Chem 279:17070–17078[Abstract/Free Full Text]
  29. Vlahos CJ, Matter WF, Hui KY, Brown RF 1994 A specific inhibitor of phosphatidylinositol 3-kinase, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002). J Biol Chem 269:5241–5248[Abstract/Free Full Text]
  30. Kummer JL, Rao PK, Heidenreich KA 1997 Apoptosis induced by withdrawal of trophic factors is mediated by p38 mitogen-activated protein kinase. J Biol Chem 272:20490–20494[Abstract/Free Full Text]
  31. Gallego MS, Sanchez de Toledo CJ 2007 Molecular biology of rhabdomyosarcoma. Clin Transl Oncol 9:415–419[CrossRef][Medline]
  32. Fedorov YV, Rosenthal RS, Olwin BB 2001 Oncogenic Ras-induced proliferation requires autocrine fibroblast growth factor 2 signaling in skeletal muscle cells. J Cell Biol 152:1301–1305[Abstract/Free Full Text]
  33. Suzuki J, Kaziro Y, Koide H 2000 Positive regulation of skeletal myogenesis by R-Ras. Oncogene 19:1138–1146[CrossRef][Medline]
  34. Galetic I, Maira SM, Andjelkovic M, Hemmings BA 2003 Negative regulation of ERK and Elk by protein kinase B modulates c-Fos transcription. J Biol Chem 278:4416–4423[Abstract/Free Full Text]
  35. Figueroa C, Vojtek AB 2003 Akt negatively regulates translation of the ternary complex factor Elk-1. Oncogene 22:5554–5561[CrossRef][Medline]
  36. Galbiati F, Volonte D, Engelman JA, Scherer PE, Lisanti MP 1999 Targeted down-regulation of caveolin-3 is sufficient to inhibit myotube formation in differentiating C2C12 myoblasts. Transient activation of p38 mitogen-activated protein kinase is required for induction of caveolin-3 expression and subsequent myotube formation. J Biol Chem 274:30315–30321[Abstract/Free Full Text]
  37. Perdiguero E, Ruiz-Bonilla V, Gresh L, Hui L, Ballestar E, Sousa-Victor P, Baeza-Raja B, Jardi M, Bosch-Comas A, Esteller M, Caelles C, Serrano AL, Wagner EF, Munoz-Canoves P 2007 Genetic analysis of p38 MAP kinases in myogenesis: fundamental role of p38{alpha} in abrogating myoblast proliferation. EMBO J 26:1245–1256[CrossRef][Medline]
  38. Cabane C, Englaro W, Yeow K, Ragno M, Derijard B 2003 Regulation of C2C12 myogenic terminal differentiation by MKK3/p38{alpha} pathway. Am J Physiol Cell Physiol 284:C658–C666
  39. Tortorella LL, Lin CB, Pilch PF 2003 ERK6 is expressed in a developmentally regulated manner in rodent skeletal muscle. Biochem Biophys Res Commun 306:163–168[CrossRef][Medline]
  40. Tiffin N, Adi S, Stokoe D, Wu NY, Rosenthal SM 2004 Akt phosphorylation is not sufficient for insulin-like growth factor-stimulated myogenin expression but must be accompanied by down-regulation of mitogen-activated protein kinase/extracellular signal-regulated kinase phosphorylation. Endocrinology 145:4991–4996[Abstract/Free Full Text]
  41. Cabane C, Coldefy AS, Yeow K, Derijard B 2004 The p38 pathway regulates Akt both at the protein and transcriptional activation levels during myogenesis. Cell Signal 16:1405–1415[CrossRef][Medline]
  42. Gonzalez I, Tripathi G, Carter EJ, Cobb LJ, Salih DA, Lovett FA, Holding C, Pell JM 2004 Akt2, a novel functional link between p38 mitogen-activated protein kinase and phosphatidylinositol 3-kinase pathways in myogenesis. Mol Cell Biol 24:3607–3622[Abstract/Free Full Text]
  43. Kamei Y, Miura S, Suzuki M, Kai Y, Mizukami J, Taniguchi T, Mochida K, Hata T, Matsuda J, Aburatani H, Nishino I, Ezaki O 2004 Skeletal muscle FOXO1 (FKHR) transgenic mice have less skeletal muscle mass, down-regulated type I (slow twitch/red muscle) fiber genes, and impaired glycemic control. J Biol Chem 279:41114–41123[Abstract/Free Full Text]
  44. Sumitani S, Goya K, Testa JR, Kouhara H, Kasayama S 2002 Akt1 and Akt2 differently regulate muscle creatine kinase and myogenin gene transcription in insulin-induced differentiation of C2C12 myoblasts. Endocrinology 143:820–828[Abstract/Free Full Text]
  45. Lee KH, Kim DG, Shin NY, Song WK, Kwon H, Chung CH, Kang MS 1997 NF-{kappa}B-dependent expression of nitric oxide synthase is required for membrane fusion of chick embryonic myoblasts. Biochem J 324:237–242[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by De Alvaro, C.
Right arrow Articles by Lorenzo, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by De Alvaro, C.
Right arrow Articles by Lorenzo, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals