help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2007-1364
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schaaf, M. J. M.
Right arrow Articles by Richardson, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schaaf, M. J. M.
Right arrow Articles by Richardson, M. K.
Endocrinology Vol. 149, No. 4 1591-1599
Copyright © 2008 by The Endocrine Society

Discovery of a Functional Glucocorticoid Receptor β-Isoform in Zebrafish

Marcel J. M. Schaaf, Danielle Champagne, Ivo H. C. van Laanen, Diane C. W. A. van Wijk, Annemarie H. Meijer, Onno C. Meijer, Herman P. Spaink and Michael K. Richardson

Departments of Molecular Cell Biology (M.J.M.S., I.H.C.v.L., D.C.W.A.v.W., A.H.M., H.P.S.) and Integrative Zoology (M.K.R.), Institute of Biology, and Division of Medical Pharmacology (D.C., O.C.M.), Leiden/Amsterdam Center for Drug Research/Leiden University Medical Center, Leiden University, 2300 RA Leiden, The Netherlands

Address all correspondence and requests for reprints to: Marcel J. M. Schaaf, Department of Molecular Cell Biology, Institute of Biology, P.O. Box 9505, 2300 RA Leiden, The Netherlands. E-mail: m.j.m.schaaf{at}biology.leidenuniv.nl.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In humans, two glucocorticoid receptor (GR) splice variants exist: GR{alpha} and GRβ, which are identical between amino acids 1–727 and then diverge. Whereas GR{alpha} (the canonical GR) acts as a ligand-activated transcription factor, GRβ does not bind traditional glucocorticoid agonists, lacks GR{alpha}’s transactivational activity, and acts as a dominant-negative inhibitor of GR{alpha}. It has been suggested that this receptor isoform is involved in the induction of glucocorticoid resistance in asthma patients. Unfortunately, a GR β-isoform has been detected in only humans, and therefore, an animal model for studies on this isoform is lacking. In the present study, we demonstrate that in zebrafish a GR isoform exists that diverges from the canonical zebrafish GR at the same position as human GRβ from human GR{alpha}. The zebrafish GR β-isoform acts as a dominant-negative inhibitor in reporter assays, and the extent of inhibition and the effective GR{alpha}/GRβ ratio is similar to studies performed with the human GR isoforms. In addition, the subcellular localization of zebrafish GRβ is similar to its human equivalent. Finally, expression levels of GR{alpha} and GRβ were determined in adult zebrafish tissues and at several developmental stages. Both receptor isoforms were detected throughout the body, and GRβ mRNA levels were relatively low compared with GR{alpha} mRNA levels, as in humans. Thus, for the first time, a GR β-isoform has been identified in a nonhuman animal species, shedding new light on the relevance of this GR splice variant and providing a versatile animal model for studies on the GR system.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
GLUCOCORTICOID HORMONES REGULATE a plethora of physiological processes, including metabolic, immune, and behavioral processes, and analogs of these hormones are among the most prescribed drugs worldwide. Their actions are mediated by the glucocorticoid receptor (GR), a steroid receptor that is a member of the nuclear receptor family. In the absence of ligand, this receptor resides in the cytoplasm, in a complex with heat-shock proteins and immunophilins (1). Activation by a ligand results in dissociation from this complex and translocation to the nucleus, where GR can bind to glucocorticoid response elements (GREs) in the promoter regions of target genes, which results in transactivation of these genes. Alternatively, GR can transrepress genes by interacting with transcription factors like nuclear factor-{kappa}B and activation protein-1, thereby inhibiting their activity (2).

Two splice variants of the human GR (hGR) occur: hGR{alpha} and hGRβ (3, 4). The two receptor isoforms are identical between amino acid 1–727 and then diverge. hGR{alpha} contains 50 specific C-terminal amino acid residues that form two helical structures that play an important role in ligand binding, whereas the C terminus of hGRβ contains 15 specific, nonhomologous amino acids, which are largely disordered (5). hGR{alpha} is the canonical GR, whereas hGRβ lacks GR{alpha}’s transactivational activity on GRE-containing promoters and does not bind traditional glucocorticoid agonists. However, binding to the glucocorticoid antagonist RU486 has recently been reported (6). In several studies, hGRβ has been shown to act as a dominant-negative inhibitor of hGR{alpha}’s transactivational properties in transiently transfected cell cultures (7, 8, 9). The mechanism of this inhibition is still unclear, but competition between hGR{alpha} and hGRβ for transcriptional coactivator proteins (10) and the formation of inactive hGR{alpha}-hGRβ heterodimers (5, 9, 11, 12) have been suggested. Specific RNA silencing of hGRβ in human monocytes and macrophages results in enhanced transactivation and transrepression induced by hGR{alpha} (13, 14), whereas overexpression of human hGRβ in mouse hybridoma cells results in decreased responsiveness to glucocorticoids in these cells (11).

In several studies, a correlation has been found between increased expression of GRβ and the occurrence of immune-related diseases. In ulcerative colitis (15), leukemia (16), and severe asthma patients (17), increased expression levels of this receptor isoform were found in various immune cells. Moreover, increased hGRβ expression correlates with resistance to glucocorticoid treatment in patients suffering from these diseases (13, 15, 16, 18, 19), suggesting that hGRβ plays an important role in glucocorticoid resistance. Interestingly, the glucocorticoid responsiveness of bronchoalveolar lavage cells from glucocorticoid-resistant asthma patients is enhanced by decreasing the hGRβ expression level using specific RNA silencing (13).

Until now, a GR β-isoform has been found only in humans. Rodents do not express a GRβ due to the absence of the alternative splice site (20). Therefore, an animal model for studies on GRβ is lacking, and studies on GRβ have been limited to human cells and tissues. In the present study, we have discovered the occurrence of a GR β-isoform in zebrafish, which is strikingly similar in structure, function, and expression level to its human equivalent. This provides a versatile animal model for studies on this pharmacologically important protein and sheds new light on the physiological relevance of hGRβ.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
Wild-type zebrafish (Danio rerio) were maintained on a 14-h light, 10-h dark photoperiod cycle at 28 C. Embryos were obtained by natural crosses. Fertilized eggs were collected and raised in embryo rearing solution at 28 C. All procedures involving animals used in this study are compliant with local animal welfare regulations and were approved by the local animal welfare committee.

In silico prediction of the zebrafish GR gene
To identify the zebrafish GR gene(s), BLAST searches of the zebrafish genomic sequence were carried out using the TBLASTN tool at the Sanger Institute Ensembl server (www.ensembl.org). The zebrafish genome release Zv7 was used for these searches using the full-length protein sequences of Burton’s mouthbrooder (21) and rainbow trout (22) GR1 and GR2 as queries. A single zebrafish GR genomic sequence was identified. Analysis of the syntenic regions of the fish GR genes in tetraodon, fugu, medaka, stickleback, and zebrafish was done using the available annotated regions of the respective genomes on the Ensembl website. The National Center for Biotechnology Information (NCBI) website (www.ncbi.nlm.nih.gov) was used to search for expressed sequence tag and cDNA sequences derived from zebrafish GR transcripts. Text searches and BLAST searches (using Burton’s mouthbrooder and rainbow trout GR1 and GR2 sequences as queries) were performed.

RT-PCR analysis of zGR{alpha} and zGRβ cDNA
Total RNA was isolated from whole adult zebrafish, livers dissected from adult fish, larvae at 72 h after fertilization, or cultured zebrafish fibroblast (ZF4) cells using Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Subsequently, RT-PCR analysis was performed using the Superscript III One-Step RT-PCR system with Platinum Taq (Invitrogen). Forward primers containing sequences from exon 1 (AATAACTCTGTACTGCCAAT), exon 2 (GCAAAATGGATCAAGGAGGA), and exon 7 were used (AGAGAGGATGAAGTTGCCCT), and reverse primers were based on sequences from exon 2 (CGCCTTTAATCATGGGAGAA), exon 8β (CCAAGCGGAATCACTATGACG), and exon 9 (CTGCTGTTGGGAGGAGATTC). PCR fragments were cloned into pCRII-TOPO vectors (Invitrogen) and sequenced using the sequencing service of BaseClear (Leiden, The Netherlands).

Northern blotting
Probes hybridizing in exon 8β and 9 were used (location of sequences is indicated in Fig. 1AGo by solid bars). RT-PCR was performed on RNA isolated from adult zebrafish, to obtain a 519-bp amplicon from exon 8β (primers used were CCATGTCTCTCTCTGCTCCAAAGCC and TCCAATATTGTGCAGCCCTAATCCA) and a 567-bp amplicon from exon 9 (primers used were TTGGTGGGTGGACTCCTGAACTTC and GGACTGTAAGTGCTGCATCTGCTCC). Total RNA derived from whole zebrafish was reverse-transcribed using oligo-dT (Life Technologies, Inc., Rockville, MD) and Super RT (HT Biotechnology, Cambridge, UK), and PCR amplification was performed using Phusion DNA polymerase (Finnzymes, Espoo, Finland) according to the manufacturer’s instructions. The amplified products were cloned into pCRII-TOPO vectors and excised by restriction enzyme digestion. The DNA fragments were end-labeled with [32P]dCTP and the Klenow fragment of DNA polymerase I.


Figure 1
View larger version (44K):
[in this window]
[in a new window]

  		FIG. 1. The zebrafish GR gene is transcribed into zGR{alpha} and zGRβ mRNA. A, The human and zebrafish GR gene. Both genes contain nine exons, of which exon 1 is noncoding. A remarkable difference is the location of the sequence encoding β-isoform-specific amino acids. In the human gene, this sequence is located in exon 9, whereas in the zebrafish gene, it is found in exon 8. Using the most 5' splice donor site in this exon results in a shorter version of exon 8 and an open reading frame that includes exon 9, resulting in mRNA encoding zGR{alpha} (GenBank accession no. EF436284). Using the most 3' site results in an extended version of exon 8, introducing a stop codon in exon 8, resulting in zGRβ mRNA (accession no. EF436285). B, Northern blot analysis. Single bands were detected using probes specific for zGR{alpha} or zGRβ mRNA. Locations of probe sequences are indicated by solid bars in A. C, RT-PCR analysis. Total zebrafish RNA of different sources was used to amplify coding sequences of zGR{alpha} and zGRβ mRNA. Single amplification products were detected, and their identity was confirmed by sequence analysis. Locations of primer sequences are indicated by arrows in A. D, Alignment of the C-terminal amino acid sequence of hGR{alpha} and -β and zGR{alpha} and -β. A vertical line indicates the position at which the GR{alpha} and GRβ sequences diverge, and the alignment shows that this position is identical between hGRs and zGRs.

 
Total RNA from adult zebrafish was separated by agarose gel electrophoresis and transferred to a nylon membrane (PerkinElmer, Waltham, MA) by capillary transfer overnight at room temperature. Blots were incubated with the labeled probes overnight at 65 C in hybridization buffer (1 M NaCl, 1% SDS, 10% dextran sulfate) and washed twice in 0.1x standard saline phosphate-EDTA/0.1% SDS (30 min at 42 C). Autoradiographic films were exposed to the blots at –80 C.

Luciferase reporter assays
Expression vectors for zGR{alpha} and zGRβ were constructed. Coding sequences were amplified by RT-PCR (as described under Northern blotting) using a forward primer with a linker containing a BamHI restriction site and reverse primers containing XhoI sites (forward primer, CCGGATCCGCAAAATGGATCAAGGAGGA; reverse primer for zGR{alpha}, CCCTCGAGCTGCTGTTGGGAGGAGATTC; reverse primer for zGRβ, CCCTCGAGCCAAGCGGAATCACTATGACG). Fragments were cloned into the expression vector pCS2+ (see http://sitemaker.umich.edu/dlturner.vectors/home) using BamHI and XhoI restriction sites. The resulting vectors were named pCS2+zGR{alpha} and pCS2+zGRβ. COS-1 cells (African green monkey kidney cells lacking an endogenous GR, and used in most published human GRβ studies) (5, 7, 9) were used for the luciferase assays. The day before transfection, the cells were seeded into 24-well plates at the appropriate density. Plasmids pCS2+zGR{alpha} and/or PCS2+zGRβ were transfected together with the reporter constructs pCMV-renilla (Promega, Madison, WI) and pMMTV-luciferase using Superfect reagent (QIAGEN, Valencia, CA). Different amounts of the empty vector pCS2+ were cotransfected to use equal amounts of total DNA in the individual transfections. Cells were incubated at 37 C for 24 h, a glucocorticoid ligand (dexamethasone or cortisol) was added, and cells were incubated at 37 C for 24 h. Cells were lysed and the firefly and renilla luciferase activity was measured using the Promega Dual Label Reporter assay. Bioluminescence was detected in a Berthold luminometer (LUMAT LB 9507; Berthold, Bad Wildbad, Germany). Averages were taken from at least three replicates, and the average firefly luciferase activity was divided by the average renilla luciferase activity. Data shown are means ± SE of at least three individual experiments. Data from zGR{alpha} and zGRβ coexpression studies (Fig. 3AGo) were analyzed by ANOVA using the software SPSS 7.5.


Figure 3
View larger version (25K):
[in this window]
[in a new window]

  		FIG. 3. A, The dominant-negative activity of zGRβ. Luciferase reporter assays were performed in COS-1 cells after transfection of different zGR{alpha}/zGRβ ratios and 24 h after addition of 100 nM dexamethasone. Different amounts of the empty expression vector were cotransfected to use equal amounts of total DNA in the individual transfections. A 10-fold excess of transfected zGRβ expression vector resulted in a statistically significant decrease in transcriptional activity (P = 0.0004). B, Transcriptional activity of zGR{alpha} and zGRβ at 24 h after addition of 100 nM dexamethasone after transfection of different zGR{alpha} or zGRβ expression vector amounts. A plateau is reached for zGR{alpha} between 30 and 300 ng DNA. For zGRβ, luciferase activity still increases with higher DNA amounts in this range. These data indicate that the dominant-negative effect of zGRβ observed in this assay is not due to a nonspecific squelching effect.

 
Confocal microscopy
Expression vectors for YFP-zGR{alpha} and YFP-zGRβ were constructed to obtain YFP-GR fusion proteins with an identical linker sequence as previously made YFP-hGR constructs (23). Amplification of zGR{alpha} and zGRβ cDNA sequence was performed using primers containing XhoI and BamHI restriction sites and pCS2+zGR{alpha} and pCS2+zGRβ as templates (primer sequences: CC GCT CGA GCA GGA GCA GGC GCC GGG GCG GGT GCT ATGGATCAAGGAGGACTGGAG as forward primer, and as reverse primer, CCGGGATCCCTGCTGTTGGGAGGAGATTC for zGR{alpha} and CCGGGATCCCCAAGCGGAATCACTATGACG for zGRβ. Using XhoI and BamHI restriction sites, the amplicons were ligated into the vector pEYFP-C1 (Clontech, Mountain View, CA).

The resulting plasmids were transfected into COS-1 cells (plated in four-well chambered coverglasses from Nunc, Roskilde, Denmark) using TransIt Cos (Mirus), and cells were imaged 24 h later. Imaging was performed using a Leica (Leica Microsystems, Wetzlar, Germany) SP1 confocal laser scanning microscope. Excitation was done with an argon laser at 514 nm. Images were captured using a x63 water immersion objective, a 1024 x 1024 pixel resolution was used, and images are averages of six scans. Quantitation of the fluorescence was done using LCS Lite software (Leica).

Western blotting
Lysates of COS-1 cells transfected with yellow fluorescent protein (YFP)-zGR{alpha} or YFP-zGRβ were analyzed by Western blotting. One day after transfection, cells were scraped off in ice-cold PBS, spun down, and resuspended in a 0.25 M Tris/5 mM EDTA buffer (pH 8), lysed by tip sonication, and incubated at 95 C for 10 min. Protein samples were resolved by electrophoresis through polyacrylamide gels and electrophoretically transferred to nitrocellulose membranes. Membranes were blocked at room temperature for 30 min in PBS with Tween 20 [PBST; 10 mM Tris-HCl (pH 7.4), 150 mM NaCl, and 0.1% Tween 20] containing 5% nonfat dry milk. Subsequently, the membrane was incubated overnight at 4 C with a monoclonal anti-green fluorescent protein antibody (JL-8; Clontech) at a dilution of 1:1000 in PBST containing 5% nonfat dry milk. After three 15-min washes in PBST containing 5% nonfat dry milk, the membrane was incubated with a horseradish peroxidase (HRP)-labeled antimouse secondary antibody (Cell Signaling Technology, Danvers, MA) (1:10,000 dilution in PBST containing 5% nonfat dry milk) for 1.5 h at room temperature. Finally, after three 15-min washes in PBST, immunoreactivity was visualized by enhanced chemiluminescence (GE Healthcare Life Sciences, Piscataway, NJ) according to the manufacturer’s instructions.

Quantitative RT-PCR analysis
Total RNA was extracted using Trizol reagent. A DNase treatment was performed, using the DNA-free kit (Ambion, Austin, TX), and cDNA was synthesized as described under Northern blotting. PCR amplification of the cDNA was performed using DNA Engine Opticon2 (Bio-Rad, Hercules, CA) and qPCR Core kit for SYBR Green I (Bio-Rad). Primers were designed to amplify a region in exon 8β (GATGAACTACGAATGTCTTA and GCAACAGACAGCCAGACAGCTCACT) or exon 9 (AACTGGCACGGTTCTATCAGCTCA and TTCTGGTGAAAGCAGCGG). For normalization, in separate reactions, primers were used to amplify β-actin mRNA (CGAGCAGGAGATGGAACC and CAACGGAAACGCTCATTGC).

To study whether genomic sequences were amplified, a control sample was used to which no reverse transcriptase was added (non-RT control). The thermocycling protocol consisted of 2 min at 50 C, 10 min at 95 C, 40 cycles of 1 sec at 95 C, 30 sec at 60 C, and 30 sec at 72 C and finished with a melting curve ranging from 65–95 C to allow discrimination of specific products. Standard curves were made using serial dilutions of known amounts of PCS2+zGR{alpha} or PCS2+zGRβ and used for quantitation of specific cDNAs in the samples. A standard curve for β-actin was made using serial dilutions of cDNA sample, so the relative amount of β-actin in each sample could be determined. Finally, the zGR{alpha} and zGRβ data were normalized for β-actin. Data shown are means ± SE of at least three individual experiments.

In situ hybridization
For both receptor isoforms, both a sense (control) and an antisense probe was constructed. Plasmids previously described under Northern blotting containing exon 9 and 8β sequences were used and linearized by enzymatic digestion, purified, and stored at –20 C until use. The RNA probe was synthesized from 1 mg of the DNA plus 2 µl 0.1 M dithiothreitol (Invitrogen), 0.5 µl RNase out (Invitrogen), 2 µl dNTPs digoxigenin labeling mix (Roche, Mannheim, Germany), 2 µl 10x transcription buffer (Ambion), and 1.5 µl of either SP6 or T7 RNA polymerase (Ambion). After a 2-h incubation period at 37 C, DNase I (Roche) was added and incubated for 15 min at 37 C. The reaction was stopped with 1 µl 0.5 M EDTA. The RNA was precipitated, air dried, and taken up in water.

Whole 24-h embryos (approximately 10 embryos were used per condition) were fixed in 4% paraformaldehyde (PFA) overnight before being washed with PBST (containing 1% Tween 20), transferred to methanol in graded steps, and then stored at –20 C until use. Before use, embryos were transferred back into PBST in graded steps. The embryos were then washed again with PBST, and all embryos were refixed with 4% PFA. After washing off the PFA with PBST, the embryos were prehybridized in hybridization buffer for 5 h before the RNA probe was added to a concentration of 1 ng/µl. The embryos were left to hybridize overnight at 70 C. Embryos were transferred in series to 2x standard saline citrate with Tween 20, then to 0.2x standard saline citrate with Tween 20, and finally to PBST. Antibody buffer was then added, and after 2 h, anti-digoxigenin alkaline phosphatase-labeled antibody (Roche) was added to the embryos in a 1:3000 dilution. The embryos were left in antibody for 2 h. The embryos were washed with PBST overnight. After additional washes with PBST, the embryos were transferred to AP buffer and then stained with purple Boehringer Mannheim AP substrate staining solution (Roche). Once staining appeared optimal, stop solution (1 mM EDTA in PBS, pH 5.5) was added before the embryos were refixed in 4% PFA for 20 min and washed with PBST. Each pair of conditions (antisense and sense for each receptor isoform) was stained for the same amount of time to validate the control in the experiment.

Images were captured using a Leica microscope (MZ FLIII) with connected camera (DC500; Leica Microsystems) and computer software (FireCam IM50).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
The zebrafish GR gene
BLAST searches of the zebrafish genome (Ensembl Danio rerio Zv7 database) recovered one GR gene. This zebrafish GR (zGR) gene is located on chromosome 14 and consists of at least nine exons (Fig. 1AGo). A transcription product of this gene, a cDNA encoding zGR, was revealed by RT-PCR analysis using total RNA from adult zebrafish, and its sequence has been submitted to GenBank under accession no. EF436284. This sequence matched a zebrafish cDNA that had previously been annotated and described in the database as being similar to a GR (GenBank accession no. AB218424). The translation product spans 746 amino acids, and alignment with the hGR{alpha} peptide sequence reveals that 47.1% of the amino acids are identical, with high percentages in the DNA-binding domain (96.7%, amino acids 394–454) and the ligand-binding domain (73.3%, amino acids 496–746; supplemental Fig. 1A, published as supplemental data on The Endocrine Society’s Journals Online web site at http://endo.endojournals.org).

In many teleostean fish species, two GR genes have been found, and the resulting receptor isoforms have been named GR1 and GR2. Our analysis of the phylogenetic tree of fish GRs (supplemental Fig. 2) confirms previously published data demonstrating that this zebrafish GR clusters within the GR2 clade of fish GRs (24, 25). We strongly suggest that the zebrafish does not contain a second GR gene (representing the GR1 ortholog), based on three lines of evidence. First, BLAST searches using GR1 peptide sequences from rainbow trout and Burton’s mouthbrooder as queries returned sequences of genes encoding all zebrafish steroid receptors and many nuclear receptor but not a second GR gene. For example, when the rainbow trout GR1 sequence was used as a query, the genes for the three zebrafish estrogen receptors that have been identified before (26, 27) and the five previously described estrogen receptor-related receptor genes (28) were found, as well as genes encoding one zebrafish GR, one mineralocorticoid receptor, one progestin receptor, and one androgen receptor (supplemental Table 1). Second, BLAST searching in GenBank for cDNA and expressed sequence tag sequences representing possible transcripts from a zebrafish GR gene revealed fourteen sequences (supplemental Table 2). Sequence alignment showed that all 14 sequences turned out to be transcripts from the identified GR gene. Third, analysis of the syntenic region of GR1 and GR2 genes in fugu, tetraodon, medaka, and stickleback demonstrates that the GR2 gene and its syntenic region is intact in the zebrafish genome but that the GR1 syntenic region has undergone major rearrangement, apparently resulting in the loss of the GR1 gene (supplemental Fig. 3).

The zebrafish GR {alpha}- and β-isoform
A partial mRNA prediction had been deposited in GenBank (acc. no. XM_696233), which could be an alternative transcription product of this gene as a result of alternative splicing between exons 8 and 9. Northern blot analysis on RNA from embryonic zebrafish was performed using probes hybridizing against sequences downstream of this putative alternative splice site. Both probes stained a single band, but the size and intensity of the bands were different, indicating that alternative splicing indeed occurs (Fig. 1BGo). RT-PCR analysis confirmed the occurrence and identity of the alternative splice product in adult zebrafish, in larvae, and in cultured fibroblast cells (Fig. 1CGo). The full-length coding sequence of this mRNA was determined, confirming that this mRNA was the result of alternative splicing between exons 8 and 9 (Fig. 1AGo). This sequence was submitted to GenBank under accession no. EF436285. The encoded protein diverges from zGR at amino acid 697 and contains a C-terminal end of 40 specific amino acids (Fig. 1DGo). Protein alignments show that divergence from the zGR sequence occurs at the exact same position as divergence between human GR{alpha} and GRβ (Fig. 1DGo). We therefore named this protein zGRβ.

Both in the human and in the zebrafish GR protein sequence, the point of divergence between the GR {alpha}- and β-isoform is located in the transition region between the 10th and 11th helix of the ligand-binding domain (5, 29). Both GR β-isoforms therefore lack helix 12, which contains a transactivation domain (AF-2). Analysis of the predicted secondary protein structure reveals that both hGRβ and zGRβ contain a shortened version of helix 11 and a C-terminal tail that is largely disordered (supplemental Fig. 4). However, the 40 zGRβ-specific amino acids display a very low level of homology with the 15 GRβ-specific amino acids of hGRβ (supplemental Fig. 1B), although the two-amino-acid motif (lysine-proline) that has been demonstrated to be responsible for the dominant-negative effect of hGRβ (5) is present in zGRβ and is predicted to be located at the same position in hGRβ and zGRβ, immediately behind the shortened helix 11 (supplemental Fig. 4).

Comparison between the human and zebrafish GR gene reveals that the gene organization and splicing events leading to GR{alpha} and GRβ mRNA are different (Fig. 1AGo). The sequence encoding the β-specific amino acids is located in exon 9 in the human gene, whereas in the zebrafish gene, this sequence is found in exon 8. Therefore, hGR{alpha} and hGRβ mRNA are produced through alternative usage of a splice acceptor site in exon 9, whereas in zebrafish, alternative use of a splice donor site in exon 8 is the underlying mechanism. In zebrafish, using the most 5' splice donor site results in a shorter version of exon 8 and an open reading frame that includes exon 9, which encodes zGR{alpha}-specific amino acids. Using the most 3' site results in an extended version of exon 8 in zGRβ mRNA, introducing a stop codon in exon 8.

The dominant-negative activity of zGRβ
Transcriptional properties of zGR{alpha} and zGRβ were studied using luciferase assays in COS-1 cells (Fig. 2Go), which are commonly used for this type of assay because they lack an endogenous GR. First, expression vectors for zGR{alpha} and zGRβ were transfected into these cells together with a vector containing a luciferase gene driven by the MMTV promoter, which contains several GREs. Luciferase activity induced by zGR{alpha} was increased 15-fold at 24 h after addition of dexamethasone (100 nM), a synthetic GR ligand. Addition of cortisol (100 nM), the main endogenous glucocorticoid hormone in fish, resulted in a 10-fold increase in luciferase activity (Fig. 2AGo). In a separate experiment, dose-response curves were made for these ligands, and EC50 values were determined (0.37 and 10.1 nM for dexamethasone and cortisol respectively, Fig. 2BGo) that are in line with previously found EC50 values using the human GR{alpha} in comparable assays [0.3 nM for dexamethasone (30) and 8 nM for corticosterone (31)]. No induction in transcriptional activity of zGRβ was observed using these two ligands, confirming our expectation that zGRβ has no transactivational activity.


Figure 2
View larger version (32K):
[in this window]
[in a new window]

  		FIG. 2. Transcriptional activity of zGR{alpha} and zGRβ determined using luciferase reporter assays in COS-1 cells. Expression plasmids for zGR{alpha} or zGRβ were transfected together with the reporter constructs pMMTV-luciferase and pCMV-renilla (to correct for transfection and protein isolation efficiency) using Superfect reagent. Luciferase activity was measured 24 h after ligand addition. A, Induction by dexamethasone and cortisol. Addition of 100 nM dexamethasone and cortisol resulted in a 15- and 10-fold induction in luciferase activity by zGR{alpha}, respectively, whereas no induction in transcriptional activity of zGRβ was observed. B, Dose-response curves for zGR{alpha}’s transcriptional activity induced by dexamethasone and cortisol. EC50 values were 0.37 and 10.1 nM for dexamethasone and cortisol, respectively.

 
Second, the possible dominant-negative activity of zGRβ was studied. For this purpose, the zGR{alpha} and zGRβ expression vectors were cotransfected at different ratios, and luciferase activity was measured 24 h after addition of dexamethasone. Coexpression of zGRβ decreased the zGR{alpha}-induced transcription, depending on the amount of zGRβ present (Fig. 3AGo). A 10-fold excess of transfected zGRβ expression vector resulted in a 60% decrease in transcriptional activity. ANOVA indicated that this decrease was statistically significant (P = 0.004). In a control experiment, the transcriptional activity of zGR{alpha} and zGRβ was determined after transfection of different expression vector amounts (induced by 100 nM dexamethasone, Fig. 3BGo). A plateau is reached for zGR{alpha} between 30 and 300 ng DNA, whereas for zGRβ, luciferase activity still increases with higher DNA amounts in this range. These data indicate that the dominant-negative effect of zGRβ observed in this assay (Fig. 3AGo) is not due to a nonspecific squelching effect.

Subcellular localization of zGR{alpha} and zGRβ
To study the subcellular localization of zGR{alpha} and zGRβ, expression plasmids encoding zGR{alpha} and zGRβ tagged with a YFP at the N terminus were constructed and transfected into COS-1 cells. Images of transfected cells were made using confocal microscopy, and representative images are shown in Fig. 4AGo. Quantitation of the nuclear localization is shown in supplemental Table 3. YFP-zGR{alpha} was localized in both the nucleus and the cytoplasm at comparable levels. After administration of dexamethasone, complete translocation of the receptor to the nucleus was observed. YFP-zGRβ showed a slightly more nuclear localization than YFP-zGR{alpha} in the absence of ligand. This localization was not changed after addition of dexamethasone.


Figure 4
View larger version (60K):
[in this window]
[in a new window]

  		FIG. 4. Subcellular localization of zGR{alpha} and zGRβ. A, Representative confocal microscopy images of YFP-zGR{alpha} and YFP-zGRβ transiently transfected in COS-1 cells. Pictures were taken 24 h after transfection and 3 h after addition of vehicle/dexamethasone to the medium. B, Western blots on lysates from COS-1 cells transfected with empty vector, YFP-zGR{alpha}, and YFP-zGRβ. Cells were lysed 24 h after transfection. An antibody against YFP was used for detection of the fusion proteins.

 
For comparison, we included YFP-tagged hGR{alpha} and hGRβ constructs in our study (supplemental Table 3). The linker sequence between YFP and GR in these constructs was identical to the respective sequence in the YFP-zGR constructs. Subcellular localization of the YFP-hGR constructs were in line with previously published data (6). YFP-hGRβ showed a more nuclear localization than YFP-zGR{alpha}, and this localization was not changed by dexamethasone administration. Thus, both the human and zebrafish YFP-tagged GRs show that the β-isoform displays a slightly more nuclear localization than the {alpha}-isoform (in the absence of ligand). Interestingly, both the human {alpha}-isoform and the β-isoform showed a more cytoplasmic localization in the absence of ligand than their zebrafish equivalents.

To control whether the fusion protein was correctly expressed, a Western blot was performed on cell lysates from COS-1 cells transfected with YFP-zGR{alpha} and YFP-zGRβ (Fig. 4BGo). Using an antibody against YFP, a single band of approximately 120 bp was detected, which is the expected size of the fusion proteins. The expression level of YFP-zGR{alpha} was slightly higher than the level of YFP-zGRβ, probably reflecting a difference in stability between the two isoforms as observed between the human isoforms (32).

Expression of zGR{alpha} and zGRβ mRNA in vivo
To study the relative expression levels of zGR{alpha} and zGRβ mRNA, quantitative RT-PCR analysis was performed on RNA from several tissues of adult zebrafish (Fig. 5AGo). In all tissues studied, zGR{alpha} and zGRβ mRNA appear to be coexpressed, with zGR{alpha} mRNA levels being significantly higher than zGRβ mRNA levels. Ratios of GR{alpha}/β mRNA levels varied between 13.3 (in muscle) and 60.6 (in spleen).


Figure 5
View larger version (31K):
[in this window]
[in a new window]

  		FIG. 5. zGR{alpha} and zGRβ mRNA expression studies. A, Expression in adult tissues. RNA was isolated from adult zebrafish tissues and zGR{alpha}, and zGRβ mRNA levels were measured by quantitative RT-PCR using isoform-specific primer pairs. In all tissues studied, zGR{alpha} and zGRβ mRNA appear to be expressed, with zGR{alpha} mRNA levels being significantly higher than zGRβ mRNA levels. B, Expression at different developmental stages. RNA was isolated from whole zebrafish embryos at different developmental stages, and zGR{alpha} and zGRβ mRNA levels were measured. At all stages studied, zGR{alpha} and zGRβ mRNA appear to be coexpressed, with zGR{alpha} mRNA levels being significantly higher than zGRβ mRNA levels. Ratios of zGR{alpha}/β are relatively high (>100) until tail bud stage (10 h after fertilization), after which they decrease to approximately 20 at 72 h after fertilization.

 
In most studies using zebrafish as an animal model, embryonic and larval stages are used because of the fact that they are easy to acquire in large numbers, easy to manipulate, small, and transparent. Therefore, zGR{alpha} and zGRβ mRNA levels were measured at different stages during the first 72 h of zebrafish development (Fig. 5BGo). At all stages, both isoforms appeared to be expressed at the mRNA level, and zGR{alpha} mRNA levels were significantly higher than zGRβ mRNA levels. Ratios of GR{alpha}/β mRNA ranged from 20.7 (at 72 h after fertilization) to 146 (at tail bud stage, i.e. 10 h after fertilization).

To study the localization of zGR{alpha} and zGRβ mRNA expression, whole mount in situ hybridizations were performed, using zGR{alpha}- and zGRβ-specific probes on 24-h embryos. Expression of zGR{alpha} mRNA was observed throughout the body (Fig. 6AGo), confirming an in situ hybridization study previously published on the ZFIN website (33) using a probe for gene zgc:113038, which turns out to be the zGR gene. The zGRβ mRNA expression pattern looks similar, indicating that the two isoforms are colocalized (Fig. 6BGo). Hybridization with sense probes did not result in any staining of the embryo (data not shown).


Figure 6
View larger version (100K):
[in this window]
[in a new window]

  		FIG. 6. Whole-mount in situ hybridization on 24-h zebrafish embryos. A, Expression pattern of zGR{alpha} mRNA; B, expression pattern of zGRβ mRNA. Probes specific for zGR{alpha} and zGRβ were made using sequences indicated by solid bars in Fig. 1AGo and are identical to the probe sequences used for Northern blotting (Fig. 1BGo). No spatial restriction was observed for either zGR{alpha} or zGRβ mRNA.

 
The presence of a GR β-isoform in other species
How exceptional is the presence of a GR β-isoform among animal species? The presence of a GR β-isoform as present in zebrafish requires two characteristics in the GR gene. First, the splice acceptor site at the 3' end of exon 8 should have a low efficiency. Second, intron 8 should contain sequences encoding the GR β-specific amino acids (exon 8β) and the 3'-untranslated region of GRβ mRNA. Comparison of the region encompassing exon 8, intron 8, and exon 9 of the GR genes in zebrafish, medaka, fugu, tetraodon, stickleback, human, mouse, chicken, and Xenopus reveals that in zebrafish, the splice acceptor site at the 3' end of exon 8 is relatively inefficient, which is demonstrated by a low score (0.06) after in silico splice site prediction analysis. This score is exceptionally low compared with the score for human, mouse, chicken, and Xenopus (0.99, 0.99, 0.99, and 1.00) and the lowest of all studied fish, although in some fish species, relatively low scores are found as well (supplemental Fig. 5). In addition, intron 8 in the zebrafish GR gene is exceptionally long, containing 3550 bp. In the majority of the studied GR genes, intron 8 contains less than 1000 bp, except for the Xenopus and mouse GR gene and the medaka GR1 gene, in which intron 8 contains 1202, 1061, and 1009 bp, respectively (supplemental Fig. 5). For all studied GR genes, possible translation products of this intron were aligned with the zebrafish GRβ-specific amino acids. No significant homology between these translation products and the zebrafish GRβ-specific amino acids was observed (supplemental Fig. 5). These data indicate that the zebrafish has acquired a GR gene containing an intron 8 sequence enabling the expression of a GR β-isoform that is unique among the species analyzed in this study.

Finally, we studied whether the GR gene organization that is present in the human GR gene, i.e. the presence of an exon (9β) encoding GRβ-specific amino acids downstream of exon 9, occurs in other species as well. The exon 9 sequence of the GR gene of a wide variety of animals was studied. First we aligned exon 9 of the human GR gene with its equivalent in several nonmammalian vertebrates and nonplacental mammals. A low level of similarity was found in the region around the start of exon 9β, and the equivalent of exon 9β could not be found in these species (data not shown). Second, the human GR exon 9 sequence was aligned with its counterparts in other placental mammalian species (supplemental Fig. 6). In the rodent species studied (mouse, rat, and guinea pig), the donor splice site enabling GRβ expression is absent, as demonstrated before (20). In addition, this splice site appears to be absent in hedgehog, dog, and cat. Presence of a splice site was demonstrated in four primate species and in rabbit, horse, and cow. In both elephant and shrew, a splice site with a very low prediction score was observed. Translation products from these putative exon 9β sequences were aligned, demonstrating that this sequence is 100% identical among human, chimpanzee, and macaque and 76% identical between human and rabbit. The bushbaby, horse, cow, elephant, and shrew sequences show significantly lower similarity to the human sequence. These data show that the presence of a GR β-isoform as it occurs in humans is restricted to placental mammals and that within this group of animals, the genomic characteristics enabling GRβ expression (a specific donor splice site in exon 9 and/or GRβ-specific amino acid encoding sequences) are poorly conserved.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Characterization of a GR β-isoform in zebrafish
In the present study, we have demonstrated the occurrence of a C-terminal GR splice variant in zebrafish that diverges from the canonical zebrafish GR at the same position as hGRβ from hGR{alpha}. This splice variant was therefore suggested to be the zebrafish equivalent of hGRβ. We demonstrated that this zGRβ has a function similar to its human equivalent. In reporter assays in COS cells, it was demonstrated that zGRβ acts as a dominant-negative inhibitor of zGR{alpha}’s transactivational activity. Both the extent of the inhibition (i.e. approximately 50%) and the effective zGRβ/zGR{alpha} ratio (i.e. 10) are remarkably similar to results of comparable experiments in which the transcriptional activity of hGR{alpha} and hGRβ was studied in related cell lines (5, 7, 9, 10).

Using YFP-tagged receptors, the subcellular localization of zGR{alpha} and zGRβ was studied in COS cells. The localization patterns appeared to be similar to those observed for YFP-tagged hGR{alpha} and hGRβ in our study and in previously published studies on the subcellular localization of (YFP-tagged) hGRβ (5, 6, 13, 14). Both the zebrafish and the human β-isoform show a more nuclear localization than their respective unliganded {alpha}-isoform, but less nuclear than the liganded GR{alpha}. Both human GR{alpha} and GRβ were shown to be more nuclearly localized than their zebrafish equivalents. This may be due to the fact that the zebrafish constructs were not expressed in an appropriate (zebrafish) cell line.

The relative expression levels of zGR{alpha} and zGRβ mRNA were measured, and relatively low zGRβ expression levels were observed both in tissues from adult fish and in embryos at different developmental stages. The observed zGR{alpha}/zGRβ ratios were similar to those observed in human cells and tissues (8, 15, 34, 35), in which significantly lower levels of hGRβ mRNA are observed compared with hGR{alpha}. These relatively low hGRβ expression levels raise questions about the physiological relevance of this receptor isoform. However, the low level of hGRβ mRNA expression is not reflected at the protein level (12, 36), probably due to the greater stability of the hGRβ protein (32). In addition, the expression of hGRβ appears to be inducible by proinflammatory cytokines, including IL-2 and IL-4 (18) and TNF{alpha} (32), and expression within tissues differs between cell types. Several specific cell types, mainly epithelial cells, show higher expression levels of hGRβ protein (37).

Although the human and zebrafish GR β-isoforms show remarkable similarities in structure, function, and expression level, it should be noted that there are differences in the splicing events resulting in human and zebrafish GRβ mRNA and that homology between the human and zebrafish GRβ-specific C-terminal peptide sequences is lacking. We therefore suggest that this functional outcome was achieved independently in humans and zebrafish by strong positive selection. This convergent evolution sheds new light on the physiological relevance of GRβ in the glucocorticoid system.

The presence of a GR β-isoform in other species
Our studies of the GR genes of a wide variety of animal species show that the presence of a GR β-isoform is restricted to a relatively small group of animals. The gene organization enabling GRβ expression as shown in zebrafish could not be detected in tetrapods or in the other teleost fish species tetraodon, fugu, medaka, and stickleback. Because these four fishes belong to the superorder of Acantopterygii, and the zebrafish is a member of the Ostariophysi superorder, the acquisition of GRβ appears to have occurred after the Ostariophysii superorder branched off the lineage that led to Acantopterygii (110–160 million years ago) and is therefore probably restricted to species in this superorder of teleost fish. In addition, the gene organization enabling GRβ expression as shown in humans appeared to be restricted to placental mammals, and even within this group, it was shown to be poorly conserved. Because only a limited group of animals has acquired and conserved a GR gene organization that results in the presence of a GR β-isoform, this adaptation of the GR system appears not to be essential for glucocorticoid signaling. However, the convergent evolution of GRβ in certain mammalian and fish species suggests a significant role of this receptor isoform in the regulation of glucocorticoid responsiveness in these species.

The presence of a single GR gene in zebrafish
Surprisingly, only one GR gene was identified in the zebrafish genome. This is remarkable, because in many teleostean fish species, such as rainbow trout (21), Burton’s mouthbrooder (22), tetraodon, fugu and common carp (25), and sea bass (38, 39), two GR genes have been found (24, 25). These duplicate GRs appear to be a result of the genome duplication that occurred in fish between 300 and 450 million years ago, shortly after the divergence of the tetrapods from the fish lineages (40). In a few other fish species, such as Japanese flounder and brown trout (25), evidence for only one GR gene has been found thus far, but it is yet unclear whether these fishes contain a second GR gene because most of these species are poorly studied. From our analysis, it appears that the zebrafish has lost one GR gene copy during its evolution, probably as a result of rearrangements in chromosome 21. The loss of this gene appears to be limited to a small subset of fish species of the family of Cyprinidae, possibly to the Danioninae subfamily to which the zebrafish (genus Danio) belongs, because the presence of two isoforms has been reported in common carp (25), which is a member of the Cyprinidae family as well (Cyprininae subfamily, genus Cyprinus). It can be hypothesized that the zebrafish has acquired an alternative mechanism of regulation of glucocorticoid responsiveness by means of a dominant-negative GR splice variant to compensate for the loss of a second GR gene.

As a result of the loss of this GR gene, a GR splice variant, the equivalent of rainbow trout GR1b (41), which has orthologs in Burton’s mouthbrooder (21), fugu, and tetraodon (25), is lacking in zebrafish. This splice variant, which contains an additional nine amino acids between the two zinc fingers of the DNA-binding domain, is a product of the GR genes of the GR1 clade, which is the GR gene that is absent in zebrafish.

Conclusions
In conclusion, during evolution, zebrafish have acquired a β-isoform of the GR, which displays similarities in structure, function, subcellular localization, and expression level to its human equivalent. However, differences in the splicing events resulting in human and zebrafish GRβ mRNA exist, and the GRβ-specific C-terminal peptide sequence displays differences. Until now, a GR β-isoform had not been observed in any species apart from humans, and its presence in humans and zebrafish is most likely a result of convergent evolution. This and the fact that only a single GR gene appears to be present in zebrafish makes it a unique animal model system for studies on the GR system, especially given the versatility and suitability of the zebrafish in genetic, endocrine, and pharmacological studies.


   Acknowledgments
 
We thank Miyuki Kuribara, Audrey Cibert-Goton, Kezia Howes, and Huma Safdar for technical assistance.


   Footnotes
 
This work was supported by Cyttron in the BSIK program (Besluit Subsidies Investeringen Kennisinfrastructuur) and by a grant in the SmartMix program. In addition, two European Community Sixth Framework Program grants (Contracts LSHG-CT-2003-503496 and LSHG-CT-2006-037220) supported this work.

Disclosure Statement: The authors have nothing to disclose.

First Published Online December 20, 2007

Abbreviations: GR, Glucocorticoid receptor; GRE, glucocorticoid response element; hGR, human GR; PBST, PBS with Tween 20; PFA, paraformaldehyde; YFP, yellow fluorescent protein; zGR, zebrafish GR.

Received October 3, 2007.

Accepted for publication December 10, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Pratt WB, Toft DO 2003 Regulation of signaling protein function and trafficking by the hsp90/hsp70-based chaperone machinery. Exp Biol Med (Maywood) 228:111–133[Abstract/Free Full Text]
  2. Adcock IM, Caramori G 2001 Cross-talk between pro-inflammatory transcription factors and glucocorticoids. Immunol Cell Biol 79:376–384[CrossRef][Medline]
  3. Hollenberg SM, Weinberger C, Ong ES, Cerelli G, Oro A, Lebo R, Thompson EB, Rosenfeld MG, Evans RM 1985 Primary structure and expression of a functional human glucocorticoid receptor cDNA. Nature 318:635–641[CrossRef][Medline]
  4. Encio IJ, Detera-Wadleigh SD 1991 The genomic structure of the human glucocorticoid receptor. J Biol Chem 266:7182–7188[Abstract/Free Full Text]
  5. Yudt MR, Jewell CM, Bienstock RJ, Cidlowski JA 2003 Molecular origins for the dominant negative function of human glucocorticoid receptor β. Mol Cell Biol 23:4319–4330[Abstract/Free Full Text]
  6. Lewis-Tuffin LJ, Jewell CM, Bienstock RJ, Collins JB, Cidlowski JA 2007 Human glucocorticoid receptor β binds RU-486 and is transcriptionally active. Mol Cell Biol 27:2266–2282[Abstract/Free Full Text]
  7. Bamberger CM, Bamberger AM, de Castro M, Chrousos GP 1995 Glucocorticoid receptor β, a potential endogenous inhibitor of glucocorticoid action in humans. J Clin Invest 95:2435–2441[Medline]
  8. Oakley RH, Sar M, Cidlowski JA 1996 The human glucocorticoid receptor β isoform. Expression, biochemical properties, and putative function. J Biol Chem 271:9550–9559[Abstract/Free Full Text]
  9. Oakley RH, Jewell CM, Yudt MR, Bofetiado DM, Cidlowski JA 1999 The dominant negative activity of the human glucocorticoid receptor β isoform. Specificity and mechanisms of action. J Biol Chem 274:27857–27866[Abstract/Free Full Text]
  10. Charmandari E, Chrousos GP, Ichijo T, Bhattacharyya N, Vottero A, Souvatzoglou E, Kino T 2005 The human glucocorticoid receptor (hGR) β isoform suppresses the transcriptional activity of hGR{alpha} by interfering with formation of active coactivator complexes. Mol Endocrinol 19:52–64[Abstract/Free Full Text]
  11. Hauk PJ, Goleva E, Strickland I, Vottero A, Chrousos GP, Kisich KO, Leung DY 2002 Increased glucocorticoid receptor β expression converts mouse hybridoma cells to a corticosteroid-insensitive phenotype. Am J Respir Cell Mol Biol 27:361–367[Abstract/Free Full Text]
  12. Strickland I, Kisich K, Hauk PJ, Vottero A, Chrousos GP, Klemm DJ, Leung DY 2001 High constitutive glucocorticoid receptor β in human neutrophils enables them to reduce their spontaneous rate of cell death in response to corticosteroids. J Exp Med 193:585–593[Abstract/Free Full Text]
  13. Goleva E, Li LB, Eves PT, Strand MJ, Martin RJ, Leung DY 2006 Increased glucocorticoid receptor β alters steroid response in glucocorticoid-insensitive asthma. Am J Respir Crit Care Med 173:607–616[Abstract/Free Full Text]
  14. Li LB, Leung DY, Hall CF, Goleva E 2006 Divergent expression and function of glucocorticoid receptor β in human monocytes and T cells. J Leukoc Biol 79:818–827[Abstract/Free Full Text]
  15. Honda M, Orii F, Ayabe T, Imai S, Ashida T, Obara T, Kohgo Y 2000 Expression of glucocorticoid receptor β in lymphocytes of patients with glucocorticoid-resistant ulcerative colitis. Gastroenterology 118:859–866[CrossRef][Medline]
  16. Shahidi H, Vottero A, Stratakis CA, Taymans SE, Karl M, Longui CA, Chrousos GP, Daughaday WH, Gregory SA, Plate JM 1999 Imbalanced expression of the glucocorticoid receptor isoforms in cultured lymphocytes from a patient with systemic glucocorticoid resistance and chronic lymphocytic leukemia. Biochem Biophys Res Commun 254:559–565[CrossRef][Medline]
  17. Bergeron C, Fukakusa M, Olivenstein R, Lemiere C, Shannon J, Ernst P, Martin JG, Hamid Q 2006 Increased glucocorticoid receptor-β expression, but not decreased histone deacetylase 2, in severe asthma. J Allergy Clin Immunol 117:703–705[CrossRef][Medline]
  18. Leung DY, Hamid Q, Vottero A, Szefler SJ, Surs W, Minshall E, Chrousos GP, Klemm DJ 1997 Association of glucocorticoid insensitivity with increased expression of glucocorticoid receptor β. J Exp Med 186:1567–1574[Abstract/Free Full Text]
  19. Hamid QA, Wenzel SE, Hauk PJ, Tsicopoulos A, Wallaert B, Lafitte JJ, Chrousos GP, Szefler SJ, Leung DY 1999 Increased glucocorticoid receptor β in airway cells of glucocorticoid-insensitive asthma. Am J Respir Crit Care Med 159:1600–1604[Abstract/Free Full Text]
  20. Otto C, Reichardt HM, Schutz G 1997 Absence of glucocorticoid receptor-β in mice. J Biol Chem 272:26665–26668[Abstract/Free Full Text]
  21. Greenwood AK, Butler PC, White RB, DeMarco U, Pearce D, Fernald RD 2003 Multiple corticosteroid receptors in a teleost fish: distinct sequences, expression patterns, and transcriptional activities. Endocrinology 144:4226–4236[Abstract/Free Full Text]
  22. Bury NR, Sturm A, Le Rouzic P, Lethimonier C, Ducouret B, Guiguen Y, Robinson-Rechavi M, Laudet V, Rafestin-Oblin ME, Prunet P 2003 Evidence for two distinct functional glucocorticoid receptors in teleost fish. J Mol Endocrinol 31:141–156[Abstract]
  23. Schaaf MJ, Cidlowski JA 2003 Molecular determinants of glucocorticoid receptor mobility in living cells: the importance of ligand affinity. Mol Cell Biol 23:1922–1934[Abstract/Free Full Text]
  24. Prunet P, Sturm A, Milla S 2006 Multiple corticosteroid receptors in fish: from old ideas to new concepts. Gen Comp Endocrinol 147:17–23[CrossRef][Medline]
  25. Stolte EH, van Kemenade BM, Savelkoul HF, Flik G 2006 Evolution of glucocorticoid receptors with different glucocorticoid sensitivity. J Endocrinol 190:17–28[Abstract/Free Full Text]
  26. Bardet PL, Horard B, Robinson-Rechavi M, Laudet V, Vanacker JM 2002 Characterization of oestrogen receptors in zebrafish (Danio rerio). J Mol Endocrinol 28:153–163[Abstract]
  27. Menuet A, Pellegrini E, Anglade I, Blaise O, Laudet V, Kah O, Pakdel F 2002 Molecular characterization of three estrogen receptor forms in zebrafish: binding characteristics, transactivation properties, and tissue distributions. Biol Reprod 66:1881–1892[Abstract/Free Full Text]
  28. Bardet PL, Obrecht-Pflumio S, Thisse C, Laudet V, Thisse B, Vanacker JM 2004 Cloning and developmental expression of five estrogen-receptor related genes in the zebrafish. Dev Genes Evol 214:240–249[CrossRef][Medline]
  29. Bledsoe RK, Montana VG, Stanley TB, Delves CJ, Apolito CJ, McKee DD, Consler TG, Parks DJ, Stewart EL, Willson TM, Lambert MH, Moore JT, Pearce KH, Xu HE 2002 Crystal structure of the glucocorticoid receptor ligand binding domain reveals a novel mode of receptor dimerization and coactivator recognition. Cell 110:93–105[CrossRef][Medline]
  30. Miner JN, Tyree C, Hu J, Berger E, Marschke K, Nakane M, Coghlan MJ, Clemm D, Lane B, Rosen J 2003 A nonsteroidal glucocorticoid receptor antagonist. Mol Endocrinol 17:117–127[Abstract/Free Full Text]
  31. Li Y, Suino K, Daugherty J, Xu HE 2005 Structural and biochemical mechanisms for the specificity of hormone binding and coactivator assembly by mineralocorticoid receptor. Mol Cell 19:367–380[CrossRef][Medline]
  32. Webster JC, Oakley RH, Jewell CM, Cidlowski JA 2001 Proinflammatory cytokines regulate human glucocorticoid receptor gene expression and lead to the accumulation of the dominant negative β-isoform: a mechanism for the generation of glucocorticoid resistance. Proc Natl Acad Sci USA 98:6865–6870[Abstract/Free Full Text]
  33. Thisse B, Thisse C 2004 Fast release clones: a high throughput expression analysis. ZFIN Direct Data Submission (see http://zfin.org/cgi-bin/webdriver?MIval=aa-pubview2.apg&OID=ZDB-PUB-040907-1)
  34. Dahia PL, Honegger J, Reincke M, Jacobs RA, Mirtella A, Fahlbusch R, Besser GM, Chew SL, Grossman AB 1997 Expression of glucocorticoid receptor gene isoforms in corticotropin-secreting tumors. J Clin Endocrinol Metab 82:1088–1093[Abstract/Free Full Text]
  35. Mu YM, Takayanagi R, Imasaki K, Ohe K, Ikuyama S, Yanase T, Nawata H 1998 Low level of glucocorticoid receptor messenger ribonucleic acid in pituitary adenomas manifesting Cushing’s disease with resistance to a high dose-dexamethasone suppression test. Clin Endocrinol (Oxf) 49:301–306[CrossRef][Medline]
  36. de Castro M, Elliot S, Kino T, Bamberger C, Karl M, Webster E, Chrousos GP 1996 The non-ligand binding beta-isoform of the human glucocorticoid receptor (hGR beta): tissue levels, mechanism of action, and potential physiologic role. Mol Med 2:597–607[Medline]
  37. Oakley RH, Webster JC, Sar M, Parker Jr CR, Cidlowski JA 1997 Expression and subcellular distribution of the β-isoform of the human glucocorticoid receptor. Endocrinology 138:5028–5038[Abstract/Free Full Text]
  38. Terova G, Gornati R, Rimoldi S, Bernardini G, Saroglia M 2005 Quantification of a glucocorticoid receptor in sea bass (Dicentrarchus labrax, L.) reared at high stocking density. Gene 357:144–151[CrossRef][Medline]
  39. Vizzini A, Vazzana M, Cammarata M, Parrinello N 2007 Peritoneal cavity phagocytes from the teleost sea bass express a glucocorticoid receptor (cloned and sequenced) involved in genomic modulation of the in vitro chemiluminescence response to zymosan. Gen Comp Endocrinol 150:114–123[CrossRef][Medline]
  40. Volff JN 2005 Genome evolution and biodiversity in teleost fish. Heredity 94:280–294[CrossRef][Medline]
  41. Ducouret B, Tujague M, Ashraf J, Mouchel N, Servel N, Valotaire Y, Thompson EB 1995 Cloning of a teleost fish glucocorticoid receptor shows that it contains a deoxyribonucleic acid-binding domain different from that of mammals. Endocrinology 136:3774–3783[Abstract]



This article has been cited by other articles:


Home page
 J. Exp. Biol.Home page
T. M. Rodela, M. D. McDonald, P. J. Walsh, and K. M. Gilmour
The regulatory role of glucocorticoid and mineralocorticoid receptors in pulsatile urea excretion of the gulf toadfish, Opsanus beta
J. Exp. Biol., June 15, 2009; 212(12): 1849 - 1858.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schaaf, M. J. M.
Right arrow Articles by Richardson, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schaaf, M. J. M.
Right arrow Articles by Richardson, M. K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals