| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Medicine and Neuroscience (E.v.d.W., S.M.L., Y.H.J., G.J.S., S.C.C.), Albert Einstein College of Medicine, Bronx, New York 12461; Department of Medicine and Physiology (R.L., M.G.M.), University of Michigan Medical School, Ann Arbor, Michigan 48109; University of California, San Francisco, Diabetes Center (A.W.X.), University of California, San Francisco, San Francisco, California 94143; Department of Physiology (N.B.), University of Bristol, Bristol BS13NY, United Kingdom; Department of Internal Medicine (R.C., J.E.), Center for Hypothalamic Research, The University of Texas Southwestern Medical Center, Dallas, Texas 75390; Department of Psychiatry and Behavioral Neurosciences (R.G.M.), Wayne State University School of Medicine, Detroit, Michigan 48202; Department of Biostatistics (D.B.A.), University of Alabama at Birmingham, Birmingham, Alabama 35294; Department of Pharmacology (N.J.D.), Temple University School of Medicine, Philadelphia, Pennsylvania 19140; Department of Medicine (B.B.L.), Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts 02215; Departments of Pediatrics and Genetics (G.S.B.), Stanford University School of Medicine, Palo Alto, California 94305; and Department of Medicine (C.d.L.), University of California, San Diego, California 92161
Address all correspondence and requests for reprints to: Dr. Streamson Chua, Belfer Suite 701, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, New York 12461. E-mail: schua{at}aecom.yu.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Two types of leptin-responsive neurons in the hypothalamic arcuate nucleus have received a great deal of attention, principally due to their demonstrated involvement in the melanocortin and neuropeptide Y (NPY) systems that modulate ingestive behavior and metabolism. The proopiomelanocortin (POMC)/cocaine amphetamine regulated transcript (CART) neuron is a crucial component of the metabolism neural network as ablation of the POMC gene in rodents (10) and humans (11) leads to hyperphagia and obesity. The loss of leptin receptors on POMC cells causes mild obesity and diminished POMC mRNA (9) and targeted ablation of POMC neurons leads to hyperphagia and obesity (12). The NPY/agouti gene related peptide (AGRP) neuron is another critical network component because it secretes two highly potent orexigenic peptides. The dependence of hyperphagia and obesity on NPY in leptin signaling deficient rodents has been reported, whereas AGRP overexpression (by transgenesis or direct intracranial injections) leads to hyperphagia and obesity (13). Additionally, leptin directly stimulates the expression of POMC in the arcuate nucleus (14) and leptin inhibits the transcription of the Npy and Agrp genes (15, 16). Targeted deletion of NPY/AGRP neurons in adult mice produces hypophagia, although the same manipulation in neonates does not affect food intake or body weight (17, 18). Destruction of both POMC/CART neurons and NPY/AGRP neurons in adult rodents produces relatively mild obesity and hyperphagia (12, 19). Finally, viral mediated expression of leptin receptors into the arcuate nucleus of leptin receptor-deficient rodents ameliorated obesity, hyperglycemia, and locomotor activity (20, 21).
We report on the developmental progression of phenotypes of mice with selective ablation of leptin receptor (LEPR)-B expression in AGRP/NPY and POMC/CART neurons with cyclization recombinase (CRE)-locus of crossing over technology. Based on our data from periweaning and adult mice, we propose that the rapid periweaning growth phase is characterized by the emergence of leptin-regulated control of ingestion and substrate use that is mediated by POMC and AGRP/NPY neurons. The adult maintenance phase is characterized by leptin-regulated substrate use that modulates body composition. Finally, the incomplete recapitulation of the leptin signaling deficient phenotype by loss of LEPR in these two neuronal types indicates that other biochemically defined neuronal types are critical to mediating the effects of leptin signaling.
| Materials and Methods |
|---|
|
|
|---|
17 (238 bp) Lepr alleles: mLepr-105, ACAGGCTTGAGAACATGAACAC; mLepr-106, GTCTGATTTGATAGATGGTCTT; and mLepr-65A, AGAATGAAAAAGTTGTTTTGG.
The Agrp-CRE and Pomc-CRE transgenes were detected was detected with the following primer sets with the expected product sizes (Agrp-CRE,
500 bp; Pomc-CRE, 90 bp): Agrp-CRE-F1, GTACCCTAAGGATGAGGAGAGAC; Agrp-CRE-R1, CCGCATAACCAGTGAAACAGCATTG; Pomc-CRE 3'-F, AACTAAGCGGCCGCCACCGC; Pomc-CRE, 3'-R GGCACTGGCTGCTCTCCAGG.
Mice were fed PicoLab Rodent Diet 20 (an irradiated mouse breeder chow with 20% protein and minimal 9% fat; LabDiet; PMI Nutrition International, St. Louis, MO) and water ad libitum unless stated. Genotyping was done on DNA obtained from ear clips. Blood was obtained by milking a nicked tail vein. All procedures were reviewed and approved by the institutions animal care committee, conforming to accepted standards of humane animal care.
Energy balance studies: calorimetry, meal patterns, locomotion, and body temperature
Male mice A+P Lepr–/– 8 wk of age and AGRP-CRE 6 wk of age at the beginning of experiments served as subjects. Before data collection, animals were implanted with E-mitters (Mini-Mitter, Bend, OR) under ketamine/xylazine anesthesia for temperature measurements and allowed 4 d for recovery. Animals were individually housed in metabolic chambers maintained at 20–22 C on a 12-h light, 12-h dark cycle with lights on at 0700 h. Metabolic measurements (oxygen consumption, food intake, locomotor activity, core temperature) were obtained continuously using a CLAMS (Columbus Instruments, Columbus, OH) open circuit indirect calorimetry system. Mice were provided with 35% fat nutritionally complete powdered diet (Research Diets, New Brunswick, NJ) and tap water ad libitum. Presented results contain data collected over at least 7 d after at least 2–4 d of adaptation to the metabolic cages.
Under isoflurane anesthesia, mice received ip implants of radiofrequency impedance temperature probes (model G2; Minimitter). These probes were anchored to the interior face of the abdominal wall such that the intestines covered the probe. The abdominal incision was closed with 6–0 Prolene and the skin wound was closed with vetbond skin adhesive. After a 2-d recovery from surgery, animals were placed in chambers equipped with Minimitter ER-4000 receiver units that sampled core temperature from each mouse six times per minute continuously every day. Core temperatures were recorded directly onto a personal computer by Columbus Instruments temperature monitoring software interfaced with the Minimitter temperature receivers that registered core temperature.
To evaluate whether postweaning hyperphagia contributes to the obese phenotype of the adult AGRP+POMC:Lepr-flox mouse, feeding behavior was examined in a separate cohort of AGRP+POMC:Lepr-flox mice from 4 to 8 wk of age. Mice were maintained for 4 wk at 20–22 C on a 12-h light, 12-h dark cycle with lights on at 0700 h in individual chambers equipped with 20-mg pellet dispensers. Mice were provided with 35% fat nutritionally complete 20-mg pelleted diet (Research Diets) and tap water ad libitum. Food intake was measured continuously and body weight was assessed daily.
Leptin stimulation of arcuate nucleus signal transducer and activator of transcription (STAT)-3 phosphorylation
Mice were injected with leptin (10 mg/kg, ip) after an overnight fast. One hour after injection, the mice were anesthetized with ketamine/xylazine and perfused with 4% fresh paraformaldehyde. Brains were processed for phosphor-STAT3 immunostaining as described below.
Leptin-mediated inhibition of feeding
Ketamine/xylazine-anesthetized mice were implanted with third ventricle cannulae (coordinates: ML = 0, 2.5 mm posterior from bregma, 8.5 mm ventral to skull surface) and were housed individually on a 12-h light, 12-h dark cycle, with lights on at 0700 h. Cannula placement was functionally verified before leptin testing by 1 µl/1 µg peptide YY injection stimulating at least 1 g of food intake per 60 min in a nonfasted, daytime test. On each test day, testing began at 1800 h, 5 min after the intracerebroventricular injection of one of three doses (2.5, 5, 10 µg per 2 µl) of recombinant murine leptin (R&D Systems, Minneapolis, MN) or artificial cerebrospinal fluid vehicle (Harvard Apparatus, Holliston, MA). Food was presented in the form of 20 mg standard chow pellets, 3.8 kcal/g (Research Diets). Individual pellets were presented in a food trough, and timing of pellet removals was recorded. Pellet intake was calculated hourly for the first 6 h and then again at 23 h. All animals were tested with all doses, and data were analyzed with repeated-measures ANOVA with time and leptin dose and factors.
Hormone and glucose assays
Fasting serum insulin and leptin concentrations were done by ELISA (Alpco Diagnostics, Salem, NH). Glucose concentrations were determined by the glucose oxidase method (Glucometer; Bayer Corp., Tarrytown, NY).
Body mass and body composition determinations
Body mass was measured to the nearest 0.1 g. Body composition was determined by either dual-energy x-ray absorptiometry (Lunar Piximus; GE Health Care, Chalfont St. Giles, UK) or magnetic resonance spectroscopy using an ECHO magnetic resonance spectroscopy instrument (Echo Medical Systems, Houston, TX).
Microscopy and immunostaining
Mice were perfused with 4% formaldehyde through the left ventricle, and the fixed brains were equilibrated in 30% sucrose. For enhanced green fluorescent protein (GFP) and AGRP colocalization, coronal hypothalamic sections of 50 µm thickness were prepared with a vibratome. Sections were first blocked with 10% normal goat antiserum and then incubated in AGRP antiserum (1:500 dilution) or NPY antiserum (1:1500) with 0.4% Triton X-100 and 0.5% BSA in PBS for 48 h in a cold room, with gentle agitation. The primary antiserum was a rabbit polyclonal (Phoenix Pharmaceuticals, Inc., Burlingame, CA). After several washes with PBS, sections were incubated in biotinylated antirabbit IgG (1:50; Vector Laboratories, Burlingame, CA) for 2 h. After several washes in PBS, tissues were incubated in avidin conjugated with Texas Red (1:50; Vector Laboratories) for 3 h. Finally, tissues were washed for 30 min with PBS, mounted in Citifluor, and coverslipped. Native GFP and Texas Red fluorescence were visualized with the appropriate lasers and emission filters on a LSM 510 NLO multiphoton confocal microscope (Zeiss, Thornwood, NY).
For phosphorylated STAT (pSTAT)-3/AGRP colocalization, brains were cut into 30-µm coronal sections using a sliding microtome. Free-floating tissue sections were washed with PBS and pretreated with 1% H2O2 in methanol, 0.3% glycine in PBS, and 0.03% sodium dodecyl sulfate in PBS. Tissues were blocked in 3% normal donkey serum followed by incubation in rabbit anti-pSTAT3 (1:3000; Cell Signaling Technology, Danvers, MA) for 48 h at 4 C. Sections were then incubated with biotinylated donkey antirabbit (1:1000; Jackson ImmunoResearch, West Grove, PA) followed by Vectastain Elite ABC kit (Vector Laboratories) and 0.4% diaminobenzidine in 0.01% H2O2. Stained tissue slices were washed, blocked, and incubated with anti-AGRP (1:500; Phoenix Pharmaceuticals). Sections were labeled using goat antirabbit Alexa 594 (1:200; Molecular Probes, Invitrogen, Carlsbad, CA), mounted onto gelatin-coated slides, and coverslipped with ProLong Gold (Molecular Probes).
Images (x40 magnification) were captured using an FV-500 confocal microscope (Olympus, Center Valley, PA) and analyzed using Metamorph software with the operator blind to experimental group. Neurons exhibiting staining above threshold for both pSTAT3 and AGRP neurons were counted in 13 or more comparable 1-µm confocal slices per animal from three animals per group.
Data and statistical analysis
Data are expressed as means with SD or SEM (specified in each figure or table). Comparisons between groups were performed using the unpaired one-tailed Students t test, one-way ANOVA repeated measures, or 2 x N ANOVA repeated measures using Prism (GraphPad Software, San Diego, CA). Post hoc analyses were conducted using Tukey post hoc or Bonferroni comparisons. Differences were significant with P
0.05.
To evaluate whether there was any positive or negative synergy (i.e. nonadditivity) between the effects of LEPR-B-null status in AGRP cells (denoted A) and LEPR-B-null status in POMC cells (denoted P), we regressed the dependent variables of interest (fat mass, lean mass, and fractional body fat) on A, P, and an A x P interaction term using ordinary least squares linear regression. We tested for the incremental effects of the interaction term at the nondirectional (i.e. two tailed) 0.05
-level. The data indicated a pure additive effect of A x P on body composition.
| Results |
|---|
|
|
|---|
|
|
Increased body mass and fat mass due to selective Lepr deletion
We generated mice with Lepr deletion in AGRP/NPY and POMC/CART neurons by intercrossing mice of the following genotypes: Agrp-CRE Lepr-flox/flox [AGRP:Lepr–/–] mated to Pomc-CRE Lepr-flox/flox [POMC:Lepr–/–]. Subsequently we used Agrp-CRE Pomc-CRE Lepr-flox/flox males [AGRP+POMC:Lepr–/–] mated to Lepr-flox/flox females for all subsequent experiments because this type of mating would produce four types of mice in equal proportions in all litters: AGRP+POMC:Lepr–/–; AGRP:Lepr–/–; POMC:Lepr–/–; and Lepr-flox/flox. We used Lepr-flox/flox females to avoid any potential effects that maternal obesity, as would be the case if we used either POMC:Lepr–/– or AGRP:Lepr–/– mice as dams, might have on progeny development. Finally, all mice were typed for Lepr in ear or tail tissues to identify and eliminate those mice with complete or nearly complete deletion of both alleles due to early embryonic activation of the Agrp-CRE transgene with approximately 25% of all Agrp-CRE-positive mice being eliminated from the studies (25).
We studied several cohorts of male and female mice at 2–3 months of age and observed significant body weight differences due to genotype (Table 2
). These studies were mainly conducted with one Agrp-CRE transgenic line (25) and confirmed with a second Agrp-CRE line (23) in an independent cohort. AGRP:Lepr–/– mice and POMC:Lepr–/– mice were equivalent in weight and heavier than the control group. In addition, these cohorts were raised at three different institutions vivariums, indicating that the phenotypes are robust and reproducible. The AGRP+POMC:Lepr–/– groups showed the largest masses among all of the groups.
|
We addressed the issue of additive or synergistic effect on body mass in the AGRP+POMC:Lepr–/– mice. Because POMC neurons receive projections with inhibitory neurotransmitters from AGRP/NPY neurons, it is possible that we might observe synergistic effects due to loss of LEPR in both neuronal groups. Regression analysis was performed for fat mass, lean mass, and fraction body fat content to detect positive or negative synergy due to selective Lepr deletions. There was no compelling evidence for an interaction factor for any of the three dependent variables (all P > 0.5). These results indicate that a simple additive model for body mass and body fat mass is sufficient to explain the effects of loss of leptin signaling in AGRP/NPY and POMC neurons. A similar result of additive effects has been observed for mice with loss of leptin receptors in both POMC and steroidogenic factor (SF)-1 neurons (8).
Mild hyperinsulinemia due to selective LEPR ablation
One of the hallmarks of leptin signaling deficiency is insulin resistance, hyperglycemia, and hyperinsulinemia. Fasting blood glucose concentrations were statistically equivalent across all four groups (data not shown). However, we observed mild fasting hyperinsulinemia in male and female AGRP+POMC:Lepr–/– mice (Fig. 2A
). We did not observe hyperinsulinemia in either the AGRP:Lepr–/– or POMC:Lepr–/– groups. Testing of the AGRP+POMC:Lepr–/– mice with a glucose tolerance test did not reveal glucose intolerance (Fig. 2B
) with the areas under the curve being equivalent (control mice: 17,315 ± 2,400 vs. AGRP+POMC:Lepr–/– mice: 16,172 ± 1,586; units in milligrams per deciliter per minute) to control mice.
|
Fertility and lactation capacity are preserved in AGRP+POMC:Lepr–/– mice
All of the mice were produced by using AGRP+POMC:Lepr–/– males as studs. We formally documented their reproductive capacity in test matings (Table 3
). Of four males tested with virgin females, all four males produced progeny within 21–39 d of mating. Female AGRP+POMC:Lepr–/– mice are also fertile, delivering their first litters within 21 d of the initial pairing date. Because the average gestation time in mice is 20 d and the average estrus cycle is 4 d, these matings produced successful pregnancies within one estrous cycle. The numbers of pups born to and weaned by the female A+P:Lepr–/– mice are similar to Lepr-flox/flox mice, indicating that lactational capacity was not compromised.
|
|
|
|
Despite the data regarding neutral energy balance for adult mice of all genotypes, we observed a significant effect of selective leptin receptor deletion on physical activity and core body temperature. AGRP:Lepr–/– mice and AGRP+POMC:Lepr–/– mice showed decrements in physical activity in the dark phase of the circadian cycle (Fig. 4C
). There was also a significant decrease of core body temperature for both types of mice during the entire circadian cycle (Fig. 4D
).
The altered RER of AGRP+POMC:Lepr–/– mice would be expected to make them accumulate more fat during feeding of a high-fat diet because more of the ingested calories would be deposited within adipose tissue than in control mice. We placed adult female mice of two genotypes (A+P:Lepr–/– and non-CRE) on a 60% fat diet. Total weight accumulation and fat mass accretion was significantly higher in A+P:Lepr–/– mice after 5 wk of high-fat feeding (Fig. 4E
), although total food intake was not different between the groups (data not shown). There was no significant difference in accretion of fat-free mass during the interval of high-fat feeding in the two groups of mice.
Reduced inhibition of feeding from central leptin in AGRP+POMC:Lepr–/– mice
To address the issue of whether leptin sensitivity was functionally altered after the loss of LEPR-B expression in AGRP/NPY and POMC neurons, we tested the ability of central leptin injections to inhibit feeding. Two groups of adult mice, AGRP+POMC:Lepr–/– males and non-CRE males, were injected with varying doses of leptin (2.5, 5, and 10 µg) through a cannula situated in the third ventricle. In control mice, leptin at all doses caused a decrease in the 23 h cumulative intake (Fig. 5
). There was also a decrease at the 6-h cumulative intake for the 2.5- and 10-µg doses. In the AGRP+POMC:Lepr–/– mice, there was a significant decrease in the 23-h cumulative intake for the 5- and 10-µg doses, whereas 2.5 µg did not produce feeding inhibition that reached statistical significance. Moreover, leptin did not produce any statistically significant decreases in feeding except at 5 h for the 10-µg dose.
|
| Discussion |
|---|
|
|
|---|
Transient hyperphagia in the AGRP+POMC:Lepr–/– mice is surprising because complete leptin signaling deficiency leads to persistent hyperphagia in adolescent and adult rodents, a behavioral trait that is found to contribute significantly to the degree of obesity attained (26, 27). Postweaning weight gain is a trait that is a highly heritable phenotype (28, 29, 30) and is associated with alterations in body composition that can confound balance studies. Our current data suggest that the function of hypothalamic POMC and AGRP/NPY neurons may be a significant factor during postweaning weight gain in some models. The mechanism for the decrease of AGRP+POMC:Lepr–/–animals food intake to control levels over time is clearly unrelated to circulating leptin concentrations. The attenuation of the ability of leptin to inhibit feeding in adult AGRP+POMC:Lepr–/– mice provides evidence that the mechanism for normalization of feeding in adult AGRP+POMC:Lepr–/– mice is leptin independent.
The hyperphagia in developing AGRP+POMC:Lepr–/– mice is manifested by a specific increase in meal size with no change in meal frequency. Leptins effect on feeding occurs through reducing meal size without affecting meal number (31, 32). Moreover, leptin modulates other signals related to feeding and satiety, e.g. the gut hormone cholecystokinin (CCK) (12). Obese Leprfa(k)/fa(k) rats have a markedly increased meal size and reduced satiety in response to CCK. Because these animals are leptin receptor deficient, this observation suggests a critical role for leptin in the response to endogenous signals that induce satiety. The arcuate nucleus appears to be critical because when adenoviral gene therapy was used to express either functional leptin receptors or a reporter gene in this area of Leprfa(k)/fa(k) rats, the effect of CCK on the activation of neurons in the nucleus of the solitary tract and area postrema were normalized (12). We note that CCKs satiety effect is ineffective in younger rats but attains potency in adult rats (33).
A simple model to be derived from this study is that leptin, at all ages, inhibits feeding via combined actions on AGRP/NPY and POMC neurons. The loss of leptin regulation of these neurons results in hyperphagia. Maturation of the controls of feeding is manifested by the additional overlay of other, leptin-independent mechanisms of satiety and modulators of meal size that are likely to include CCK. The presence or absence of these leptin-independent mechanisms are likely to be responsible for the phenotypes of mice with loss of AGRP neurons. Adults with these satiety mechanisms are unable to overcome the feeding inhibitory influences, whereas perinatal mice, which have not developed these mechanisms, remain unaffected. We assume that some degree of plasticity permits compensatory changes for the perinatal loss of AGRP neurons with normal feeding patterns.
Maintenance of obesity without hyperphagia in adult A+P:Lepr–/– mice
There is an apparent increased metabolic efficiency in AGRP+POMC:Lepr–/– mice in that their increased mass is maintained by a daily food intake that is isocaloric to control mice that have a lower body mass. However, because the increased body mass is primarily in triglyceride mass, which does not impose a large metabolic burden, the normophagia of adult AGRP+POMC:Lepr–/– animals is sufficient to maintain their increased body mass. We should note that the increased RER of adult AGRP+POMC:Lepr–/– mice permitted increases in body fat content greater than that observed in control mice. Thus, oxidative sparing of triglycerides can contribute to increased body fat content without hyperphagia, at least with high dietary fat.
The AGRP+POMC:Lepr–/– mice have decreased core temperature and locomotor activity. This must have some impact on energy expenditure, although it is not possible to calculate the direct caloric equivalents. Because total daily energy expenditure was not altered, some other component of energy output must be increased in A+P:Lepr–/– mice. Whereas diet-induced thermogenesis is a likely candidate as the balancing mechanism, it would be difficult to calculate the energetic equivalents among diet-induced thermogenesis, body temperature maintenance, and locomotor activity in mice.
Synergism between POMC and AGRP/NPY arcuate neurons
Studies of rodents with genetic manipulations of both POMC and AGRP/NPY neurons have been previously reported (12, 17, 18). However, these were performed by ablations of the neurons. These manipulations would be expected to antagonize each other because the loss of POMC neurons leads to hyperphagia and obesity, whereas the loss of AGRP/NPY neurons causes hypophagia and weight loss in adults. Surprisingly, the loss of AGRP/NPY arcuate neurons in neonates does not affect feeding or subsequent growth, setting a precedent for developmental influences on AGRP/NPY neuronal function. In contrast, our manipulation of LEPR expression would have been expected to enhance obesity and insulin resistance.
We observed the appearance of elevated circulating insulin, leptin, and MCP1 concentrations in AGRP+POMC:Lepr–/– mice, whereas AGRP:Lepr–/– mice did not show such a similar overall pattern. Leptin concentrations were increased in AGRP:Lepr–/– mice, but insulin concentrations were significantly increased over control mice. We were surprised that we did not observe more severe perturbations in glucose control because widespread but incomplete loss of LEPR in the brain leads to hyperglycemia and insulin resistance (34, 35). It is possible that the hyperleptinemia of mice with partial Lepr deficiency has a beneficial compensatory effect by activating the remaining LEPR-B-bearing neurons, minimizing the impact of the genetic ablation of Lepr within the arcuate nucleus.
Models of LEPR-B replacement into the arcuate nucleus of LEPR-deficient animals have been studied and reported (34, 35). Food intake and weight gain were reduced in male LEPR-deficient rats with viral LEPR-B replacement in the arcuate nucleus. Unfortunately, long-term changes measured in months could not be assessed due to the transient expression provided by the adenoviral vector. Estrous cycling and hormonal concentrations were normalized in female LEPR-deficient rats with arcuate nucleus delivery of LEPR-B. These studies provide a complementary view to the role of LEPR-B-expressing arcuate neurons. Two explanations, which are not mutually exclusive, can be proposed to reconcile these two reports with our current studies: 1) non-POMC, non-AGRP/NPY arcuate nucleus neurons that express LEPR-B contribute to the control of feeding and the hypothalamic-pituitary-gonadal axis; and 2) extra-arcuate nucleus LEPR-B-bearing neurons contribute in a significant manner to leptins actions of feeding and reproduction. The identity of non-POMC, non-AGRP/NPY arcuate nucleus LEPR-B neurons remains to be determined, whereas there are many known extra-arcuate nucleus sites that bear leptin-responsive neurons.
A mouse model of leptin receptor reactivation in the arcuate nucleus in otherwise LEPR-B signaling-deficient animals found that LEPR reactivation reduced body weight and food intake, improved glucose homeostasis, and normalized locomotor activity, whereas male fertility was not restored (20). Our findings of reduced locomotion and normal fertility in deletion of LEPR signaling in POMC and AGRP/NPY arcuate neurons is consistent with this report. The findings on food intake and body weight regulation are also not inconsistent between the two studies. However, a major difference is the difference in glucose homeostasis between the models of LEPR reactivation in adult mice and LEPR deletion during embryogenesis and periweaning. Because complete LEPR deficiency by either germline mutations or CRE-mediated excision in the FVB strain of the current study causes severe hyperglycemia (34, 36), it is unlikely that the difference is due to strain differences between the two studies. We cannot exclude the possibility of developmental alterations that may have occurred in the AGRP+POMC:Lepr–/– mice. Other possibilities are the existence of another cell type within the arcuate nucleus that is critical to glucose homeostasis or extra-arcuate nucleus neurons that are directly leptin responsive contribute significantly to glucose control when arcuate nucleus neurons are rendered LEPR deficient.
We should note that the AGRP:Lepr–/– and the AGRP+POMC:Lepr–/– mice have reduced locomotor activity. Reactivation of LEPR in the arcuate nucleus restored locomotor activity to normal (20). This is highly suggestive that the AGRP/NPY neurons are responsible for mediating leptins control of locomotor activity.
The role of extraarcuate sites of leptin responsivity
A surprising finding of our studies is the incomplete replication of the full phenotype of LEPR deficiency. The A+P:Lepr–/– animals are fertile, normoglycemic with very mild hyperinsulinemia, and normophagic as adults. These observations would be highly suggestive that there must be other extraarcuate neurons that mediate leptins actions. There are known LEPR-B-expressing neurons within the paraventricular nucleus, the lateral hypothalamic area, the ventromedial nucleus, and the dorsomedial nucleus (37). Because all of these sites can alter body mass when bilateral lesions are performed and show STAT3 phosphorylation on leptin stimulation, it is likely that some, if not each, of these nonarcuate sites must be mediators of leptin function. The ventromedial nucleus neurons that express SF1 have been critically evaluated (8) and are important in leptins control of body mass and body composition. Moreover, mice with loss of LEPR in POMC and SF1 neurons showed additive effects on body weight. This point of view is supported by our report that two different transgenes driving LEPR-B expression with varying expression in hypothalamic nuclei from different neuronal-specific promoters were necessary to normalize body mass, body composition, fertility, and glycemic control in db/db mice (37). Interactions between these sites probably contribute to the regulation of meal feeding because loss of leptin modulation of POMC and AGRP/NPY neurons could produce only transient hyperphagia. However, leptins modulation of puberty/fertility and glycemic control appear to require one or more hypothalamic sites that have not yet been identified.
In summary, all of the phenotypic manifestations of complete loss of leptin signaling, except for reproductive capacity, are displayed in mice with loss of leptin receptors in POMC and AGRP neurons, albeit to a lesser degree and in a developmentally controlled manner. Therefore, we conclude that the combined output from POMC and AGRP/NPY neurons is a major efferent mediator of leptin action.
| Footnotes |
|---|
Disclosure Statement: The authors have nothing to declare.
First Published Online December 27, 2007
Abbreviations: AGRP, Agouti gene-related peptide; CART, cocaine amphetamine regulated transcript; CCK, cholecystokinin; CRE, cyclization recombinase; GFP, green fluorescent protein; ir, immunoreactive; LEPR, leptin receptor; Lepr, leptin receptor gene; MCP, monocyte chemotactic protein; NPY, neuropeptide Y; POMC, proopiomelanocortin; pSTAT, phosphorylated STAT; RER, respiratory exchange ratio; SF, steroidogenic factor; STAT, signal transducer and activator of transcription.
Received August 14, 2007.
Accepted for publication December 20, 2007.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. L. Morris and L. Rui Recent advances in understanding leptin signaling and leptin resistance Am J Physiol Endocrinol Metab, December 1, 2009; 297(6): E1247 - E1259. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Balthasar Feeding signals to the hungry mind Exp Physiol, August 1, 2009; 94(8): 857 - 866. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Obici Molecular Targets for Obesity Therapy in the Brain Endocrinology, June 1, 2009; 150(6): 2512 - 2517. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Jo, Y. Su, R. Gutierrez-Juarez, and S. Chua Jr. Oleic Acid Directly Regulates POMC Neuron Excitability in the Hypothalamus J Neurophysiol, May 1, 2009; 101(5): 2305 - 2316. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Donato Jr, R. J. Silva, L. V. Sita, S. Lee, C. Lee, S. Lacchini, J. C. Bittencourt, C. R. Franci, N. S. Canteras, and C. F. Elias The Ventral Premammillary Nucleus Links Fasting-Induced Changes in Leptin Levels and Coordinated Luteinizing Hormone Secretion J. Neurosci., April 22, 2009; 29(16): 5240 - 5250. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Seo, D.-F. Guo, K. Bugge, D. A. Morgan, K. Rahmouni, and V. C. Sheffield Requirement of Bardet-Biedl syndrome proteins for leptin receptor signaling Hum. Mol. Genet., April 1, 2009; 18(7): 1323 - 1331. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. W Williams, M. M Scott, and J. K Elmquist From observation to experimentation: leptin action in the mediobasal hypothalamus Am. J. Clinical Nutrition, March 1, 2009; 89(3): 985S - 990S. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hinoi, N. Gao, D. Y. Jung, V. Yadav, T. Yoshizawa, M. G. Myers Jr., S. C. Chua Jr., J. K. Kim, K. H. Kaestner, and G. Karsenty The sympathetic tone mediates leptin's inhibition of insulin secretion by modulating osteocalcin bioactivity J. Cell Biol., December 29, 2008; 183(7): 1235 - 1242. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |