help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2007-1015
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yazawa, T.
Right arrow Articles by Miyamoto, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yazawa, T.
Right arrow Articles by Miyamoto, K.
Endocrinology Vol. 149, No. 4 1786-1792
Copyright © 2008 by The Endocrine Society

Cyp11b1 Is Induced in the Murine Gonad by Luteinizing Hormone/Human Chorionic Gonadotropin and Involved in the Production of 11-Ketotestosterone, a Major Fish Androgen: Conservation and Evolution of the Androgen Metabolic Pathway

Takashi Yazawa, Miki Uesaka, Yoshihiko Inaoka, Tetsuya Mizutani, Toshio Sekiguchi, Takashi Kajitani, Takeshi Kitano, Akihiro Umezawa and Kaoru Miyamoto

Department of Biochemistry (T.Y., M.U., Y.I., T.M., T.S., T.Ka., K.M.), Faculty of Medical Sciences, University of Fukui, Fukui 910-1193, Japan; Department of Materials and Life Science (T.Ki.), Graduate School of Science and Technology, Kumamoto University, Kumamoto 860-8555, Japan; and National Research Institute for Child Health and Development (A.U.), Tokyo 157-8535, Japan

Address all correspondence and requests for reprints to: Kaoru Miyamoto, Department of Biochemistry, Faculty of Medical Sciences, University of Fukui, Shimoaizuki, Matsuoka, Eiheiji-cho, Fukui 910-1193, Japan. E-mail: kmiyamot{at}u-fukui.ac.jp.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have shown previously that Cyp11b1, an 11β-hydroxylase responsible for glucocorticoid biosynthesis in the adrenal gland, was induced by cAMP in androgen-producing Leydig-like cells derived from mesenchymal stem cells. We found that Cyp11b1 was induced in male Leydig cells, or female theca cells, when human chorionic gonadotropin was administered in immature mice. Expression of Cyp11b1 in rodent gonads caused the production of 11-ketotestosterone (11-KT), a major fish androgen, which induces male differentiation or spermatogenesis in fish. As in teleosts, plasma concentrations of 11-KT were elevated in human chorionic gonadotropin-treated mice. In contrast to teleosts, however, plasma concentrations of 11-KT were similar in both sexes, despite levels of testosterone, a precursor substrate, being about 20 times higher in male mice. Because expression of 11β-hydroxysteroid dehydrogenase type 2, was much higher in the mouse ovary than in the testis, conversion of testosterone into 11-KT may occur more efficiently in the ovary. In a luciferase reporter system that was responsive to and activated by androgens, 11-KT efficiently activated mammalian androgen receptor-mediated transactivation. Our results suggest that the androgen metabolic pathway is conserved between teleosts and mammals, despite sexual dominance and reproductive functions of 11-KT being altered during evolution.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
A MEMBER OF the cytochrome P-450 superfamily, steroid 11β-monooxygenase (CYP11B1 in humans or Cyp11b1 in rodents), is responsible for the last step of glucocorticoid biosynthesis in mammalian adrenal cortices. The enzyme has been shown to function in the zona fasciculate-reticularis of the adrenal cortex by an ACTH-regulated manner but has not generally been thought to work in the gonad (1, 2). Wang et al. (3), however, reported that Cyp11b1 is expressed in rat Leydig cells and involved in the regulation of 11β-hydroxysteroid dehydrogenase (11β-HSD) activity by producing 11β-hydroxysteroid. In addition to the adrenal (head kidney), fish steroid 11β-hydroxylase, a homolog of Cyp11b1, is expressed in testicular Leydig cells to produce 11-ketotstosterone (11-KT), a major androgen in fishes, with the aid of 11β-HSD (4, 5). 11-KT is necessary for inducing the male sexual phenotype and spermatogenesis in many teleost species (6, 7, 8, 9, 10). Although Cyp11b1 knockout (KO) mice are not reported until now, congenital adrenal hyperplasia with various abnormalities in gonad was reported for human CYP11B1 mutations (11, 12).

Two isoforms of 11β-HSD have been characterized in mammals and thought to be involved in the glucocorticoid metabolism (13, 14). Type I enzyme (11β-HSD1) acts predominantly as a reductase of 11-ketosteroids, whereas type II enzyme mainly acts as an oxidase of 11-hydroxysteroids. 11β-HSD1 is an oxidation of nicotinamide adenine dinucleotide phosphate-dependent oxidoreductase in key glucocorticoid target tissues such as liver, gonads, and adipose tissue, converting cortisone to cortisol, thereby regulating the level of active glucocorticoid available for intracellular glucocorticoid receptors. Deficiency of 11β-HSD1 is the cause of apparent cortisone reductase deficiency. In some cases, it may be associated with polycystic ovary syndrome by adrenal androgen excess (15, 16), although results are controversial (17, 18). By contrast, the type 2 enzyme (11β-HSD2) is an oxidation of nicotinamide adenine dinucleotide-dependent dehydrogenase found predominantly in mineralocorticoid-responsive tissues such as the kidney, salivary glands, and colon. In these tissues, 11β-HSD2 converts cortisol to cortisone or corticosterone to 11-dehydrocorticosterone, thereby protecting mineralocorticoid receptors from inappropriate occupation by cortisol. Mutations in the 11β-HSD2 gene cause a rare monogenic juvenile hypertensive syndrome called apparent mineralocorticoid excess. About half of the Hsd11b2 KO mice die within 48 h after birth (19). Although survivors were fertile, they showed human apparent mineralocorticoid excess-like phenotype. Analysis of litter size or their gonadal functions, however, have not been reported yet.

In teleosts, 11β-HSD2 is abundantly expressed in testicular Leydig cells and plays a role in the final step of production of 11-KT, a major fish androgen (20, 21).

In this study, we report induction of Cyp11b1 and production of 11-KT in murine gonads by human chorionic gonadotropin (hCG) stimulation. We also show that, in contrast to teleosts, expression of 11β-HSD2 was much higher in the mouse ovary than the testis. Although the metabolic pathway of 11-KT production is conserved between teleosts and mammals, the roles of 11-KT may be different between them.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals and hormone assay
Immature C57BL/6J mice (21–28 d old) were purchased from Charles River (Wilmington, MA). At all times, animals were treated according to National Institutes of Health guidelines. Animals were treated ip with 10 U hCG (Teikoku Zouki, Tokyo, Japan) or 5 U ACTH (Sigma, St. Louis, MO). At each time point, animals were anesthetized with diethyl ether. After collection of serum samples, concentrations of serum steroids were determined by ELISA (Cayman Chemical Co., Ann Arbor, MI). Cross-reactivities of other steroids in these assays were as follows: testosterone [5{alpha}-dihydrotestosterone (DHT), 27.4%; 5β-DHT, 18.9%; androstenedione, 3.7%; 11-KT, 2.2%; 5-androsteneodiol, 0.51%], 11-KT (4-androsten-11β, 17β-diol-3one, 0.01%).

Plasmids
A ARE-Luc reporter and hAR/pSG5 were kindly provided by Dr. Shigeaki Kato (The University of Tokyo, Tokyo, Japan). AR/pcDNA3.1 was kindly provided by Dr. Makoto Nakai (Chemicals Assessment Center, Chemicals Evaluation and Research Institute, Saitama, Japan). The slp-ARU-tk/Luc was made by inserting the oligonucleotides of the mouse sex-limited protein upstream androgen-responsive unit in the tk/Luc plasmid (22).

RT-PCR
Total RNA from cultured cells was extracted using Trizol reagent (Invitrogen Corp., Carlsbad, CA). RT-PCR was performed as described previously (23). The reaction products of the RT-PCR assay were subjected to electrophoresis in a 1.5% agar gel, and the resulting bands were visualized by staining with ethidium bromide. The primers used for PCR were as follows: Hsd11b1 (forward, ttatgaaaaaatacctcctccc, reverse, ctttgatctccagggcgcattc), Hsd11b2 (forward, aaggcagaggcatcagccgt, reverse, tgccattctgagtgaattcag), aldo-keto-reductase 1b7 (Akr1b7, forward, tcactcagagaactctctgc, reverse, atcatgcacggatctcatca). The primers used for other genes were as described by Yazawa et al. (23).

Cell culture, transfection, and luciferase assay
MA10 cells (kindly provided by Dr. Mario Ascoli, University of Iowa, Iowa City, IA) were cultured in Waymouth 752 supplemented with 15% horse serum. CV-1 and KUM9 cells were cultured in DMEM with 10% fetal calf serum. KGN cells (kindly gifted by Dr. Toshihiko Yanase, Kyushu University, Fukuoka, Japan) were culture in the DMEM/F-12 medium with 10% fetal calf serum. Transfection and luciferase reporter assays were performed as described before (24). After 24 h of transfection, the cells were treated with vehicle, androgens (Sigma), with or without aromatase inhibitors, fadrozole (Ciba Geigy Ltd., Basel, Switzerland), or anastrozole (Astra Zeneca Pharmaceuticals, Macclesfield, UK) for 24 h. Data presented represent the mean of at least four independent experiments.

Western blot analysis
The extraction of protein from the cultured cells and subsequent quantification was performed as described previously (23, 24). Equal amounts of proteins (50 µg) were analyzed by 10% SDS-PAGE and transferred to polyvinylidene difluoride membranes. Western blot analyses of Cyp11b1, Hsd11b2, glyceraldehyde-3-phosphate dehydrogenase (Gapdh), and β-tubulin were carried out with antiserum directed against Cyp11b1 (kindly given by Dr. Hiroshi Takemori, University of Osaka, Osaka, Japan), Hsd11b2 (Chemicon International, Inc., Temecula, CA), Gapdh (6C5; Santa Cruz Biotechnology, Santa Cruz, CA), and β-tubulin (D-10; Santa Cruz Biotechnology). ECL Western blot reagents (Amersham Pharmacia Biotech, Piscataway, NJ) were used for detection.

Immunohistochemistry
Tissue treatment and immunohistochemistry were performed as described previously (25). Briefly, gonads were fixed in 4% paraformaldehyde solution, dehydrated in a graded ethanol series, and embedded in paraffin wax. Sections of 7 µm thickness were treated with anti-Cyp11b1 or anti-Hsd11b2 antibodies and developed using a Vectastain Elite ABC kit (Vector Laboratories, Burlingame, CA).

Statistics
Data from transactivation experiments were analyzed by the Student’s t test. P < 0.01 was considered statistically significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Expression of Cyp11b1 in murine gonads
In a previous study, we made testosterone-producing adult Leydig-like cells from murine bone marrow-derived mesenchymal stem cells, KUM9 (23). A peculiar phenomenon that occurred in these cells was that Cyp11b1, an adrenal-specific gene, was induced by cAMP treatment after 5 d (Fig. 1AGo). Cyp11b1 mRNA and proteins were also induced in Leydig cell tumor derived-MA10 cells at 2 h after cAMP treatments, increasing thereafter (Fig. 1Go, B and C). In contrast, Cyp11b2 was not induced in both cells (Fig. 1Go, A and B).


Figure 1
View larger version (32K):
[in this window]
[in a new window]

  		FIG. 1. Time-dependent induction of Cyp11b1 mRNA (A and B) and protein (C) by cAMP in mesenchymal stem cells (A) and MA10 cells (B and C). A, Murine mesenchymal stem cells stably transfected with an SF-1-expression vector were cultured and treated with 8-bromoadenosine-cAMP for the indicated times. mRNA levels of each gene were analyzed by RT-PCR. B and C, MA10 cells were treated with cAMP for the indicated times. C, Western blot analyses were performed with antibodies against Cyp11b1 and β-tubulin using the same lysates.

 
To investigate the physiological relevance of these phenomena, we treated immature mice with hCG. Although Cyp11b1 mRNA and proteins were never detected before the hCG treatment, they were induced by hCG treatment both in the male and female gonad within 6 h (Fig. 2Go, A and B). The expression was continued for at least 48 h, although testicular levels were decreased at 48 h. In contrast, ACTH treatment did not induce gonadal Cyp11b1 mRNA, despite the fact that it induced adrenal ACTH-inducible gene, Akr1b7 mRNA (Fig. 1CGo). Immunohistochemistry showed that Cyp11b1 proteins were induced in the testicular Leydig cells and the ovarian theca cells (Fig. 2Go, C–F). The expression of Cyp11b2 was never detected.


Figure 2
View larger version (31K):
[in this window]
[in a new window]

  		FIG. 2. Induction of Cyp11b1 mRNA and protein by hCG in murine testes and ovaries. Animals were treated with hCG, and gonads were removed at indicated times (A and B). A, mRNA levels of each gene were analyzed by RT-PCR. Lane A represents an adrenal. B, Western blot analyses were performed with antibodies against Cyp11b1 and Gapdh using the same lysates. C, Animals were treated with saline, hCG, or ACTH, and tissues were removed at 16 h. mRNA levels of each gene were analyzed by RT-PCR. D–G, Localization of Cyp11b1 protein in the murine gonad. Testes or ovaries from mice treated with hCG for 24 h were used. Positive staining for Cyp11b1 was observed in testicular Leydig cells (D) and ovarian theca cells (F). No staining was observed in control sections incubated with nonimmune serum (E and G).

 
Fish androgen, 11-KT, production in the murine gonad
Teleost 11β-hydroxylase, CYP11B, is also induced by hCG treatment in immature eel Leydig cells (4). This causes the production of fish androgen, 11-KT, and premature spermatogenesis (26). To determine whether a similar phenomenon occurs in murine gonads, we measured the plasma androgen levels in the hCG-treated mice (Fig. 3Go). hCG treatment elevated the plasma testosterone levels in males and females, with much higher concentrations in the males at all times (0, 24, 48 h). The hCG treatment also elevated the 11-KT levels, but surprisingly, they were almost the same in both sexes. Thus, much higher conversion of 11-KT from testosterone seemed to occur in the ovary.


Figure 3
View larger version (12K):
[in this window]
[in a new window]

  		FIG. 3. Concentrations of serum androgens in mice treated with hCG. Serum 11-KT (A) and testosterone (B) concentrations in male ({blacksquare}) and female ({diamondsuit}) mice treated with hCG at indicated times. Data for each point are from five animals (means and SEM).

 
After the 11β-hydroxylation, 11-KT is produced by the actions of 11β-HSD (Fig. 4AGo). Two isoforms of 11β-HSD exist in mammals and have reverse activity in vivo; type I enzyme dominantly acts as a reductase and type II exhibits only an oxidative activity. It is possible that the expression pattern of the two isoforms in gonads may determine sexual dimorphism with respect to the conversion of testosterone to 11-KT. Therefore, we investigated the expression of the 11β-HSDs in the testis and ovary (Fig. 4BGo). In contrast to Cyp11b1, expression levels of 11β-HSDs, Hsd11b1 and Hsd11b2, were not affected by the hCG treatment. Hsd11b1 mRNA was expressed at higher levels in the testis than the ovary, whereas Hsd11b2 mRNA was expressed at very high levels in the ovary as reported previously (13). Only ovarian Hsd11b2 protein was detected by Western blot analysis (Fig. 4CGo). Immunohistochemistry showed that Hsd11b2 protein was expressed mainly in the theca cells (Fig. 4DGo). Using the same antibody, specific staining was not detected in the testis (data not shown). These results indicate that sexual dimorphic expression of Hsd11b2 enzyme causes the higher conversion of testosterone into 11-KT in the female.


Figure 4
View larger version (39K):
[in this window]
[in a new window]

  		FIG. 4. The expression and localization of the 11β-HSDs in the murine gonad. A, The enzymes and pathways involved in the synthesis of 11-KT. B, mRNA levels of each gene in gonads treated with hCG for indicated times were analyzed by RT-PCR. C, Immunoblot of Hsd11b2 and Gapdh proteins in testis (T) and ovary (O) using the same lysates. Localization of Hsd11b2 protein in the ovary (D and E). Positive staining for Hsd11b2 was observed in theca cells (D). No staining was observed in control sections incubated with nonimmune serum (E).

 
The effects of 11-KT and other androgen on androgen receptor (AR) activation
To investigate whether 11-KT is an effective ligand of mammalian AR, we compared the androgen-dependent transcriptional activity of 11-KT with various androgens using the luciferase reporter system (Fig. 5Go). DHT activated AR-mediated transcription in a dose-dependent manner from 10–10 M. 11-KT was as effectively strong as testosterone, although to a lesser extent than DHT. Androstenedione and 11OH-testosterone were the poor activators.


Figure 5
View larger version (17K):
[in this window]
[in a new window]

  		FIG. 5. Activation of mammalian AR by various androgens. CV-1 cells were transiently transfected with the ARE-Luc vector together with an AR expression vector. After 24 h after transfection, cells were incubated with or without increasing concentrations of various androgens for 24 h. Data are shown as the mean ± SEM values of at least four independent assays.

 
AR is exclusively expressed in the granulosa cells in the ovary (27). Because androgens can be converted to estrogens by aromatase, they could act as not only androgen but also the precursors of estrogens in these cells. Therefore, we compared androgenic activity of the aromatizable testosterone with that of the nonaromatizable 11-KT by their transcriptional activities through AR in the granulosa-like tumor KGN cells (Fig. 6Go). Both androgens significantly activated the AR-mediated transcription from 10–10 M in these cells. However, 11-KT showed significant higher activity than testosterone at 10–10 and 10–9 M (P < 0.01). Such a difference was blunted by the addition of aromatase inhibitors, fadrozole (Fig. 6Go) or anastrozole (data not shown). A significant difference was not observed at 10–8 M, probably because unconverted testosterone levels were high enough to exert the maximum response at this concentration. These results suggest that the conversion from testosterone to 11-KT may have a role in maintaining the androgenic activity caused by testosterone in granulosa cells by preventing aromatization.


Figure 6
View larger version (27K):
[in this window]
[in a new window]

  		FIG. 6. Comparison of AR-mediated transactivation by testosterone and 11-KT in granulosa like-tumor KGN cells. KGN cells were transiently transfected with the slp-ARU-tk/Luc vector together with an AR expression vector. After 24 h after transfection, cells were incubated with or without androgens and fadrozole (1 µM) for 24 h. Data are shown as the mean ± SEM values of at least four independent assays. *, Significant difference in transactivation between testosterone and 11-KT (P < 0.01).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this study, we demonstrated that the metabolic pathway producing 11-KT in the fish gonad is also conserved in murine gonads, although there is a marked difference in the production pattern in the gonads. In fish, this pathway is dominant in males (testis) and causes much higher 11-KT levels when compared with females. 11-KT is necessary for the male sexual phenotype and spermatogenesis in fish testis. In addition, it induces female-to-male sex reversal in some teleost species (9, 10). In contrast to fish, this pathway is dominant in female (ovary) mice.

In mammals, it is believed that the steroid 11β-hydroxylase, CYP11B1 or Cyp11b1, is an adrenal-specific gene and is responsible for the last step of glucocorticoid biosynthesis. However, Cyp11b1 was induced by cAMP treatment in the Leydig-like cells made from murine bone marrow-derived mesenchymal stem cells as well as in Leydig cell tumor-derived MA10 cells. Supporting the physiological relevance of this phenomenon, it was also induced in vivo by hCG treatment in testicular Leydig cells and ovarian theca cells. In addition, Wang et al. (3) reported that Cyp11b1 was expressed in rat testis. These results indicate that 11β-hydroxylase (Cyp11b1) is not an adrenal-specific gene. Recently Val et al. (28) reported that adrenal-like cells exist in the embryonic murine testis, and they respond to both ACTH and hCG that leads to the expression of Cyp11b1. However, it is unlikely that adrenal-like cells in murine gonads can explain our present observation because adrenal-like cells are presently unknown in the murine ovary, and induction of Cyp11b1 was observed in almost all populations of Leydig or theca cells. In addition, Cyp11b1 mRNA was not detected in gonads of ACTH-treated animals because O’Shaughnessy et al. (29) reported the deficiency of response to ACTH stimulation in adult Leydig cells. Rather, these results suggest that testicular Leydig cells and ovarian theca cells have a capacity to express Cyp11b1, as in the case of adrenal-like cells.

As we reported previously (23), much longer times (1–5 d) were necessary to induce all the steroidogenic enzymes by cAMP treatment in mesenchymal stem cells (MSCs) (including KUM9) than steroidogenic cell lines including MA10 (1–8 h). Then we speculated that the cAMP treatment in MSCs induced the differentiation of stem cells into steroidogenic linage in MSCs, whereas it induces the transactivation of steroidogenic enzymes in steroidogenic cell lines. Supporting this assumption, Cyp11b1 had been induced by retreatment of the cAMP in MSC-derived cells as fast as in the MA10 cells after 7 d cAMP treatment and ensuring depletion of the cAMP.

Considerable work has been done on the mechanisms that regulate transcription of human and bovine 11β-hydroxylase genes, CYP11B1 and CYP11B, respectively. Transcription factors, steroidogenic factor 1 (SF-1) (also known as Ad4BP) and cAMP response element-binding protein are known to play a vital role in both species (30, 31, 32). The model also seems to be applicable to the transcriptional regulation of murine Cyp11b1 because it is induced in nonsteroidogenic mesenchymal stem cells by the stable transfection of SF-1 and the treatment of cAMP (23, 33), although its promoter analysis is not yet reported. SF-1 is essential for the development of the adrenal gland and gonad and sexual differentiation (34, 35, 36). It is expressed in the adrenal cortex, testicular Leydig and Sertoli cells, ovarian theca and granulosa cells, pituitary gonadotroph, hypothalamus, and spleen. SF-1 is a member of the nuclear receptor superfamily and regulates the cell-specific expression of a variety of different genes involved in steroidogenesis including a number of steroid hydroxylases (34, 35, 36, 37). The expression pattern of SF-1 during urogenital development suggested that adrenal and gonadal cells are derived from common precursor cell populations (38). Therefore, it is conceivable that Cyp11b1 mRNA is induced by LH/hCG treatment in gonadal steroidogenic cells as well as by ACTH treatment in the adrenal gland. However, other adrenal-specific factors should be involved in the transcription of Cyp11b1 because the expression levels were much higher in adrenocortical cells than gonadal cells, even after hCG or cAMP treatment. Further studies will be necessary to understand the regulatory mechanisms of the Cyp11b1 gene expression.

Because the substrate precursors for glucocorticoid are not produced in the gonad due to the deficiency of Cyp21, Cyp11b1 may be involved in steroid metabolism, other than glucocorticoid synthesis in the gonad. In eel testis, 11β-hydroxylase is induced by hCG treatment and contributes to the production of the fish androgen 11-KT (4, 26). This was also observed in murine gonads, with the elevation of the plasma 11-KT levels by hCG treatment. It is likely that 11-KT is not only a teleost androgen but also a mammalian androgen. This is supported by the findings that 11-KT was able to activate mammalian AR-mediated transcription.

There is, however, a marked difference between teleosts and mammals with respect to the production of 11KT. 11-KT is a major androgen in most male teleost species and was found at much higher concentrations in male plasma than in female, whereas this is usually not the case for testosterone (39, 40). In teleosts, 11-KT is involved in the many male reproductive processes, such as spermatogenesis (6, 7), development of secondary sex characteristics (8, 9), and modulation of behavior (9). In addition, it eventually induces female-to-male sex reversal in some species (10). In contrast to teleosts, murine plasma 11-KT concentrations were at similar levels in both sexes, whereas testosterone levels were much higher in males. Such a difference between these vertebrates implies a difference in sexual dimorphic expression of the enzymes involving the conversion of 11-KT in their gonads. In teleost gonads, P450 11β is exclusively expressed in the testis (41, 42, 43), whereas murine Cyp11b1 was induced by hCG both in the testis and ovary at similar levels. By contrast, teleost 11β-HSD2 is abundantly expressed in the testis (20, 21), whereas murine Hsd11b2 was expressed more highly in the ovary. These results indicate that the 11-KT production pathway is conserved between teleosts and mammals, although its major physiological role(s) may have become different during their evolution.

Wang et al. (3) reported that 11β-hydroxysteroids or 11-ketosteroids were involved in the regulation of 11β-HSD activity in Leydig cells. 11β-hydroxysteroids were efficient inhibitors of Hsd11b1 dehydrogenase activity, whereas 11-keto compounds were effective as inhibitors of oxidoreductase activity. 11β-HSDs in Leydig cells convert active glucocorticoids to the inert 11-keto form, thereby playing a protective role in blunting the suppressive effects of glucocorticoid on Leydig cell steroidogenesis. Therefore, 11-KT is a possible controller of the testicular steroidogenesis via regulating the activity of 11β-HSDs. This may also be true in the ovarian steroidogenesis. As in the case of testicular Leydig cells, ovarian steroidogenesis is also inhibited by glucocorticoid (44, 45). In addition, higher expression of Hsd11b2 in the ovary suggests that ovarian Hsd11b2 may regulate the ovarian steroidogenesis by limiting the accessibility of active glucocorticoid to ovarian glucocorticoid receptors via 11-KT production. It also suggests that the ovary may be a new target organ of the mineralocorticoid-mineralocorticoid receptor pathway. Recently Fru et al. (46) reported that, compared with the glucocorticoid actions, mineralocorticoid stimulates progesterone synthesis by periovulatory granulosa cells in macaques. Therefore, it is conceivable that the complex steroid metabolism and signaling including androgen may regulate ovarian steroidogenesis.

The induction of 11KT by gonadotropin treatment suggests that 11-KT is also involved in folliculogenesis. In fact, androgen receptor KO (ArKO) female mice showed a subfertile phenotype, resulting from the impairment of ovulation and corpus lutea formation (27, 47). Because ovarian AR is exclusively expressed in granulosa cells (27), those phenotypes in ArKO mice suggest that androgens induce genes associated with folliculogenesis in granulosa cells. Our results in KGN cells suggest that conversion from testosterone to 11-KT may have a role in maintaining the androgenic activity caused by testosterone in granulose cells because it can efficiently induce AR-regulated genes in these cells. Shiina et al. (27) reported that Kit ligand is the direct downstream target of AR, and its down-regulation in ArKO mice is the cause of premature ovarian failure. Future studies will be necessary to investigate the relationship between Kit ligand and 11-KT-AR pathway in the ovary.

In summary, we reported that the metabolic pathway producing 11-KT, a major teleost androgen, was conserved in the mammalian gonad, although it was more active in the ovary. In female eels, however, 11-KT synthesis and levels fluctuated during oogenesis and follicular maturation (48). Therefore, 11-KT production and AR signaling in female might be conserved from teleosts to mammals, even though 11-KT has been replaced by DHT in male during evolution.


   Acknowledgments
 
We are grateful to Drs. S. Kato, M. Nakai, H. Takemori, T. Yanase, and M. Ascoli for providing the materials. We also thank Ms. Y. Inoue, K. Matsuura, and H. Fujii for technical assistance.


   Footnotes
 
This work was supported in part by a grant from the Smoking Research Foundation, Kanzawa Medical Research Foundation, 21st Century Center of Excellence Program (Medical Science), and Research and Education Program for Life Science.

Disclosure Statement: All authors (T.Y., M.U., Y.I., T.M., T.S., T.Ka., T.Ki., A.U., K.M.) have nothing to declare.

First Published Online December 27, 2007

Abbreviations: AR, Androgen receptor; ArKO, androgen receptor KO; DHT, dihydrotestosterone; Gapdh, glyceraldehyde-3-phosphate dehydrogenase; hCG, human chorionic gonadotropin; 11β-HSD, 11β-hydroxysteroid dehydrogenase; 11β-HSD1, type I enzyme 11β-HSD; 11β-HSD2, type 2 enzyme 11β-HSD; KO, knockout; 11-KT, 11-ketotstosterone; MSC, mesenchymal stem cell; SF-1, steroidogenic factor 1.

Received July 24, 2007.

Accepted for publication December 19, 2007.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Domalik LJ, Chaplin DD, Kirkman MS, Wu RC, Liu WW, Howard TA, Seldin MF, Parker KL 1991 Different isozymes of mouse 11β-hydroxylase produce mineralocorticoids and glucocorticoids. Mol Endocrinol 5:1853–1861[Abstract/Free Full Text]
  2. Ogishima T, Suzuki H, Hata J, Mitani F, Ishimura Y 1992 Zone-specific expression of aldosterone synthase cytochrome P-450 and cytochrome P-45011β in rat adrenal cortex: histochemical basis for the functional zonation. Endocrinology 130:2971–2977[Abstract/Free Full Text]
  3. Wang GM, Ge RS, Latif SA, Morris DJ, Hardy MP 2002 Expression of 11β-hydroxylase in rat Leydig cells. Endocrinology 143:621–626[Abstract/Free Full Text]
  4. Jiang JQ, Kobayashi T, Ge W, Kobayashi H, Tanaka M, Okamoto M, Nonaka Y, Nagahama Y 1996 Fish testicular 11β-hydroxylase: cDNA cloning and mRNA expression during spermatogenesis. FEBS Lett 397:250–252[CrossRef][Medline]
  5. Jiang JQ, Young G, Kobayashi T, Nagahama Y 1998 Eel (Anguilla japonica) testis 11β-hydroxylase gene is expressed in interrenal tissue and its product lacks aldosterone synthesizing activity. Mol Cell Endocrinol 146:207–211[CrossRef][Medline]
  6. Miura T, Yamauchi K, Takahashi H, Nagahama Y 1991 Hormonal induction of all stages of spermatogenesis in vitro in the male Japanese eel (Anguilla japonica). Proc Natl Acad Sci USA 88:5774–5778[Abstract/Free Full Text]
  7. Nagahama Y 1994 Endocrine regulation of gametogenesis in fish. Int J Dev Biol 38:217–229[Medline]
  8. Mayer I, Borg B, Schulz R 1990 Seasonal changes in and effect of castration/androgen replacement on the plasma levels of five androgens in the male three-spined stickleback, Gasterosteus aculeatus L. Gen Comp Endocrinol 79:23–30[CrossRef][Medline]
  9. Kobayashi M, Nakanishi T 1999 11-Ketotestosterone induces male-type sexual behavior and gonadotropin secretion in gynogenetic crucian carp, Carassius auratus langsdorfii. Gen Comp Endocrinol 115:178–187[CrossRef][Medline]
  10. Cardwell JR, Liley NR 1991 Hormonal control of sex and color change in the stoplight parrotfish, Sparisoma viride. Gen Comp Endocrinol 81:7–20[CrossRef][Medline]
  11. Curnow KM, Slutsker L, Vitek J, Cole T, Speiser PW, New MI, White PC, Pascoe L 1993 Mutations in the CYP11B1 gene causing congenital adrenal hyperplasia and hypertension cluster in exons 6, 7, and 8. Proc Natl Acad Sci USA 90:4552–4556[Abstract/Free Full Text]
  12. Karnak I, Senocak ME, Gögüçs S, Büyükpamukçu N, Hiçsönmez A 1999 Testicular enlargement in patients with 11-hydroxylase deficiency. J Pediatr Surg 32:756–758[CrossRef]
  13. Condon J, Ricketts ML, Whorwood CB, Stewart PM 1997 Ontogeny and sexual dimorphic expression of mouse type 2 11β-hydroxysteroid dehydrogenase. Mol Cell Endocrinol 127:121–128[CrossRef][Medline]
  14. Paterson JM, Seckl JR, Mullins JJ 2005 Genetic manipulation of 11β-hydroxysteroid dehydrogenases in mice. Am J Physiol Regul Integr Comp Physiol 289:R642–R652
  15. Draper N, Walker EA, Bujalska IJ, Tomlinson JW, Chalder SM, Arlt W, Lavery GG, Bedendo O, Ray DW, Laing I, Malunowicz E, White PC, Hewison M, Mason PJ, Connell JM, Shackleton CH, Stewart PM 2003 Mutations in the genes encoding 11β-hydroxysteroid dehydrogenase type 1 and hexose-6-phosphate dehydrogenase interact to cause cortisone reductase deficiency. Nat Genet 34:434–439[CrossRef][Medline]
  16. Gambineri A, Vicennati V, Genghini S, Tomassoni F, Pagotto U, Pasquali R, Walker BR 2006 Genetic variation in 11β-hydroxysteroid dehydrogenase type 1 predicts adrenal hyperandrogenism among lean women with polycystic ovary syndrome. J Clin Endocrinol Metab 91:2295–2302[Abstract/Free Full Text]
  17. White PC 2005 Genotypes at 11β-hydroxysteroid dehydrogenase type 11B1 and hexose-6-phosphate dehydrogenase loci are not risk factors for apparent cortisone reductase deficiency in a large population-based sample. J Clin Endocrinol Metab 90:5880–5883[Abstract/Free Full Text]
  18. San Millan JL, Botella-Carretero JI, Alvarez-Blasco F, Luque-Ramirez M, Sancho J, Moghetti P, Escobar-Morreale HF 2005 A study of the hexose-6-phosphate dehydrogenase gene R453Q and 11β-hydroxysteroid dehydrogenase type 1 gene 83557insA polymorphisms in the polycystic ovary syndrome. J Clin Endocrinol Metab 90:4157–4162[Abstract/Free Full Text]
  19. Kotelevtsev Y, Brown RW, Fleming S, Kenyon C, Edwards, CRW, Seckl JR Mullins JJ 1999 Hypertension in mice lacking 11β-hydroxysteroid dehydrogenase type 2. J Clin Invest 103:683–689[Medline]
  20. Jiang JQ, Wang DS, Senthilkumaran B, Kobayashi T, Kobayashi HK, Yamaguchi A, Ge W, Young G, Nagahama Y 2003 Isolation, characterization and expression of 11β-hydroxysteroid dehydrogenase type 2 cDNAs from the testes of Japanese eel (Anguilla japonica) and Nile tilapia (Oreochromis niloticus). J Mol Endocrinol 31:305–315[Abstract]
  21. Kusakabe M, Nakamura I, Young G 2003 11β-Hydroxysteroid dehydrogenase complementary deoxyribonucleic acid in rainbow trout: cloning, sites of expression, and seasonal changes in gonads. Endocrinology 144:2534–2545[Abstract/Free Full Text]
  22. Verrijdt G, Schauwaers K, Haelens A, Rombauts W, Claessens F 2002 Functional interplay between two response elements with distinct binding characteristics dictates androgen specificity of the mouse sex-limited protein enhancer. J Biol Chem 277:35191–35201[Abstract/Free Full Text]
  23. Yazawa T, Mizutani T, Yamada K, Kawata H, Sekiguchi T, Yoshino M, Kajitani T, Shou Z, Umezawa A, Miyamoto K 2006 Differentiation of adult stem cells derived from bone marrow stroma into Leydig or adrenocortical cells. Endocrinology 147:4104–4111[Abstract/Free Full Text]
  24. Yazawa T, Mizutani T, Yamada K, Kawata H, Sekiguchi T, Yoshino M, Kajitani T, Shou Z, Miyamoto K 2003 Involvement of cyclic adenosine 5'-monophosphate response element-binding protein, steroidogenic factor 1, and Dax-1 in the regulation of gonadotropin-inducible ovarian transcription factor 1 gene expression by follicle-stimulating hormone in ovarian granulosa cells. Endocrinology 144:1920–1930[Abstract/Free Full Text]
  25. Yazawa T, Nakayama Y, Fujimoto K, Matsuda Y, Abe K, Kitano T, Abe S, Yamamoto T 2003 Abnormal spermatogenesis at low temperatures in the Japanese red-bellied newt, Cynops pyrrhogaster: possible biological significance of the cessation of spermatocytogenesis. Mol Reprod Dev 66:60–66[CrossRef][Medline]
  26. Miura T, Yamauchi K, Nagahama Y, Takahashi H 1991 Induction of spermatogenesis in male Japanese eel, Anguilla japonica, by a single injection of human chorionic gonadotropin. Zool Sci 8:63–73
  27. Shiina H, Matsumoto T, Sato T, Igarashi K, Miyamoto J, Takemasa S, Sakari M, Takada I, Nakamura T, Metzger D, Chambon P, Kanno J, Yoshikawa H, Kato S 2006 Premature ovarian failure in androgen receptor-deficient mice. Proc Natl Acad Sci USA 103:224–229[Abstract/Free Full Text]
  28. Val P, Jeays-Ward K, Swain A 2006 Identification of a novel population of adrenal-like cells in the mammalian testis. Dev Biol 299:250–256[CrossRef][Medline]
  29. O’Shaughnessy PJ, Fleming LM, Jackson G, Hochgeschwender U, Reed P, Baker PJ 2003 Adrenocorticotropic hormone directly stimulates testosterone production by the fetal and neonatal mouse testis. Endocrinology 144:3279–3284[Abstract/Free Full Text]
  30. Wang XL, Bassett M, Zhang Y, Yin S, Clyne C, White PC, Rainey WE 2000 Transcriptional regulation of human 11β-hydroxylase (hCYP11B1). Endocrinology 141:3587–3594[Abstract/Free Full Text]
  31. Takayama K, Morohashi K, Honda S, Hara N, Omura T 1994 Contribution of Ad4BP, a steroidogenic cell-specific transcription factor, to regulation of the human CYP11A and bovine CYP11B genes through their distal promoters. J Biochem (Tokyo) 116:193–203[Abstract/Free Full Text]
  32. Rainey WE 1999 Adrenal zonation: clues from 11β-hydroxylase and aldosterone synthase. Mol Cell Endocrinol 151:151–160[CrossRef][Medline]
  33. Gondo S, Yanase T, Okabe T, Tanaka T, Morinaga H, Nomura M, Goto K, Nawata H 2004 SF-1/Ad4BP transforms primary long-term cultured bone marrow cells into ACTH-responsive steroidogenic cells. Genes Cells 9:1239–1247[Abstract/Free Full Text]
  34. Ikeda Y, Lala DS, Luo X, Kim E, Moisan MP, Parker KL 1993 Characterization of the mouse FTZ-F1 gene, which encodes a key regulator of steroid hydroxylase gene expression. Mol Endocrinol 7:852–860[Abstract/Free Full Text]
  35. Morohashi K 1999 Gonadal and extragonadal functions of Ad4BP/SF-1: developmental aspects. Trends Endocrinol Metab 10:169–173[CrossRef][Medline]
  36. Parker KL, Schimmer BP 1997 Steroidogenic factor 1: a key determinant of endocrine development and function. Endocr Rev 18:361–377[Abstract/Free Full Text]
  37. Morohashi K, Iida H, Nomura M, Hatano O, Honda S, Tsukiyama T, Niwa O, Hara T, Takakusu A, Shibata Y, Omura T 1994 Functional difference between Ad4BP and ELP, and their distributions in steroidogenic tissues. Mol Endocrinol 8:643–653[Abstract/Free Full Text]
  38. Morohashi K 1997 The ontogenesis of the steroidogenic tissues. Genes Cells 2:95–106[Abstract]
  39. Borg B 1994 Androgens in teleost fishes. Comp Biochem Physiol 109:219–245[CrossRef]
  40. Lokman PM, Harris B, Kusakabe M, Kime DE, Schulz RW, Adachi S, Young G 2002 11-Oxygenated androgens in female teleosts: prevalence, abundance, and life history implications. Gen Comp Endocrinol 129:1–12[CrossRef][Medline]
  41. Liu S, Govoroun M, D’Cotta H, Ricordel MJ, Lareyre JJ, McMeel OM, Smith T, Nagahama Y, Guiguen Y 2000 Expression of cytochrome P450(11β) (11β-hydroxylase) gene during gonadal sex differentiation and spermatogenesis in rainbow trout, Oncorhynchus mykiss. J Steroid Biochem Mol Biol 75:291–298[CrossRef][Medline]
  42. Yokota H, Abe T, Nakai M, Murakami H, Eto C, Yakabe Y 2005 Effects of 4-tert-pentylphenol on the gene expression of P450 11β-hydroxylase in the gonad of medaka (Oryzias latipes). Aquat Toxicol 71:121–132[CrossRef][Medline]
  43. Socorro S, Martins RS, Deloffre L, Mylonas CC, Canario AV 2007 A cDNA for European sea bass (Dicentrachus labrax) 11β-hydroxylase: gene expression during the thermosensitive period and gonadogenesis. Gen Comp Endocrinol 150:164–173[CrossRef][Medline]
  44. Hsueh AJ, Erickson GF 1978 Glucocorticoid inhibition of FSH-induced estrogen production in cultured rat granulosa cells. Steroids 32:639–648[CrossRef][Medline]
  45. Valli G, Sudha S, Ravi Sankar B, Govindarajulu P, Srinivasan N 2000 Altered corticosterone status impairs steroidogenesis in the granulosa and thecal cells of Wistar rats. J Steroid Biochem Mol Biol 73:153–158[CrossRef][Medline]
  46. Fru KN, VandeVoort CA, Chaffin CL 2006 Mineralocorticoid synthesis during the periovulatory interval in macaques. Biol Reprod 75:568–574[Abstract/Free Full Text]
  47. Hu YC, Wang PH, Yeh S, Wang RS, Xie C, Xu Q, Zhou X, Chao HT, Tsai MY, Chang C 2004 Subfertility and defective folliculogenesis in female mice lacking androgen receptor. Proc Natl Acad Sci USA 101:11209–11214[Abstract/Free Full Text]
  48. Matsubara H LP, Senaha A, Kazeto Y, Ijiri S, Kambegawa A, Hirai T, Youg G, Todo T, Adachi S, Yamauchi K 2003 Synthesis and possible function of 11-ketotestosterone during oogenesis in eel (Anguilla japonica). Fish Physiol Biochem 28:353–354[CrossRef]



This article has been cited by other articles:


Home page
 J. Histochem. Cytochem.Home page
E. P. Gomez-Sanchez, M. T. Gomez-Sanchez, A. F. de Rodriguez, D. G. Romero, M. P. Warden, M. W. Plonczynski, and C. E. Gomez-Sanchez
Immunohistochemical Demonstration of the Mineralocorticoid Receptor, 11{beta}-Hydroxysteroid Dehydrogenase-1 and -2, and Hexose-6-phosphate Dehydrogenase in Rat Ovary
J. Histochem. Cytochem., July 1, 2009; 57(7): 633 - 641.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. J. Mullins, A. Peter, N. Wrobel, J. R. McNeilly, A. S. McNeilly, E. A. S. Al-Dujaili, D. G. Brownstein, J. J. Mullins, and C. J. Kenyon
Cyp11b1 Null Mouse, a Model of Congenital Adrenal Hyperplasia
J. Biol. Chem., February 6, 2009; 284(6): 3925 - 3934.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yazawa, T.
Right arrow Articles by Miyamoto, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yazawa, T.
Right arrow Articles by Miyamoto, K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals