| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Centre for Endocrinology (S.N.C., I.A.D.V., T.R.W., J.P.C., A.J.L.C.) and Clinical Pharmacology (K.-Y.L.), William Harvey Research Institute, Barts and the London, London EC1M 6BQ, United Kingdom; School of Biological and Chemical Sciences (I.A.D.V., M.E., M.R.E.), Queen Mary University of London, London E1 1BB, United Kingdom; and Division of Molecular and Cellular Neuroscience (M.E.C.), University College of London Institute of Ophthalmology, London EC1V 9EL, United Kingdom
Address all correspondence and requests for reprints to: Professor Adrian J. L. Clark, William Harvey Research Institute, Barts and the London, Queen Mary University of London, West Smithfield, London EC1M 6BQ, United Kingdom. E-mail: a.j.clark{at}qmul.ac.uk.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
Because MC2R is efficiently translated in nonadrenal cell lines but is still nonfunctional, we have proposed that the receptor is dependent on an accessory factor for cell surface trafficking and function (3). We recently identified a novel single transmembrane domain protein that we named MC2R accessory protein (MRAP) as such a factor (12). We showed that MRAP and MC2R colocalized in the cell and coimmunoprecipitated and that cotransfection resulted in the functional expression of the MC2R in CHO-K1 and SKN-SH cells. Furthermore, a variety of mutations in MRAP were shown to be associated with familial glucocorticoid deficiency type 2, an autosomal recessive ACTH insensitivity syndrome (12).
The concept of accessory factors for GPCR expression is not new. The Drosophila cyclophilin gene Nina A (neither inactivation nor after potential A) and its mammalian homolog, Ran binding protein 2, have been identified as being essential for the folding and trafficking of R1–6 rhodopsin and red/green opsin to the cell surface (13, 14, 15). A protein named ODR4 was found to be necessary for the efficient targeting of odorant receptors to olfactory cilia in Caenorhabditis elegans (16). Dopamine receptor interacting protein (DRiP78) is required for the trafficking of the D1 dopamine receptor (17), and the small single-transmembrane domain proteins receptor activity modifying proteins (RAMPs) are required for trafficking and ligand specificity of the calcitonin receptor and the calcitonin-like receptor (18, 19). More recently receptor transporter proteins 1 and 2 and the distantly related receptor expression-enhancing proteins have been shown to promote functional cell surface expression of some of the odorant receptors (20). The RAMPs, receptor transporter proteins, and receptor expression-enhancing proteins are all relatively small single transmembrane domain containing proteins that otherwise have no sequence homology to MRAP or each other. Despite the observation that mutations in MRAP cause ACTH insensitivity, the physiological relevance of functional observations made from protein overexpression in transfected cell lines was not fully clear. Furthermore, our previous studies had not clarified the specificity of the action of MRAP.
In the work reported here, we therefore used the RNA interference approach to knock down the expression of MRAP in Y1 mouse adrenocortical cells and investigated its effect on MC2R signaling. Furthermore, because MRAP is detected on immunoblotting at a molecular mass of 32 kDa in Y1 cells that is significantly higher than the predicted size of 14.1 kDa, we explored the possibility that it may exist as a dimeric structure.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
Cell culture
Y1 mouse adrenocortical cells were grown on collagen-coated tissue culture plates in the presence of DMEM/Ham’s F10 (1:1) media (Life Technologies, Inc., Paisley, UK) supplemented with 12.5% horse serum, 2.5% fetal calf serum, and 1% penicillin/streptomycin. SKN-SH and CHO cells were grown in the presence of DMEM/Ham’s F12 (1:1) media with 10% fetal calf serum and 1% penicillin/streptomycin.
MRAP siRNA duplexes and plasmid constructs
Four 21-nucleotide siRNA duplexes targeting the first coding exon of the mouse MRAP sequence were synthesized. The sequences of the four MRAP siRNA duplexes were: duplex 2, AGTATTACCTGGACTACATTT; duplex 4, ATGAGTATTACCTGGACTATT; duplex 5, GCTGAAAGCCAAACAAGCATT; duplex 6, TCACCAGCTATGAGTATTATT. The optimum target sequence for MRAP was determined by RT-PCR analysis of MRAP gene expression in Y1 cells transfected with 25 nM each of these four MRAP siRNA duplexes. The target sequence of the MRAP siRNA duplex 6 was then used to design two complementary 55-mer siRNA template oligonucleotides encoding MRAP short hairpin RNAs (shRNAs) with BamH1 and HindIII overhangs. The two oligonucleotide used were; 5'-GATCCTCACCAGCTATGAGTATTATTC AAGAGATAATACTCATAGCTGGTGACGA-3'and 5'-AGCTTCCTCACCAGCTATGAGTA TTATCTCTTGAATAATACTCATAGCTGGT GAG-3'. The oligonucleotides were then annealed and cloned into the BamH1- and HindIII-digested pSilencer 4.1 CMV-Neo expression vector (Ambion, Cambridgeshire, UK). pRL-CMV luciferase (Promega, Southampton, UK) control plasmid was used to correct for transfection efficiency in luciferase assays. The cAMP luciferase reporter construct, glycoprotein hormone 
-subunit (-GSU)-846 (containing 846 bp of the 5' flanking sequence and 44 bp of exon 1 of the human -GSU gene, cloned in frame with the luciferase gene in the plasmid pA3Luc) was kindly donated by Professor J. Burrin (21). The mouse MRAP-Flag construct was a kind gift from Professor G. Cooper (22). The mouse MRAP-HA construct was prepared using 5'-ATCGGGATCCATGGCCA ACGGGACC-3' as the sense primer and 5'-GGTAGTCTGGGACGTCGTATGGGTAGGGGAGAGCCA-3' as the antisense primer. Human MRAP was amplified using 5'-ATGGCCAACGGACCAACG-3' as the sense primer and 5'-TCAGCTCTGCAATTGAGA-3' as the antisense primer and cloned into pcDNA3.1.
Stable transfections of shRNA expression plasmids
For the creation of stable cell lines expressing MRAP shRNA, the pSilencer 4.1 CMV-Neo-MRAP shRNA plasmid was linearized using EcoR1 and gel purified before transfecting into Y1 cells at 50% confluency. As a control the pSilencer 4.1CMV Neo plasmid (Ambion) encoding a hairpin siRNA, which shows no homology to any known gene, was also transfected into cells. Cells were selected using 500 µg/ml G418 in growth media for 20 d. Surviving clones were transferred onto a 96-well plate and when confluent were transferred to 24-, 12-, and six-well plates.
RT-PCRs and Western blotting
To detect the expression of MRAP and MC2R in Y1 cells, total RNA was extracted from cells and cDNA was synthesized and used for PCR with the MC2R and MRAP primers. MRAP primers used were 5'-ACTGTCATGGCCAACGG-3' as the sense primer and 5'-AGTGTGAGG CCAGCTGAT-3' as the antisense primer. Primers used to amplify MC2R were 5'-ATGAAGCATATTATCAATTCG-3' as the sense and 5'-CTAATACCGGTTGCAGAA-3' as the antisense primers. To detect the knockdown of MRAP expression in cells transiently transfected with MRAP siRNAs, cells were collected 24 or 48 h after transfection, and total RNA was extracted from the cell lines and used for cDNA synthesis. RT-PCRs were carried out using the MRAP and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer pairs. For Western blotting, cells were scraped into lysis buffer containing PBS+1% dodecyl maltoside+protease inhibitor cocktail, and 20 µg of protein samples, as determined by protein assay (Bio-Rad, Hertfordshire, UK), were separated by SDS-PAGE. Western blotting was performed using monoclonal anti-hemagglutinin (HA), clone HA-7 antibody, anti-Flag antibody M2, or an affinity-purified rabbit polyclonal MRAP antibody –7819 (produced to order by Severn Biotech, Worcestershire, UK) raised against an N-terminal peptide DLIPVDEKKLKA. This peptide was synthesized with an additional cysteine at both ends to provide two reactive sites for the coupling to the carrier protein keyhole limpet hemocyanin via sulfosuccinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate chemistry. The serum was affinity purified using a Thio-Link Gel gel column (Severn Biotech), following the manufacturer’s instructions. We characterized the antibody as being specific for MRAP at 1:20 dilution or Flag antibody at 1:1000 dilution. Horseradish peroxidase-conjugated goat antimouse/rabbit secondary antibodies (Upstate Biotechnology, Lake Placid, NY) were used at 1:5000 dilution.
Coimmunoprecipitations
To detect the dimerization of MRAP, CHO cells were transfected with MRAP-Flag and MRAP-HA constructs. Twenty-four hours after transfection, cells were scraped into Nonidet P-40 (NP-40) lysis buffer [150 mM NaCl, 1.0% (vol/vol) NP-40, 50 mM Tris (pH 8.0)]+protease inhibitor cocktail. For coimmunoprecipitations 150 µg of the supernatants were incubated with either 5 µg of HA or Flag antibody and left at 4 C overnight. Protein Sepharose beads (GE Healthcare, Buckinghamshire, UK) were added and incubated for another 2 h at room temperature. One hundred microliters of sodium dodecyl sulfate sample buffer were then added, and the samples were subjected to Western blotting using HA or Flag antibody at a dilution of 1:1000.
cAMP assay
Cells were covered with 10–5 M 3-isobutyl-1-methyl-xanthine in serum-free medium for 30 min at 37 C. Cells were then stimulated with 10–6 M ACTH for 30 min to generate cAMP. Cells were placed on ice, scraped into the media, and boiled for 5 min. They were then centrifuged and the supernatant was used in the cAMP competitive protein-binding assay as described (23).
Dual-Glo luciferase assay
For the siRNA experiment, 25 nM concentration of the MRAP siRNA duplex 6 or 25 nM of the negative control cyclophilin siRNA was transfected into Y1 adrenocortical cells along with -GSU-846 luciferase and pRL-CMV Renilla luciferase plasmid constructs. Twenty-four or 48 h after transfection, cells were stimulated with 10–6 M ACTH for 6 h. For the rescue of MC2R signaling in the clonal cell line 26, cells were transiently transfected with -GSU-846 luciferase, pRL-CMV Renilla luciferase and human MRAP plasmid constructs. After 48 h they were stimulated for 6 h with ACTH (10–6 M). Cell lysates were then harvested and assayed using the Dual Glo luciferase reporter assay system (Promega). Luciferase activity was measured using a multiplate reader (Wallac Victor 2 PerkinElmer, Bar Hill, UK), and values were normalized to the pRL-CMV Renilla luciferase activity.
Mass spectrometry analysis
CHO cells were seeded into four 25-cm2 cell flasks and transfected transiently with an MRAP-HA construct. Twenty-four hours after transfection, cells were lysed with 250 µl NP-40 lysis buffer containing the proteinase inhibitor cocktail. The total protein concentration was measured by Bradford assay. MRAP-HA was purified by immunoprecipitation of 150 µg of protein with 60 µl of anti HA conjugated beads, washed with the NP-40 lysis buffer, and resolved by SDS-PAGE. Proteins were analyzed using Western blotting with the anti-HA antibody or by colloidal Coomassie-blue staining.
Bands unique to MRAP-HA-transfected cells were excised, subjected to in-gel digestion with trypsin, and analyzed by a liquid chromatography-tandem mass spectrometer (QToF-micro; Waters Corp., Milford, MA). The mass spectral data were processed into peak lists (tandem mass spectrometer data) and searched against the Swiss Prot database using the MASCOT search algorithm (www.matrixscience.com). One missed cleavage per peptide was allowed. For identified MRAP peptides to be considered significant, the peptide score was typically greater than 40 (P < 0.05), and manual interpretation confirmed agreement between spectra and peptide sequence. In addition, MASCOT searches of all spectra were performed against a randomized version of the National Center for Biotechnology Information (Bethesda, MD) database using the same parameters as in the main search. In no case did this search retrieve more than a single peptide, and in all instances the peptide score was below the P = 0.05 significance level.
Statistical analysis
The data reported in this paper are the mean ± SEM of at least three independent experiments, each performed at least in duplicate. Statistical analysis of cAMP and luciferase assays was performed using ANOVA.
|
Results and Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
). We knocked down the expression of MRAP in cells by the RNA interference technique using synthetic siRNA duplexes and creating stable cell lines expressing MRAP shRNAs.
|
). We tested four siRNA duplexes because siRNA duplexes designed against different targets of the same gene can show noticeable differences in silencing efficiency. They showed variable levels of MRAP gene knockdown. In particular duplexes 2 and 6 showed a significant reduction in MRAP expression, compared with the wild-type Y1 cells. Duplex 6 appeared to be the most potent siRNA duplex sequence to knock down the expression of MRAP. Twenty-five nanomolar concentration of duplex 6 was then used to transfect Y1 cells to measure its effect on MC2R signaling. Using the Dual Glo luciferase assay system (Promega), we found a significant reduction in the MC2R signaling in cells transfected with MRAP siRNA, compared with control cells transfected with cyclophilin siRNA, at 24 and 48 h after transfection (Fig. 1C). This provided additional support that MRAP may be involved in the functional expression of MC2R, consistent with our previous findings in a transfection-based model.
These experiments were carried out using transient transfection of synthetic MRAP siRNA duplexes, and therefore, to ensure that all cells expressed MRAP siRNA and also to obtain long-term knockdown of MRAP, we explored a plasmid-based approach to create stable cell lines. Duplex 6 targeting the nucleotide sequence 5'-TCACCAGCTATGAGTATTA-3' located at nucleotides 31–50 in the N-terminal coding region of MRAP was used to design oligonucleotides encoding MRAP shRNAs. The sense and antisense template oligonucleotides were designed to encode a hairpin structure with a 19-mer stem and a 2-nt overhang derived from the 21-nt mRNA target site. They were cloned into the pSilencer 4.1 CMV-Neo expression vector and transfected into Y1 cells to select stable cell lines using G418. RT-PCR analysis showed different levels of MRAP knockdown in several clonal cell lines, with clone 26 showing the most efficient knockdown of MRAP expression (Fig. 2A).
|
) showed a predominant protein band of approximately 32 kDa in the pSilencer and wild-type Y1 cells. This 32-kDa band appeared to be markedly reduced in the lane containing clone 26.
The effect of MRAP silencing on MC2R signaling was determined by measuring cAMP production in response to ACTH (10–6 M). Three of the cell lines expressing MRAP shRNAs (clones 17, 23, and 26) were studied. The stably selected cell line transfected with pSilencer 4.1 CMV-Neo-negative control, which contains a siRNA sequence that shows no homology to any gene in the databases, was used as a control (Fig. 2A). The three clonal cell lines expressing MRAP shRNAs, which showed variable degrees of MRAP knockdown, showed a significant reduction of cAMP production in response to ACTH. Clone 26, which showed the most effective knockdown of MRAP expression, showed cAMP levels that did not increase significantly above basal levels in response to ACTH, confirming that MRAP needs to be expressed in cells for the MC2R to become functional.
Rescue of MRAP function
Because the possibility remained that the MRAP shRNA was having a nonspecific effect on ACTH signaling, an attempt was made to rescue the knockdown by transfection of MRAP. mMRAP-Flag was transfected into clone 26 cells. Immunoblotting using either anti-MRAP 7819 or anti-Flag antibody did not show that this maneuver had overcome the knockdown of MRAP protein expression (Fig. 2C). This was not unexpected because the mouse MRAP shRNAs expressed in this clonal cell line is able to degrade the introduced mouse MRAP transcript in a sequence-specific manner, leading to the failure of the MRAP protein to be expressed. Immunoblotting performed using the Flag antibody confirmed the failure of the MRAP protein to be expressed in the clonal cell line (Fig. 2D).
To determine whether the loss of MC2R signaling could be restored by the reintroduction of MRAP, the clonal cell line 26 was transfected with hMRAP-pcDNA3.1 that is resistant to silencing by the mouse MRAP shRNA sequence. It is well documented that the target gene recognition is highly sequence specific because even 1- or 2-bp mismatches between the siRNA and the target gene could greatly reduce or even abolish the silencing effect (24). The human MRAP sequence shows 10 of 19 mismatches to the mouse MRAP shRNA sequence and therefore would escape the knockdown by the mouse MRAP shRNA. This construct was transfected into cells along with the pRL-CMV Renilla luciferase plasmid, and -GSU-846 luciferase plasmids. Forty-eight hours after transfection, cells were stimulated with 10–6 M ACTH for 6 h before harvesting for luciferase assays. Figure 3 shows that cells rescued with the hMRAP regain significant cAMP signaling ability. The failure to completely restore the signal to wild-type levels may reflect the sequence divergence between hMRAP and the endogenous mouse MRAP.
|
, C and D). However, the 32-kDa band, which is constantly detected in Y1 cells and extracts from adrenal glands (data not shown), was suspected to be due to the dimerization of MRAP in a manner that is resistant to denaturing and reducing conditions.
We have previously shown that the overexpression of MRAP into nonadrenal cells such as SKN-SH and CHO cells that lack endogenous MRAP results in the detection of a band that corresponds to the size of the predicted MRAP monomer as well as a significantly higher molecular weight band (12). To probe the nature of the higher molecular weight band, we transfected CHO cells with the MRAP-HA construct and immunoprecipitated cell lysates using anti-HA conjugated beads. This was analyzed by immunoblotting or colloidal Coomassie-blue staining (Fig. 4A). The additional protein bands that appeared in the cells transfected with MRAP-HA were characterized by mass spectrometry. Two MRAP peptides were identified in both gel slices (corresponding to the monomer and dimer of MRAP) (Fig. 4A) having Mascot scores greater than 40 (P < 0.05). These data support our hypothesis that MRAP may exist as a dimer.
|
). The same observation was made when immunoprecipitations were performed using the anti-Flag antibody and immunoblotted with the anti-HA antibody on lysates from cells cotransfected with the MRAP-Flag and MRAP-HA constructs (data not shown). Therefore, we hypothesize that MRAP is able to exist as a dimer in CHO cells when exogenously expressed and that the endogenous 32-kDa protein that was mainly detected in the Y1 adrenocortical cell line is likely to be due to the dimerization of MRAP. It is not clear why the majority of the protein (endogenous or transfected) runs at the higher molecular weight in Y1 cells and at the lower size in nonadrenal cells. It is tempting to speculate that some further posttranslational modification unique to the adrenal cell line promotes formation of the stable dimeric structure despite strong denaturing and reducing conditions. There are some interesting, if superficial, parallels here with the RAMP proteins that associate with the calcitonin receptor and calcitonin-like receptor to create calcitonin gene-related peptide, adrenomedullin, calcitonin, or amylin receptors (18, 19, 25). RAMP1 has been shown to exist as a disulfide-linked homodimer in the absence of receptor and to reside in the endoplasmic reticulum. Only in the presence of receptor does this homodimer dissociate to form RAMP1- receptor heterodimers, which translocate to the cell surface (26). The MRAP data are distinct in that MRAP can translocate to the plasma membrane without receptor (12) and that the MRAP homodimer persists in the presence of the MC2R, despite reducing conditions. It is not yet clear whether MRAP remains in a dimeric form when complexed with the MC2R in adrenal cells.
In summary, we have shown that MRAP plays an essential role in the function of MC2R This role requires the direct protein-protein interaction between MRAP and the receptor. Whereas MRAP demonstrates several functional similarities to other receptor accessory proteins, its distinct features suggest a number of unique aspects. It remains to be seen whether other melanocortin receptors have similar requirements for an accessory protein.
|
Acknowledgments |
|---|
-GSU luciferase reporter and Professor G. Cooper for the MRAP-Flag expression vector. |
Footnotes |
|---|
Disclosure Statement: The authors of this manuscript have nothing to declare.
First Published Online December 27, 2007
Abbreviations: GAPDH, Glyceraldehyde-3-phosphate dehydrogenase; GPCR, G protein-coupled receptor; -GSU, glycoprotein hormone -subunit; HA, hemagglutinin; MC2R, melanocortin 2 receptor; MRAP, MC2R accessory protein; NP-40, Nonidet P-40; RAMP, receptor activity modifying protein; shRNA, short hairpin RNA; siRNA, small interfering RNA.
Received October 24, 2007.
Accepted for publication December 17, 2007.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResults and DiscussionReferences |
|---|
-subunit transcription in T3-1 gonadotropes. Endocrinology 139:1731–1737This article has been cited by other articles:
 |
|
 |
|
  I. Benoit, D. Drui, L. Chaillous, B. Dupas, J.-F. Mosnier, B. Charbonnel, and B. Cariou A corticotroph pituitary adenoma as the initial presentation of familial glucocorticoid deficiency Eur. J. Endocrinol., July 1, 2009; 161(1): 195 - 199. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. F. Chan, T. R. Webb, T.-T. Chung, E. Meimaridou, S. N. Cooray, L. Guasti, J. P. Chapple, M. Egertova, M. R. Elphick, M. E. Cheetham, et al. MRAP and MRAP2 are bidirectional regulators of the melanocortin receptor family PNAS, April 14, 2009; 106(15): 6146 - 6151. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. R. Webb, L. Chan, S. N. Cooray, M. E. Cheetham, J. P. Chapple, and A. J. L. Clark Distinct Melanocortin 2 Receptor Accessory Protein Domains Are Required for Melanocortin 2 Receptor Interaction and Promotion of Receptor Trafficking Endocrinology, February 1, 2009; 150(2): 720 - 726. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Sebag and P. M. Hinkle Regions of Melanocortin 2 (MC2) Receptor Accessory Protein Necessary for Dual Topology and MC2 Receptor Trafficking and Signaling J. Biol. Chem., January 2, 2009; 284(1): 610 - 618. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Tan, I. D. Pogozheva, G. S. H. Yeo, D. Hadaschik, J. M. Keogh, C. Haskell-Leuvano, S. O'Rahilly, H. I. Mosberg, and I. S. Farooqi Functional Characterization and Structural Modeling of Obesity Associated Mutations in the Melanocortin 4 Receptor Endocrinology, January 1, 2009; 150(1): 114 - 125. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. T. Chung, T. R. Webb, L. F. Chan, S. N. Cooray, L. A. Metherell, P. J. King, J. P. Chapple, and A. J. L. Clark The Majority of Adrenocorticotropin Receptor (Melanocortin 2 Receptor) Mutations Found in Familial Glucocorticoid Deficiency Type 1 Lead to Defective Trafficking of the Receptor to the Cell Surface J. Clin. Endocrinol. Metab., December 1, 2008; 93(12): 4948 - 4954. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
25 kDa) and heavy IgG (