| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Physiology (J.T.S., A.R., A.P., I.J.C.), Monash University, Victoria 3880, Australia; Unité Mixte de Recherche 6175 (A.C.), Institut National de la Recherche Agronomique/Centre National de la Recherche Scientifique, Université de Tours, Haras Nationaux, Institut Fédératif de Recherche 135, 37380 Nouzilly, France; and Medical Research Council Human Reproductive Sciences Unit (R.P.M.), The Queens Medical Research Institute, Edinburgh EH16 4TJ, United Kingdom
Address all correspondence and requests for reprints to: Professor Iain Clarke, Department of Physiology, P.O. Box 13F, Monash University, Victoria 3880, Australia. E-mail: iain.clarke{at}med.monash.edu.au.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The sheep is an ideal model to study the effects of kisspeptin on the pituitary because the gland is large and yields a high number of cells for primary cell culture and the hypothalamo-pituitary disconnection (HPD) model allows for analysis of direct action of agents on GnRH-stimulated gonadotropin secretion in vivo (12, 22). Furthermore, the methodology is well established for the collection of hypophysial portal blood from sentient animals (23).
The objectives of the present study were to determine whether kisspeptin acts on the pituitary gland to regulate the secretion of LH. First, we examined expression of GPR54 mRNA in fractions of pituitary cells enriched for gonadotropes, somatotropes and lactotropes. Second, we determined the effect of kisspeptin on primary pituitary cell cultures in vitro. Third, the effects of kisspeptin were examined in vivo using the HPD model, and finally, we determined the concentration of kisspeptin in the portal circulation and tested whether levels change during an estrogen-induced GnRH/LH surge.
| Materials and Methods |
|---|
|
|
|---|
Experiment 1: quantitative RT-PCR of GPR54 mRNA
Pituitary cells were collected from gonad-intact ewes; the cells dissociated; and then passed through Percoll gradients to provide fractions enriched for gonadotropes, somatotropes, and lactotropes, as described previously (25, 26). GPR54 mRNA quantitative RT-PCR was performed using total RNA extracted from pituitary cell fractions using the TRIzol reagent method (Invitrogen, Sydney, New South Wales, Australia). First-strand cDNA was synthesized using AMV-RT and oligo (dt) (Roche Diagnostics Corp., Indianapolis, IN). The reverse transcription reaction contained 1 µg of tRNA and was incubated at 42 C for 90 min followed by 95 C for 2 min in a final volume of 20 µl. The resultant cDNA was used as a template for PCR primers designed against the ovine GPR54 cDNA sequence (based on the genomic DNA sequence cloned by Professor Colin Clay, Colorado State University, Fort Collins, CO). This partial sequence shares 83% homology with bases 432–920 of the murine GPR54 cDNA sequence (GenBank accession no. AF343726) and 87% homology with bases 578-1066 of the human sequence (GenBank accession no. NM_032551). The GPR54 primers used were sense GGC AGC TGC TGG TAG AGC and antisense AGC GAA GAG CAG GAC CAC. Quantitative PCR was performed in 20-µl reaction volumes using the Realplex 4 from Eppendorf with RealMaster Mix with SYBR solution (Eppendorf AG, Hamburg, Germany). The regular 80-bp GPR54 PCR product was extracted (Geneclean II kit; Q-BIOgene, Irvine, CA), quantified by spectrophotometry, and then used to generate a standard curve via serial dilutions in RNase-free water (0.125–1250 fg/µl). The PCR cycling conditions included an initial denaturation at 95 C for 2 min, followed by 50 cycles at 95 C for 10 sec, 58 C for 15 sec, and 68 C for 20 sec. Fluorescence values were analyzed, and a standard curve was constructed using the Realplex 4 software. Melting-curve analysis showed a single GPR54 PCR product, and this was confirmed by gel electrophoresis (80 bp product, data not shown). Whole hypothalami (extending from the preoptic area to the mammillary bodies) were collected at the time of pituitary dissection in ewes and mRNA extracted from fragments and used as positive control for GPR54 mRNA RT-PCR. All PCR data were normalized to the amount of cyclophilin transcript (sense, GGTGACTTCACACGCCATAA; antisense, GGTGATCTTCTTGCTGGTCT).
The cellular content of each Percoll fraction was determined before RT-PCR in an aliquot of cells by immunocytochemistry (data not shown) using primary antibodies against LH (mouse monoclonal) (27), prolactin (rabbit polyclonal from Professor A. McNeilly, Medical Research Council Human Reproductive Sciences Unit, Edinburgh, UK) and GH (mouse monoclonal, from Professor M. Brandon (Melbourne University, School of Veterinary Sciences) (28). Cellular content of gonadotropin enriched Percoll fractions was further confirmed by quantitative RT-PCR (data not shown) with primers against LHβ mRNA (sense, GGC TAC TGC CTC AGC ATG AA; antisense, AAG GAG ACC ATT GGG TCC AC; 140 bp product; GenBank accession no. NM_001009380) and FSH mRNA (sense, TAT TGC TAC ACC CGG GAC TT; antisense, TTT CAC CGT CTC GTA CAC CA; 96 bp product; GenBank accession no. NM_001009798). The PCR conditions were as above (annealing temperatures: LHβ, 60.4 C; FSHβ, 62.9 C).
Experiment 2: effect of kisspeptin on pituitary cells in vitro
Experiment 2a. Pituitary glands were collected from ovary-intact (follicular and luteal phase) ewes and OVX ewes (n = 4–5/group) and placed into culture media (DMEM plus 10% fetal calf serum). The pituitary was then minced and dissociated with collagenase, DNase, hyaluronidase, trypsin inhibitor, and pancreatin (25). After extraction, cells were cultured in 24-well plates for 72 h. Cells were then preincubated in treatment serum-free media [DMEM plus 0.5% BSA for 2 h and then exposed to human kisspeptin-10 (human Kiss1 [112–121]-NH2); Phoenix Pharmaceuticals, Belmont, CA] or vehicle (medium alone) treatment (12 wells/treatment). Human kisspeptin-10 was introduced to the treatment media to achieve a final concentration of 10–9 M (1 nM) and control cells received vehicle. After 3 h, medium was removed to measure the accumulated LH secretion and was replaced with medium containing vehicle, human kisspeptin-10, or GnRH (10–9 M; Auspep Pty. Ltd., Parkville, Victoria, Australia), such that half of the cells initially treated with kisspeptin, or vehicle, continued this treatment (6 wells/treatment), whereas the other half were treated with 10–9 M GnRH (6 wells/treatment). After a further 2 h, media were collected for LH RIA.
Experiment 2b. The purpose of this experiment was to determine whether kisspeptin administration augments the effect of GnRH on LH secretion from cultured pituitary cells. Follicular phase animals were killed (n = 3) and the primary pituitary cell culture established as above. Cells were treated with GnRH (10–9 M), human kisspeptin-10 (10–9 M), or both GnRH and human kisspeptin-10; control was culture media alone. After 3 h media were collected for LH RIA.
Experiment 2c. The purpose of this experiment was to determine the LH response of cultured follicular phase pituitary cells to variable doses of kisspeptin. Follicular-phase animals were killed (n = 3) and the primary pituitary cell culture established as above. Cells were treated with human kisspeptin-10 at doses of 10–11, 10–10, and 10–9 M. After 3 h media were collected for LH RIA.
Experiment 3: effect of kisspeptin on the pituitary in vivo
Experiment 3a. The in vivo action of kisspeptin at the level of the pituitary gland was determined using HPD ewes. All HPD animals were bilaterally OVX at least 1 month before the experiment, and the HPD surgery was performed as previously described (12, 22). The latter procedure removes all neural inputs to the median eminence, but gonadotropin secretion can be restored by iv administration of GnRH in a pulsatile fashion. Approximately 1 wk after HPD surgery, the animals were housed in single pens, and one external jugular vein was cannulated for infusion of GnRH in 2 hourly pulses of 250 ng (29). GnRH was diluted in heparinized saline and delivered iv using an infusion pump programmed to deliver 2.25-ml pulses over 6 min every 2 h. Animals received 2 hourly GnRH pulses for 7 d (to produce a fully functional gonadotrope), after which time kisspeptin treatment began. At 0530 h, animals were disconnected from infusion pumps and all remaining GnRH pulses (0600, 0800, 1000, 1200, and 1400 h) were delivered through the jugular cannula by hand (250 ng GnRH in 5 ml heparinized saline, 50 IU/liter). At 1100 h, 100 µg of mouse kisspeptin-10 [murine C-terminal Kiss1 decapeptide (110–119)-NH2] or vehicle (n = 4/group) was administered via the jugular cannula. Blood samples were collected at –5, +5, +10, +15, +20, +30, and +55 min after the mouse kisspeptin-10 injection. Blood was also collected at the same times for both the preceding (1000 h) and two following (1200 and 1400 h) GnRH pulses. For positive control, doses of mouse kisspeptin-10 (100 and 20 µg, iv) were given to OVX hypothalamo-pituitary intact ewes. All blood samples were collected into heparinized tubes and plasma harvested for LH RIA.
Experiment 3b. We determined the effect of a constant infusion of mouse kisspeptin-10 on LH secretion in OVX-HPD ewes. OVX-HPD ewes (n = 3/group) were prepared as above, and a second jugular venous cannula was inserted for kisspeptin (or vehicle) infusion (5 ml/h), which was delivered for 1 h (500 µg/h) beginning at 1130 h using Graseby MS16A infusion pumps (Smiths Medical Australasia Pty. Ltd., Gold Coast, Queensland, Australia). The GnRH replacement protocol was the same as in experiment 3a. Mouse kisspeptin-10 was diluted in heparinized saline to achieve an infusion concentration of 100 µg/ml. Blood samples were collected (as above) before and after kisspeptin (or vehicle) infusion.
Experiment 3c. A bolus iv injection of mouse kisspeptin-10 was given simultaneously with a GnRH pulse in GnRH-replaced, OVX-HPD ewes. Animals (n = 4/group) were prepared as above and kisspeptin (or vehicle) was administered as a bolus injection (500 µg in 5 ml heparinized saline) with the 1200 h GnRH pulse. Blood samples were collected as above.
Experiment 3d. Effect of kisspeptin on LH secretion in estrogen-treated, GnRH-replaced, OVX-HPD ewes. This was performed because we had observed an in vitro effect of kisspeptin in cultures of pituitary cells taken from ewes during the follicular phase of the estrous cycle. We aimed to replicate the endocrine conditions of the late follicular phase in OVX-HPD ewes (22). Animals (n = 3/group) were prepared as above but were infused with GnRH (250 ng) at hourly pulses for 7 d. On d 8, blood samples were collected at –5, +5, +10, +15, +20, +30, and +55 min around the 1400 and 1500 h GnRH pulse. After this time (1500 h pulse), 50 µg of estradiol benzoate (Intervet; Baulkham Hills, New South Wales, Australia) was injected (im in oil) to each animal. Samples were then taken 18 h later around the 0900 h pulse, and then at 1000 h animals received a bolus iv injection of mouse kisspeptin-10 (500 µg) with a lower dose pulse of GnRH (50 ng). Samples were collected at –5, +5, +10, +15, +20, +30, and +55 min after the kisspeptin/GnRH injection. Plasma was collected for LH RIA.
Experiment 4: determination of kisspeptin in the hypophysial portal circulation
Six OVX ewes were prepared for hypophysial portal blood sampling by implantation of a needle that was directed at the portal vessels on the anterior surface of the pituitary gland as previously described (23, 30). Approximately 1 wk after surgery, one external jugular vein was cannulated (12 gauge Dwellcath; Tuta Laboratories, Lane Cove, New South Wales, Australia) and kept patent with heparinized saline for measurement of peripheral LH concentration. Three animals were sampled without treatment, and another three were given an im injection of 50 µg of estradiol benzoate (in 1 ml oil) to induce preovulatory-like GnRH/LH surges (31) 14 h before commencement of sampling. Lesioning of the hypophysial portal vessels was performed at 0830 h after whole-body heparinization (30), and sampling commenced when constant blood flow was established from the portal (approximately 1000 h). Portal blood samples (1.5–2 ml) were obtained by suction via the implanted portal access needle using a peristaltic pump, and jugular venous samples were collected at the end of every portal collection period (5 to 10 min intervals, depending on the portal flow rate) for 6 h. Portal blood samples were collected into ice cold tubes containing 50 µl aprotinin (1.5 mg/ml) and 50 µl bacitracin (5 mM) (Sigma-Aldrich, Castle Hill, New South Wales, Australia). After 6 h of collection, OVX ewes were administered human kisspeptin-10 [10 µg, human Kiss1 (112–121)-NH2; Phoenix Pharmaceuticals] using the jugular line. Portal sampling continued for a further 30 min and samples were included as kisspeptin assay positive control. Plasma was harvested immediately from paired jugular and portal samples and frozen at –20 C until assayed (jugular, LH; portal, kisspeptin).
LH RIA
Plasma LH concentrations were measured in duplicate, using the method of Lee et al. (32) with NIH-oLH-S18 as standard. Assay results were calculated using the program of Burger et al. (33). Assay sensitivity was 0.12 ng/ml and the intraassay coefficient of variation was less than 10% over the range of 0.2–8.1 ng/ml.
Kisspeptin RIA
Antibody no. 564 was raised in rabbit immunized with synthetic mouse kisspeptin-10 [corresponding to the murine C-terminal Kiss1 decapeptide (110–119)-NH2, synthesized by NeoMPS, Strasbourg, France] conjugated to BSA by glutaraldehyde and used at a final dilution of 1:300,000. Mouse kisspeptin-10 is an identical match to the predicted ovine C-terminal Kiss1 decapeptide (GenBank accession no. DQ059506). The antibody did not cross-react (<0.0001%) with GnRH, galanin, substance P, neuropeptide Y, CRH,
MSH, somatostatin, and prolactin-releasing peptide. Only a small degree of cross-reactivity (around 1–2%; four assays) was observed with the human kisspeptin-10 molecule (corresponding to the human C-terminal Kiss1 decapeptide 112–121-NH2). The 125I-kisspeptin-10 was prepared using the Cloramine-T method and purified on reverse-phase HPLC on a C18 column (Nova-Pak C18, 3.9 x 150 mm; Waters, Milford, MA) over a 20–100% 30-min gradient of acetonitrile/potassium formate buffer [0.05 mol/liter (pH 4.0)]. Portal samples were extracted with acidified methanol, evaporated to dryness, and reconstituted in 1 ml assay buffer [barbitone buffer 125 mmol, 0.3% BSA, 0.1% Triton X-100 (pH 8.5)]. Extracts of peripheral (jugular vein) samples taken with aprotinin, and bacitracin served as procedural blank and to perform the standard curve. Duplicates of reconstituted extracts were assayed. Briefly, samples or standards (100 µl) were incubated with diluted antibody for 24 h at 4 C. Then 125I-kisspeptin-10 was added (30,000 cpm) for 12 h. Finally, bound and free 125I-kisspeptin-10 were separated by a double-antibody method using a sheep antirabbit
-globulin. Recovery of 10 pg mouse kisspeptin-10 added to plasma averaged 75–80% (four assays). The average assay sensitivity was 4 pg/ml and the intraassay coefficient of variation average 12% (four assays). All samples from an individual ewe were measured in duplicate in the same assay. Human kisspeptin-10 treatment in OVX ewes resulted in an immediate increase in the plasma concentration of kisspeptin in all ewes (28.6 ± 2.2 pg/ml), and this declined to basal levels within 10 min (data not shown). This resultant concentration is consistent with the dose of human kisspeptin-10 administered and the cross-reactivity of the murine kisspeptin antibody to human kisspeptin-10.
Statistical analysis
Data are presented as the mean (±SEM). To represent results for different cell culture experiments, levels of LH in culture media are normalized for basal secretion. Statistical analyses were performed using SPSS (version 14.0, SPSS Inc., Chicago, IL). For in vitro experiments, as well as analysis of GPR54 mRNA, differences among groups were assessed by one- or two-way ANOVA, using least significant differences as a post hoc test. For the in vivo HPD experiments, differences were initially assessed by two-way (repeated measures) ANOVA. Area under the curve (Sigma-Plot 9.0) was calculated for the 60 min after each GnRH pulse, and differences between kisspeptin and saline treatment were compared using one-way ANOVA. Differences were considered significant when P < 0.05. For the hypophysial portal kisspeptin experiments, a pulse analysis of the LH data were performed based on the method described for GnRH (31). LH surges were taken to have begun when a clearly evident monophasic rise in plasma LH levels occurred, as previously described (31).
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
The effect of kisspeptins on gonadotropin secretion is unequivocal. Kisspeptins stimulate a rapid and robust release of LH in a wide variety of species when administered centrally or peripherally (6, 8, 9, 10, 11). The stimulatory effect of kisspeptins on gonadotropins is thought to be due to central actions of kisspeptins on GnRH secretion. Whereas the notion that GnRH neurons are targets of kisspeptins is well supported (3, 11, 34, 35), GnRH antagonist data cannot completely rule out an effect of kisspeptin on the pituitary. This is due to the fact that synthesis and secretion of gonadotropins does not occur in the absence of GnRH trophic support (12, 13). Because patients with disabling mutations of GPR54 are clearly able to respond to GnRH (36), kisspeptin does not appear to be critical to pituitary gonadotropin release. A modulatory role is possible during in vivo conditions different from those explored in the present study, but our present data strongly suggest that this is not the case, at least in the ovine species.
Real-time RT-PCR analysis showed that GPR54 mRNA is expressed in pituitary gonadotrope-enriched cell fractions, which is consistent with previous results obtained by conventional PCR (5, 7), but we show that this expression in gonadotrope fractions is similar to that in fractions enriched for lactotropes and somatotropes. Furthermore, GPR54 mRNA expression in pituitary cells appeared similar to the level of expression in dissected whole hypothalamic blocks. A direct comparison of GPR54 mRNA expression between pituitary and hypothalamus would be difficult to interpret, given the nature of the starting material (i.e. concentrated pituitary cells vs. whole hypothalamus, which includes areas that do not contain kisspeptin responsive cells), but we believe that the similar level of expression indicates that the pituitary gonadotropes express GPR54 at a low abundance. Whereas this predicates a role for kisspeptin in the direct regulation/modulation of pituitary cell function, we have been able to show this only in the particular condition of in vitro culture of cells from ewes in the follicular phase of the estrous cycle. Thus, under specific in vitro conditions, not replicated in our in vivo data, kisspeptin may have some direct effect at the pituitary. Furthermore, GPR54 mRNA expression in lactotrope and somatotrope enriched pituitary cell fractions highlight the possible role of kisspeptin in GH and/or prolactin secretion as demonstrated recently (14). This possibility is under current investigation in our laboratory.
Using the HPD ewe, we are uniquely placed to be able to assess the direct effect of kisspeptin on the pituitary in vivo. HPD surgery eliminates the hypothalamic control of the pituitary, whereas not depriving the pituitary of its blood supply (12, 22). Kisspeptin was unable to stimulate LH secretion in HPD ewes when given either as a bolus injection or infusion. Importantly, the doses of kisspeptin tested on HPD ewes were in the equivalent range to doses used by us, and others (14, 15, 16), to stimulate LH secretion from pituitary cells in vitro. This calculation is based of the average blood volume of a sheep (approximately 4 liters). Thus, a 100-µg injection of kisspeptin would result in a concentration of approximately 25 ng/ml (or
20 nM). This is within the effective dose range of Gutierrez-Pascual et al. (14), and our own, experiments. Given that kisspeptin was able to stimulate LH from pituitary cell culture of follicular phase ewes in vitro, we considered that kisspeptin may play a role at the pituitary in the generation of the estrogen-induced LH surge. This was achieved by administration of kisspeptin in OVX-HPD ewes, given GnRH replacement and an im injection of estradiol benzoate to elicit a biphasic effect on pulsatile LH secretion (22). HPD ewes demonstrated the characteristic beginnings of a late follicular surge in LH secretion in response to exogenous GnRH pulses 18 h after the delivery of the estradiol benzoate injection, as reported previously (22). Administration of kisspeptin at this time did not influence LH secretion, strongly suggesting that there is no major role for kisspeptin at the level of the pituitary gonadotrope at the time of estrogen-positive feedback. Importantly, kisspeptin administration was able to stimulate LH from hypothalamo-pituitary-intact ewes, presumably by acting solely at the level of the GnRH neuron. These data provide strong support to the notion that kisspeptins do not effect LH secretion by directly targeting the pituitary gonadotrope.
We have been able to detect kisspeptin in the hypophysial portal blood of sheep, providing unequivocal evidence of secretion. In sheep, varicose neuronal terminals immunoreactive for kisspeptin are found in the external zone of the medium eminence (18, 19), although these are most likely distinct from GnRH terminals (see Introduction) (18, 21). The present data indicate that kisspeptin is secreted from these terminals into the portal circulation in a stochastic manner, and there is no evidence that this relates to pulsatile LH secretion; the portal kisspeptin pulses and the peripheral LH pulses were not coincident. We investigated the possibility that an increase in kisspeptin secretion may occur at the time of an estrogen-induced GnRH/LH surge, but there was no evidence of this. It is interesting to note that the level of kisspeptin we detected by RIA in the portal blood was in the overall range of 1–12 pg/ml, which is several orders of magnitude lower than the doses of kisspeptin used to achieve responses in the pituitary in vitro (14, 15, 16, 37). This raises the question as to whether effects of kisspeptin that are seen with high doses in vitro may represent pharmacological responses. Despite this, the presence of kisspeptin in portal blood, together with the presence of functional receptors in pituitary tissue, could indicate that a constant kisspeptin tone may play a modulatory role at the pituitary.
In vitro studies in rat pituitary explants have shown that kisspeptins stimulate LH release and augment GnRH-induced FSH release (14, 15, 16), although other similar studies showed no effect (10, 17). Our data show an effect of kisspeptin in a dose-dependent manner but only in cells from follicular phase ewes, suggesting some role for kisspeptin, but we have not been able to replicate this in vivo. This was despite the fact that the doses of kisspeptin used to illicit a LH response in vitro were not effective in vivo (in the HPD ewe) and far exceed the concentration of kisspeptin determined in the hypophysial portal circulation by RIA. Our in vitro results are somewhat similar to a recently published paper using bovine and porcine anterior pituitary cell cultures, albeit with extraordinarily high doses of kisspeptin (37). No response to kisspeptin was observed in pituitary cell cultures from ewes at the luteal phase of the estrous cycle or in OVX ewes, suggesting that any effect may be restricted to discrete physiological conditions. In this regard, it is interesting to note that kisspeptin expression in the arcuate nucleus is up-regulated before the onset of the cyclic GnRH/LH surge in the ewe (38), and there may be a window during which action of kisspeptin is important. It is possible that tonic secretion of kisspeptin plays a modulatory role at the level of the pituitary gland. This disparity in LH response to kisspeptin in pituitary cell culture from ewes at differing phases of the estrous cycle is intriguing and suggests that pituitary cells in culture retain some memory of their in situ environment in vitro. It is possible that long-term treatment with kisspeptin could influence response to GnRH in vivo, although this would be a very difficult experiment to conduct. This has been noted previously with estrogen treatment in rat pituitary cells (39).
Our experiments show that the effect of kisspeptin on follicular phase ovine pituitary cell culture is transient. After the initial 3-h incubation period, culture media were collected (for analysis) and replaced with fresh media (containing further treatment) for an additional 2 h. During this time kisspeptin had no effect on LH release in culture. Pituitary cells remained viable during this time because they were able to elicit a LH response to treatment with GnRH. We believe that this demise in responsiveness to kisspeptin involves some intrinsic change within the pituitary cells. A similar down-regulatory effect on kisspeptin response has recently been documented in the male rhesus monkey, in which continuous infusion elicited a brisk LH response for the first 3 h, followed by a precipitous fall in LH thereafter (40). Interestingly, this fall in LH response is not seen when repeated pulsatile administration of kisspeptin is given (41). The decline in LH response to continuous kisspeptin administration was countered with bolus injections of the GnRH agonist N-methyl-DL-aspartic, indicating the integrity of the GnRH neuron remains and the effect is possibly due to GPR54 receptor down-regulation (40). It would be instructive to examine expression of GPR54 mRNA expression in pituitary cells after various GnRH and/or kisspeptin treatments. Furthermore, action of kisspeptin on pituitary cells could be interrogated further by determination of alterations in postreceptor signaling.
There is no resounding evidence from our studies, or others, to suggest kisspeptin has a major stimulatory role directly targeting the pituitary gland. Our data in the sheep also show that kisspeptin does not augment the rise in LH seen with GnRH treatment in vitro or in vivo. Kisspeptin does appear to stimulate LH release from cultured pituitary, but this effect was seen only in pituitaries taken from follicular phase ewes and at a dose far exceeding that of the concentration of kisspeptin in the hypophysial portal circulation. No effect of kisspeptin on the pituitary was observed in HPD ewes in vivo, even when the hormonal milieu associated with the positive feedback effect of estrogen was invoked. Overall, these data suggest that the in vitro responses to kisspeptin seen in pituitary cells from follicular phase ewes represent a circumstance that is not relevant to in vivo function of kisspeptin.
| Acknowledgments |
|---|
| Footnotes |
|---|
Disclosure Statement: The authors have nothing to disclose.
First Published Online December 27, 2007
Abbreviations: GPR, G protein-coupled receptor; HPD, hypothalamo-pituitary disconnection; OVX, ovariectomized.
Received October 18, 2007.
Accepted for publication December 17, 2007.
| References |
|---|
|
|
|---|
. Neurosci Lett 401:225–230[CrossRef][Medline]This article has been cited by other articles:
![]() |
J. T. Smith, Q. Li, A. Pereira, and I. J. Clarke Kisspeptin Neurons in the Ovine Arcuate Nucleus and Preoptic Area Are Involved in the Preovulatory Luteinizing Hormone Surge Endocrinology, December 1, 2009; 150(12): 5530 - 5538. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. P. Williams III, E. M. Gibson, C. Wang, S. Tjho, N. Khattar, G. E. Bentley, K. Tsutsui, and L. J. Kriegsfeld Proximate mechanisms driving circadian control of neuroendocrine function: Lessons from the young and old Integr. Comp. Biol., November 1, 2009; 49(5): 519 - 537. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Oakley, D. K. Clifton, and R. A. Steiner Kisspeptin Signaling in the Brain Endocr. Rev., October 1, 2009; 30(6): 713 - 743. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Li, Y. Zhang, Y. Liu, X. Huang, W. Huang, D. Lu, P. Zhu, Y. Shi, C. H K Cheng, X. Liu, et al. Structural and functional multiplicity of the kisspeptin/GPR54 system in goldfish (Carassius auratus) J. Endocrinol., June 1, 2009; 201(3): 407 - 418. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Magee, C. D. Foradori, J. E. Bruemmer, J. A. Arreguin-Arevalo, P. M. McCue, R. J. Handa, E. L. Squires, and C. M. Clay Biological and Anatomical Evidence for Kisspeptin Regulation of the Hypothalamic-Pituitary-Gonadal Axis of Estrous Horse Mares Endocrinology, June 1, 2009; 150(6): 2813 - 2821. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Anderson, H.-L. Relf, M. Z. Rizwan, and J. J. Evans Central and Peripheral Effects of RFamide-Related Peptide-3 on Luteinizing Hormone and Prolactin Secretion in Rats Endocrinology, April 1, 2009; 150(4): 1834 - 1840. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Z. Rizwan, R. Porteous, A. E. Herbison, and G. M. Anderson Cells Expressing RFamide-Related Peptide-1/3, the Mammalian Gonadotropin-Inhibitory Hormone Orthologs, Are Not Hypophysiotropic Neuroendocrine Neurons in the Rat Endocrinology, March 1, 2009; 150(3): 1413 - 1420. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.K. Roseweir and R.P. Millar The role of kisspeptin in the control of gonadotrophin secretion Hum. Reprod. Update, March 1, 2009; 15(2): 203 - 212. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ramaswamy, K. A. Guerriero, R. B. Gibbs, and T. M. Plant Structural Interactions between Kisspeptin and GnRH Neurons in the Mediobasal Hypothalamus of the Male Rhesus Monkey (Macaca mulatta) as Revealed by Double Immunofluorescence and Confocal Microscopy Endocrinology, September 1, 2008; 149(9): 4387 - 4395. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |