help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2007-1425
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, J. T.
Right arrow Articles by Clarke, I. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, J. T.
Right arrow Articles by Clarke, I. J.
Endocrinology Vol. 149, No. 4 1951-1959
Copyright © 2008 by The Endocrine Society

Kisspeptin Is Present in Ovine Hypophysial Portal Blood But Does Not Increase during the Preovulatory Luteinizing Hormone Surge: Evidence that Gonadotropes Are Not Direct Targets of Kisspeptin in Vivo

J. T. Smith, A. Rao, A. Pereira, A. Caraty, R. P. Millar and I. J. Clarke

Department of Physiology (J.T.S., A.R., A.P., I.J.C.), Monash University, Victoria 3880, Australia; Unité Mixte de Recherche 6175 (A.C.), Institut National de la Recherche Agronomique/Centre National de la Recherche Scientifique, Université de Tours, Haras Nationaux, Institut Fédératif de Recherche 135, 37380 Nouzilly, France; and Medical Research Council Human Reproductive Sciences Unit (R.P.M.), The Queen’s Medical Research Institute, Edinburgh EH16 4TJ, United Kingdom

Address all correspondence and requests for reprints to: Professor Iain Clarke, Department of Physiology, P.O. Box 13F, Monash University, Victoria 3880, Australia. E-mail: iain.clarke{at}med.monash.edu.au.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
There is strong evidence that kisspeptin acts to regulate GnRH secretion, but whether there is also a component of action on the gonadotropes is not clear. Using quantitative RT-PCR, we found that G protein-coupled receptor-54 mRNA is expressed in ovine pituitary cell fractions enriched for gonadotropes as well as in somatotropes and lactotropes. To test whether kisspeptin acts directly on the pituitary gonadotropes, we first examined LH release from primary ovine pituitary cell cultures treated with kisspeptin. We found that kisspeptin treatment increased the concentration of LH in culture media by 80%, compared with control, but only in pituitary cultures from ewes during the follicular phase of the estrous cycle. After this, we determined whether kisspeptin acts on the pituitary gland in vivo. Using GnRH-replaced ovariectomized hypothalamo-pituitary-disconnected ewes, we were not able to achieve any effect of kisspeptin on LH under steady-state conditions or during the period of an estrogen-induced LH surge. Finally, we collected hypophysial portal blood samples from ovariectomized ewes and measured kisspeptin levels. Low but detectable amounts of kisspeptin were found in portal plasma, but levels were similar in ovariectomized ewes that were untreated or given estrogen to elicit an LH surge. Thus, although we observed an effect of kisspeptin on LH release in vitro in some situations, similar findings were not obtained in vivo. Moreover, the low concentrations of kisspeptin in hypophysial portal blood and the lack of any change during the period of an estrogen-induced GnRH/LH surge suggest that action on the pituitary gland is not of major consequence in terms of LH release.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IN 2003 IT WAS discovered that mutations in the gene for the receptor, G protein-coupled receptor (GPR)-54, resulted in hypogonadotropic hypogonadism (1, 2). It is now recognized that GPR54, and its natural ligands, the kisspeptins, are key mediators in the neuroendocrine regulation of reproduction. GPR54 is expressed in various levels of the brain (3, 4, 5, 6) and also the pituitary (5, 7). Kisspeptins are encoded from the Kiss1 gene and potently stimulate the secretion of LH in many species (6, 8, 9, 10, 11). Because this stimulatory effect of kisspeptin was blocked by a GnRH antagonist, it has been suggested that the effect of kisspeptin is manifest exclusively at the level of GnRH secretion (3, 9, 10). This is, however, not definitive proof of selective brain function because the synthesis and secretion of gonadotropins from the gonadotropes does not occur in the absence of the tropic input of GnRH (12, 13). Some studies in rats indicate a pituitary action of kisspeptin to regulate gonadotropin secretion (14, 15, 16), but others do not (10, 17). Kisspeptin-immunoreactive terminals are found at the exterior zone of the median eminence in the ovine brain (18, 19) but not in the rodent (20). Colocalization of kisspeptin and GnRH was observed in the sheep with one antiserum (Phoenix) (19), but this was not the case with another (Caraty) (Franceschini, I., and A. Caraty, personal communication), and it was subsequently shown that this was possibly due to nonspecificity of the former (21). Thus, it is unlikely that the colocalization of GnRH and kisspeptin is accurate. Nevertheless, the presence of kisspeptin-immunoreactive terminals in the median eminence has been observed with both antisera, so it is possible that kisspeptins are secreted into the hypophysial portal blood of this species to act on the pituitary gonadotropes.

The sheep is an ideal model to study the effects of kisspeptin on the pituitary because the gland is large and yields a high number of cells for primary cell culture and the hypothalamo-pituitary disconnection (HPD) model allows for analysis of direct action of agents on GnRH-stimulated gonadotropin secretion in vivo (12, 22). Furthermore, the methodology is well established for the collection of hypophysial portal blood from sentient animals (23).

The objectives of the present study were to determine whether kisspeptin acts on the pituitary gland to regulate the secretion of LH. First, we examined expression of GPR54 mRNA in fractions of pituitary cells enriched for gonadotropes, somatotropes and lactotropes. Second, we determined the effect of kisspeptin on primary pituitary cell cultures in vitro. Third, the effects of kisspeptin were examined in vivo using the HPD model, and finally, we determined the concentration of kisspeptin in the portal circulation and tested whether levels change during an estrogen-induced GnRH/LH surge.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
All experimental procedures were conducted under a protocol approved by the Monash School of Biomedical Sciences A Animal Ethics Committee. Adult Corriedale ewes were housed under natural lighting, and, where appropriate, animals were bilaterally ovariectomized (OVX) at least 1 month before any experimental manipulations as previously described (24). For the use of gonad-intact animals, estrous cycles were synchronized by im injection of 125 µg of the synthetic luteolysin (Cloprostenol, Estrumate; Pitman-Moore, Sydney, New South Wales, Australia). For cell culture, ewes were euthanized either 24 h after injection (follicular phase) or on d 10 of the ensuing estrous cycle (luteal phase), and the stage of cycle was confirmed by examination of ovaries for the presence or absence of ovarian follicles or corpora lutea.

Experiment 1: quantitative RT-PCR of GPR54 mRNA
Pituitary cells were collected from gonad-intact ewes; the cells dissociated; and then passed through Percoll gradients to provide fractions enriched for gonadotropes, somatotropes, and lactotropes, as described previously (25, 26). GPR54 mRNA quantitative RT-PCR was performed using total RNA extracted from pituitary cell fractions using the TRIzol reagent method (Invitrogen, Sydney, New South Wales, Australia). First-strand cDNA was synthesized using AMV-RT and oligo (dt) (Roche Diagnostics Corp., Indianapolis, IN). The reverse transcription reaction contained 1 µg of tRNA and was incubated at 42 C for 90 min followed by 95 C for 2 min in a final volume of 20 µl. The resultant cDNA was used as a template for PCR primers designed against the ovine GPR54 cDNA sequence (based on the genomic DNA sequence cloned by Professor Colin Clay, Colorado State University, Fort Collins, CO). This partial sequence shares 83% homology with bases 432–920 of the murine GPR54 cDNA sequence (GenBank accession no. AF343726) and 87% homology with bases 578-1066 of the human sequence (GenBank accession no. NM_032551). The GPR54 primers used were sense GGC AGC TGC TGG TAG AGC and antisense AGC GAA GAG CAG GAC CAC. Quantitative PCR was performed in 20-µl reaction volumes using the Realplex 4 from Eppendorf with RealMaster Mix with SYBR solution (Eppendorf AG, Hamburg, Germany). The regular 80-bp GPR54 PCR product was extracted (Geneclean II kit; Q-BIOgene, Irvine, CA), quantified by spectrophotometry, and then used to generate a standard curve via serial dilutions in RNase-free water (0.125–1250 fg/µl). The PCR cycling conditions included an initial denaturation at 95 C for 2 min, followed by 50 cycles at 95 C for 10 sec, 58 C for 15 sec, and 68 C for 20 sec. Fluorescence values were analyzed, and a standard curve was constructed using the Realplex 4 software. Melting-curve analysis showed a single GPR54 PCR product, and this was confirmed by gel electrophoresis (80 bp product, data not shown). Whole hypothalami (extending from the preoptic area to the mammillary bodies) were collected at the time of pituitary dissection in ewes and mRNA extracted from fragments and used as positive control for GPR54 mRNA RT-PCR. All PCR data were normalized to the amount of cyclophilin transcript (sense, GGTGACTTCACACGCCATAA; antisense, GGTGATCTTCTTGCTGGTCT).

The cellular content of each Percoll fraction was determined before RT-PCR in an aliquot of cells by immunocytochemistry (data not shown) using primary antibodies against LH (mouse monoclonal) (27), prolactin (rabbit polyclonal from Professor A. McNeilly, Medical Research Council Human Reproductive Sciences Unit, Edinburgh, UK) and GH (mouse monoclonal, from Professor M. Brandon (Melbourne University, School of Veterinary Sciences) (28). Cellular content of gonadotropin enriched Percoll fractions was further confirmed by quantitative RT-PCR (data not shown) with primers against LHβ mRNA (sense, GGC TAC TGC CTC AGC ATG AA; antisense, AAG GAG ACC ATT GGG TCC AC; 140 bp product; GenBank accession no. NM_001009380) and FSH mRNA (sense, TAT TGC TAC ACC CGG GAC TT; antisense, TTT CAC CGT CTC GTA CAC CA; 96 bp product; GenBank accession no. NM_001009798). The PCR conditions were as above (annealing temperatures: LHβ, 60.4 C; FSHβ, 62.9 C).

Experiment 2: effect of kisspeptin on pituitary cells in vitro
Experiment 2a. Pituitary glands were collected from ovary-intact (follicular and luteal phase) ewes and OVX ewes (n = 4–5/group) and placed into culture media (DMEM plus 10% fetal calf serum). The pituitary was then minced and dissociated with collagenase, DNase, hyaluronidase, trypsin inhibitor, and pancreatin (25). After extraction, cells were cultured in 24-well plates for 72 h. Cells were then preincubated in treatment serum-free media [DMEM plus 0.5% BSA for 2 h and then exposed to human kisspeptin-10 (human Kiss1 [112–121]-NH2); Phoenix Pharmaceuticals, Belmont, CA] or vehicle (medium alone) treatment (12 wells/treatment). Human kisspeptin-10 was introduced to the treatment media to achieve a final concentration of 10–9 M (1 nM) and control cells received vehicle. After 3 h, medium was removed to measure the accumulated LH secretion and was replaced with medium containing vehicle, human kisspeptin-10, or GnRH (10–9 M; Auspep Pty. Ltd., Parkville, Victoria, Australia), such that half of the cells initially treated with kisspeptin, or vehicle, continued this treatment (6 wells/treatment), whereas the other half were treated with 10–9 M GnRH (6 wells/treatment). After a further 2 h, media were collected for LH RIA.

Experiment 2b. The purpose of this experiment was to determine whether kisspeptin administration augments the effect of GnRH on LH secretion from cultured pituitary cells. Follicular phase animals were killed (n = 3) and the primary pituitary cell culture established as above. Cells were treated with GnRH (10–9 M), human kisspeptin-10 (10–9 M), or both GnRH and human kisspeptin-10; control was culture media alone. After 3 h media were collected for LH RIA.

Experiment 2c. The purpose of this experiment was to determine the LH response of cultured follicular phase pituitary cells to variable doses of kisspeptin. Follicular-phase animals were killed (n = 3) and the primary pituitary cell culture established as above. Cells were treated with human kisspeptin-10 at doses of 10–11, 10–10, and 10–9 M. After 3 h media were collected for LH RIA.

Experiment 3: effect of kisspeptin on the pituitary in vivo
Experiment 3a. The in vivo action of kisspeptin at the level of the pituitary gland was determined using HPD ewes. All HPD animals were bilaterally OVX at least 1 month before the experiment, and the HPD surgery was performed as previously described (12, 22). The latter procedure removes all neural inputs to the median eminence, but gonadotropin secretion can be restored by iv administration of GnRH in a pulsatile fashion. Approximately 1 wk after HPD surgery, the animals were housed in single pens, and one external jugular vein was cannulated for infusion of GnRH in 2 hourly pulses of 250 ng (29). GnRH was diluted in heparinized saline and delivered iv using an infusion pump programmed to deliver 2.25-ml pulses over 6 min every 2 h. Animals received 2 hourly GnRH pulses for 7 d (to produce a fully functional gonadotrope), after which time kisspeptin treatment began. At 0530 h, animals were disconnected from infusion pumps and all remaining GnRH pulses (0600, 0800, 1000, 1200, and 1400 h) were delivered through the jugular cannula by hand (250 ng GnRH in 5 ml heparinized saline, 50 IU/liter). At 1100 h, 100 µg of mouse kisspeptin-10 [murine C-terminal Kiss1 decapeptide (110–119)-NH2] or vehicle (n = 4/group) was administered via the jugular cannula. Blood samples were collected at –5, +5, +10, +15, +20, +30, and +55 min after the mouse kisspeptin-10 injection. Blood was also collected at the same times for both the preceding (1000 h) and two following (1200 and 1400 h) GnRH pulses. For positive control, doses of mouse kisspeptin-10 (100 and 20 µg, iv) were given to OVX hypothalamo-pituitary intact ewes. All blood samples were collected into heparinized tubes and plasma harvested for LH RIA.

Experiment 3b. We determined the effect of a constant infusion of mouse kisspeptin-10 on LH secretion in OVX-HPD ewes. OVX-HPD ewes (n = 3/group) were prepared as above, and a second jugular venous cannula was inserted for kisspeptin (or vehicle) infusion (5 ml/h), which was delivered for 1 h (500 µg/h) beginning at 1130 h using Graseby MS16A infusion pumps (Smiths Medical Australasia Pty. Ltd., Gold Coast, Queensland, Australia). The GnRH replacement protocol was the same as in experiment 3a. Mouse kisspeptin-10 was diluted in heparinized saline to achieve an infusion concentration of 100 µg/ml. Blood samples were collected (as above) before and after kisspeptin (or vehicle) infusion.

Experiment 3c. A bolus iv injection of mouse kisspeptin-10 was given simultaneously with a GnRH pulse in GnRH-replaced, OVX-HPD ewes. Animals (n = 4/group) were prepared as above and kisspeptin (or vehicle) was administered as a bolus injection (500 µg in 5 ml heparinized saline) with the 1200 h GnRH pulse. Blood samples were collected as above.

Experiment 3d. Effect of kisspeptin on LH secretion in estrogen-treated, GnRH-replaced, OVX-HPD ewes. This was performed because we had observed an in vitro effect of kisspeptin in cultures of pituitary cells taken from ewes during the follicular phase of the estrous cycle. We aimed to replicate the endocrine conditions of the late follicular phase in OVX-HPD ewes (22). Animals (n = 3/group) were prepared as above but were infused with GnRH (250 ng) at hourly pulses for 7 d. On d 8, blood samples were collected at –5, +5, +10, +15, +20, +30, and +55 min around the 1400 and 1500 h GnRH pulse. After this time (1500 h pulse), 50 µg of estradiol benzoate (Intervet; Baulkham Hills, New South Wales, Australia) was injected (im in oil) to each animal. Samples were then taken 18 h later around the 0900 h pulse, and then at 1000 h animals received a bolus iv injection of mouse kisspeptin-10 (500 µg) with a lower dose pulse of GnRH (50 ng). Samples were collected at –5, +5, +10, +15, +20, +30, and +55 min after the kisspeptin/GnRH injection. Plasma was collected for LH RIA.

Experiment 4: determination of kisspeptin in the hypophysial portal circulation
Six OVX ewes were prepared for hypophysial portal blood sampling by implantation of a needle that was directed at the portal vessels on the anterior surface of the pituitary gland as previously described (23, 30). Approximately 1 wk after surgery, one external jugular vein was cannulated (12 gauge Dwellcath; Tuta Laboratories, Lane Cove, New South Wales, Australia) and kept patent with heparinized saline for measurement of peripheral LH concentration. Three animals were sampled without treatment, and another three were given an im injection of 50 µg of estradiol benzoate (in 1 ml oil) to induce preovulatory-like GnRH/LH surges (31) 14 h before commencement of sampling. Lesioning of the hypophysial portal vessels was performed at 0830 h after whole-body heparinization (30), and sampling commenced when constant blood flow was established from the portal (approximately 1000 h). Portal blood samples (1.5–2 ml) were obtained by suction via the implanted portal access needle using a peristaltic pump, and jugular venous samples were collected at the end of every portal collection period (5 to 10 min intervals, depending on the portal flow rate) for 6 h. Portal blood samples were collected into ice cold tubes containing 50 µl aprotinin (1.5 mg/ml) and 50 µl bacitracin (5 mM) (Sigma-Aldrich, Castle Hill, New South Wales, Australia). After 6 h of collection, OVX ewes were administered human kisspeptin-10 [10 µg, human Kiss1 (112–121)-NH2; Phoenix Pharmaceuticals] using the jugular line. Portal sampling continued for a further 30 min and samples were included as kisspeptin assay positive control. Plasma was harvested immediately from paired jugular and portal samples and frozen at –20 C until assayed (jugular, LH; portal, kisspeptin).

LH RIA
Plasma LH concentrations were measured in duplicate, using the method of Lee et al. (32) with NIH-oLH-S18 as standard. Assay results were calculated using the program of Burger et al. (33). Assay sensitivity was 0.12 ng/ml and the intraassay coefficient of variation was less than 10% over the range of 0.2–8.1 ng/ml.

Kisspeptin RIA
Antibody no. 564 was raised in rabbit immunized with synthetic mouse kisspeptin-10 [corresponding to the murine C-terminal Kiss1 decapeptide (110–119)-NH2, synthesized by NeoMPS, Strasbourg, France] conjugated to BSA by glutaraldehyde and used at a final dilution of 1:300,000. Mouse kisspeptin-10 is an identical match to the predicted ovine C-terminal Kiss1 decapeptide (GenBank accession no. DQ059506). The antibody did not cross-react (<0.0001%) with GnRH, galanin, substance P, neuropeptide Y, CRH, {alpha}MSH, somatostatin, and prolactin-releasing peptide. Only a small degree of cross-reactivity (around 1–2%; four assays) was observed with the human kisspeptin-10 molecule (corresponding to the human C-terminal Kiss1 decapeptide 112–121-NH2). The 125I-kisspeptin-10 was prepared using the Cloramine-T method and purified on reverse-phase HPLC on a C18 column (Nova-Pak C18, 3.9 x 150 mm; Waters, Milford, MA) over a 20–100% 30-min gradient of acetonitrile/potassium formate buffer [0.05 mol/liter (pH 4.0)]. Portal samples were extracted with acidified methanol, evaporated to dryness, and reconstituted in 1 ml assay buffer [barbitone buffer 125 mmol, 0.3% BSA, 0.1% Triton X-100 (pH 8.5)]. Extracts of peripheral (jugular vein) samples taken with aprotinin, and bacitracin served as procedural blank and to perform the standard curve. Duplicates of reconstituted extracts were assayed. Briefly, samples or standards (100 µl) were incubated with diluted antibody for 24 h at 4 C. Then 125I-kisspeptin-10 was added (30,000 cpm) for 12 h. Finally, bound and free 125I-kisspeptin-10 were separated by a double-antibody method using a sheep antirabbit {gamma}-globulin. Recovery of 10 pg mouse kisspeptin-10 added to plasma averaged 75–80% (four assays). The average assay sensitivity was 4 pg/ml and the intraassay coefficient of variation average 12% (four assays). All samples from an individual ewe were measured in duplicate in the same assay. Human kisspeptin-10 treatment in OVX ewes resulted in an immediate increase in the plasma concentration of kisspeptin in all ewes (28.6 ± 2.2 pg/ml), and this declined to basal levels within 10 min (data not shown). This resultant concentration is consistent with the dose of human kisspeptin-10 administered and the cross-reactivity of the murine kisspeptin antibody to human kisspeptin-10.

Statistical analysis
Data are presented as the mean (±SEM). To represent results for different cell culture experiments, levels of LH in culture media are normalized for basal secretion. Statistical analyses were performed using SPSS (version 14.0, SPSS Inc., Chicago, IL). For in vitro experiments, as well as analysis of GPR54 mRNA, differences among groups were assessed by one- or two-way ANOVA, using least significant differences as a post hoc test. For the in vivo HPD experiments, differences were initially assessed by two-way (repeated measures) ANOVA. Area under the curve (Sigma-Plot 9.0) was calculated for the 60 min after each GnRH pulse, and differences between kisspeptin and saline treatment were compared using one-way ANOVA. Differences were considered significant when P < 0.05. For the hypophysial portal kisspeptin experiments, a pulse analysis of the LH data were performed based on the method described for GnRH (31). LH surges were taken to have begun when a clearly evident monophasic rise in plasma LH levels occurred, as previously described (31).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Experiment 1: GPR54 expression in pituitary gonadotropes
GPR54 mRNA was detectable by RT-PCR in cellular fractions of ovine pituitary cells enriched for gonadotropes (Fig. 1Go). Quantitative analysis revealed that the level of expression in gonadotropes was similar to that of fractions enriched for somatotropes and lactotropes. The level of GPR54 mRNA expression in all pituitary cell fractions was also comparable with the expression in the whole hypothalamus (Fig. 1Go).


Figure 1
View larger version (21K):
[in this window]
[in a new window]

 
FIG. 1. Relative levels of GPR54 mRNA in cellular fractions of ovine pituitary cells enriched for lactotropes, somatotropes, or gonadotropes as well as whole hypothalamus. Data are normalized to cyclophilin mRNA expression and are the mean ± SEM.

 
Experiment 2: effects of kisspeptin on the pituitary release of LH in vitro
Experiment 2a. Kisspeptin treatment resulted in an 80% increase in the concentration of LH in media from primary cultures of pituitary cells taken from ewes during the follicular phase of the estrous cycle (P < 0.01, Fig. 2Go). There was no effect of kisspeptin on LH concentration in cultures from pituitary glands taken from ewes either during the luteal phase of the estrous cycle or from OVX ewes (Fig. 2Go). In the follicular-phase pituitary cell cultures treated with kisspeptin for 3 h, the concentration of LH after continued kisspeptin treatment for the ensuing 2 h was similar to control (Fig. 3Go). In all cell cultures, whether treated previously with kisspeptin or control, GnRH treatment caused a significant increase in LH concentration (P < 0.05, Fig. 3Go).


Figure 2
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 2. The effect of kisspeptin treatment (10–9 M) on LH levels in media from 0–3 h primary ovine pituitary cell culture. LH responses are from pituitaries taken from ewes at the follicular and luteal phases of the estrous cycle as well as from OVX ewes. Data are expressed as the proportion of control and values are the mean ± SEM. **, P < 0.01. Con, Control.

 

Figure 3
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 3. The effect of kisspeptin (10–9 M) and GnRH (10–9 M) treatment on LH levels in media from 3- to 5-h primary ovine pituitary cell culture. LH responses are from pituitaries taken from ewes at the follicular and luteal phases of the estrous cycle as well as from OVX ewes. Data are expressed as the proportion of control and values are the mean ± SEM. *, P < 0.05. Con, Control.

 
Experiment 2b. Kisspeptin treatment increased the concentration of LH in culture media by 3-fold, compared with control (P < 0.05) in follicular phase pituitary cell cultures. This increase was comparable with that of GnRH treatment (2.8-fold increase, P < 0.05, compared with control, Fig. 4Go). Combined kisspeptin and GnRH treatment yielded a similar increase in LH concentrations in media (2.7-fold increase, P < 0.05, compared with control).


Figure 4
View larger version (15K):
[in this window]
[in a new window]

 
FIG. 4. The effect of combined kisspeptin (10–9 M) and GnRH (10–9 M) treatment on LH levels in media from 0- to 3-h primary ovine pituitary cell culture. LH responses are from pituitaries taken from ewes at the follicular phase of the estrous cycle. Data are expressed as the proportion of control and values are the mean ± SEM. *, P < 0.05. Con, Control.

 
Experiment 2c. The lowest effective dose of kisspeptin that stimulated LH secretion in cultures of pituitary cells from follicular phase ewes was 10–10 M (or 100 pM, P < 0.05) with no significant effect seen at a dose of 10–11 M (10 pM, Fig. 5Go). The response to kisspeptin appeared highest at 10–9 M (1 nM, P < 0.01).


Figure 5
View larger version (16K):
[in this window]
[in a new window]

 
FIG. 5. Effects of different doses of kisspeptin on LH levels in media from 0- to 3-h primary ovine pituitary cell culture. LH responses are from pituitaries taken from ewes at the follicular phase of the estrous cycle. Data are expressed as the proportion of control and values are the mean ± SEM. *, P < 0.05; **, P < 0.01. Con, Control.

 
Experiment 3: effects of kisspeptin on the pituitary release of LH in vivo
In all four in vivo experiments, there was no effect of kisspeptin treatment on LH concentrations in HPD ewes (Fig. 6Go). There was a significant effect of GnRH treatment on LH concentration in all experiments (P < 0.0001), but there was no significant interaction of kisspeptin treatment on the effect of GnRH. Likewise, analyses of the area under the curve failed to report any change in LH levels with kisspeptin treatment in all experiments (Table 1Go). In OVX hypothalamo-pituitary-intact animals, kisspeptin treatment (100 µg) resulted in a 4-fold increase in LH concentrations, whereas a 20-µg dose increased LH by 3-fold (data not shown).


Figure 6
View larger version (35K):
[in this window]
[in a new window]

 
FIG. 6. Plasma concentrations of LH in HPD ewes treated with kisspeptin (closed squares) or saline (open circles). Closed boxes on the x-axis represent kisspeptin treatment: experiment 3a, 100 µg; experiment 3b, 500 µg/h infusion; experiments 3c and 3d, 500 µg. Open boxes on the x-axis represent GnRH treatment (250 ng), the smaller open box on the x-axis of experiment 3d represents a lower dose of GnRH treatment (50 ng). The arrow on the x-axis of experiment 3d represents estradiol benzoate (EB) injection (50 µg). Data are the mean ± SEM.

 

View this table:
[in this window]
[in a new window]

 
TABLE 1. Area under plasma LH concentration vs. time curves for the 60-min postkisspeptin treatment (90 min for experiment 3b) in HPD ewes

 
Experiment 4: kisspeptin in the hypophysial portal circulation
Figure 7Go shows data from three OVX ewes (ewes 1–3) and three OVX ewes treated with estradiol benzoate 14 h prior (ewes 4–6). In OVX ewes the major secretory episodes of LH were clearly distinguishable. The baseline concentration of kisspeptin during this time was approximately 2–5 pg/ml, and moderate fluctuating secretory episodes over time were apparent. These did not appear to be directly coincident with LH pulses in our study. In OVX ewes sampled 14 h after estradiol benzoate treatment, LH surges were clearly visible. Because this is known to coincide with a GnRH surge (31), we did not measure portal GnRH levels. The baseline concentration of kisspeptin in the hypophysial portal circulation over this period was approximately 1–4 pg/ml, and there did not appear to be any major change in kisspeptin secretory episodes or overall concentration of kisspeptin during this time.


Figure 7
View larger version (43K):
[in this window]
[in a new window]

 
FIG. 7. Concentrations of kisspeptin in hypophysial portal plasma (closed squares) and LH in jugular venous plasma (open circles) in three OVX ewes (ewes 1–3) and three OVX ewes that were treated with 50 µg estradiol benzoate and sampled during the resultant LH surge (ewes 4–6). Arrows indicate LH pulses and dashed lines indicate the onset of the LH surge, as defined in Materials and Methods.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We show that GPR54 mRNA is expressed in fractions of pituitary cells enriched for gonadotropes, but this level of expression was not statistically different to fractions enriched for somatotropes or lactotropes. We also show that kisspeptin is unable to stimulate LH release in the HPD ewe. Under four different in vivo experimental regimens, peripheral kisspeptin administration failed to elicit a LH response, or augment the LH response to GnRH. Moreover, we show for the first time that kisspeptin is present in the hypophysial portal circulation. Hypophysial kisspeptin secretion appeared to be secreted in a stochastic manner, and secretory episodes were not synchronous with LH pulses, nor was elevation seen at the time of an estrogen-induced GnRH/LH surge. Kisspeptin did stimulate LH release, from primary pituitary cell cultures in vitro. However, this in vitro response was seen only in cultured cells taken from animals in the follicular phase of the estrous cycle, with no effect of kisspeptin seen in cell cultures of cells taken from luteal phase or OVX ewes. Furthermore, kisspeptin did not augment GnRH-stimulated LH secretion in vitro. On balance, these data strongly suggest that kisspeptin is unlikely to be major direct regulator of the pituitary gonadotropes.

The effect of kisspeptins on gonadotropin secretion is unequivocal. Kisspeptins stimulate a rapid and robust release of LH in a wide variety of species when administered centrally or peripherally (6, 8, 9, 10, 11). The stimulatory effect of kisspeptins on gonadotropins is thought to be due to central actions of kisspeptins on GnRH secretion. Whereas the notion that GnRH neurons are targets of kisspeptins is well supported (3, 11, 34, 35), GnRH antagonist data cannot completely rule out an effect of kisspeptin on the pituitary. This is due to the fact that synthesis and secretion of gonadotropins does not occur in the absence of GnRH trophic support (12, 13). Because patients with disabling mutations of GPR54 are clearly able to respond to GnRH (36), kisspeptin does not appear to be critical to pituitary gonadotropin release. A modulatory role is possible during in vivo conditions different from those explored in the present study, but our present data strongly suggest that this is not the case, at least in the ovine species.

Real-time RT-PCR analysis showed that GPR54 mRNA is expressed in pituitary gonadotrope-enriched cell fractions, which is consistent with previous results obtained by conventional PCR (5, 7), but we show that this expression in gonadotrope fractions is similar to that in fractions enriched for lactotropes and somatotropes. Furthermore, GPR54 mRNA expression in pituitary cells appeared similar to the level of expression in dissected whole hypothalamic blocks. A direct comparison of GPR54 mRNA expression between pituitary and hypothalamus would be difficult to interpret, given the nature of the starting material (i.e. concentrated pituitary cells vs. whole hypothalamus, which includes areas that do not contain kisspeptin responsive cells), but we believe that the similar level of expression indicates that the pituitary gonadotropes express GPR54 at a low abundance. Whereas this predicates a role for kisspeptin in the direct regulation/modulation of pituitary cell function, we have been able to show this only in the particular condition of in vitro culture of cells from ewes in the follicular phase of the estrous cycle. Thus, under specific in vitro conditions, not replicated in our in vivo data, kisspeptin may have some direct effect at the pituitary. Furthermore, GPR54 mRNA expression in lactotrope and somatotrope enriched pituitary cell fractions highlight the possible role of kisspeptin in GH and/or prolactin secretion as demonstrated recently (14). This possibility is under current investigation in our laboratory.

Using the HPD ewe, we are uniquely placed to be able to assess the direct effect of kisspeptin on the pituitary in vivo. HPD surgery eliminates the hypothalamic control of the pituitary, whereas not depriving the pituitary of its blood supply (12, 22). Kisspeptin was unable to stimulate LH secretion in HPD ewes when given either as a bolus injection or infusion. Importantly, the doses of kisspeptin tested on HPD ewes were in the equivalent range to doses used by us, and others (14, 15, 16), to stimulate LH secretion from pituitary cells in vitro. This calculation is based of the average blood volume of a sheep (approximately 4 liters). Thus, a 100-µg injection of kisspeptin would result in a concentration of approximately 25 ng/ml (or ~20 nM). This is within the effective dose range of Gutierrez-Pascual et al. (14), and our own, experiments. Given that kisspeptin was able to stimulate LH from pituitary cell culture of follicular phase ewes in vitro, we considered that kisspeptin may play a role at the pituitary in the generation of the estrogen-induced LH surge. This was achieved by administration of kisspeptin in OVX-HPD ewes, given GnRH replacement and an im injection of estradiol benzoate to elicit a biphasic effect on pulsatile LH secretion (22). HPD ewes demonstrated the characteristic beginnings of a late follicular surge in LH secretion in response to exogenous GnRH pulses 18 h after the delivery of the estradiol benzoate injection, as reported previously (22). Administration of kisspeptin at this time did not influence LH secretion, strongly suggesting that there is no major role for kisspeptin at the level of the pituitary gonadotrope at the time of estrogen-positive feedback. Importantly, kisspeptin administration was able to stimulate LH from hypothalamo-pituitary-intact ewes, presumably by acting solely at the level of the GnRH neuron. These data provide strong support to the notion that kisspeptins do not effect LH secretion by directly targeting the pituitary gonadotrope.

We have been able to detect kisspeptin in the hypophysial portal blood of sheep, providing unequivocal evidence of secretion. In sheep, varicose neuronal terminals immunoreactive for kisspeptin are found in the external zone of the medium eminence (18, 19), although these are most likely distinct from GnRH terminals (see Introduction) (18, 21). The present data indicate that kisspeptin is secreted from these terminals into the portal circulation in a stochastic manner, and there is no evidence that this relates to pulsatile LH secretion; the portal kisspeptin pulses and the peripheral LH pulses were not coincident. We investigated the possibility that an increase in kisspeptin secretion may occur at the time of an estrogen-induced GnRH/LH surge, but there was no evidence of this. It is interesting to note that the level of kisspeptin we detected by RIA in the portal blood was in the overall range of 1–12 pg/ml, which is several orders of magnitude lower than the doses of kisspeptin used to achieve responses in the pituitary in vitro (14, 15, 16, 37). This raises the question as to whether effects of kisspeptin that are seen with high doses in vitro may represent pharmacological responses. Despite this, the presence of kisspeptin in portal blood, together with the presence of functional receptors in pituitary tissue, could indicate that a constant kisspeptin tone may play a modulatory role at the pituitary.

In vitro studies in rat pituitary explants have shown that kisspeptins stimulate LH release and augment GnRH-induced FSH release (14, 15, 16), although other similar studies showed no effect (10, 17). Our data show an effect of kisspeptin in a dose-dependent manner but only in cells from follicular phase ewes, suggesting some role for kisspeptin, but we have not been able to replicate this in vivo. This was despite the fact that the doses of kisspeptin used to illicit a LH response in vitro were not effective in vivo (in the HPD ewe) and far exceed the concentration of kisspeptin determined in the hypophysial portal circulation by RIA. Our in vitro results are somewhat similar to a recently published paper using bovine and porcine anterior pituitary cell cultures, albeit with extraordinarily high doses of kisspeptin (37). No response to kisspeptin was observed in pituitary cell cultures from ewes at the luteal phase of the estrous cycle or in OVX ewes, suggesting that any effect may be restricted to discrete physiological conditions. In this regard, it is interesting to note that kisspeptin expression in the arcuate nucleus is up-regulated before the onset of the cyclic GnRH/LH surge in the ewe (38), and there may be a window during which action of kisspeptin is important. It is possible that tonic secretion of kisspeptin plays a modulatory role at the level of the pituitary gland. This disparity in LH response to kisspeptin in pituitary cell culture from ewes at differing phases of the estrous cycle is intriguing and suggests that pituitary cells in culture retain some memory of their in situ environment in vitro. It is possible that long-term treatment with kisspeptin could influence response to GnRH in vivo, although this would be a very difficult experiment to conduct. This has been noted previously with estrogen treatment in rat pituitary cells (39).

Our experiments show that the effect of kisspeptin on follicular phase ovine pituitary cell culture is transient. After the initial 3-h incubation period, culture media were collected (for analysis) and replaced with fresh media (containing further treatment) for an additional 2 h. During this time kisspeptin had no effect on LH release in culture. Pituitary cells remained viable during this time because they were able to elicit a LH response to treatment with GnRH. We believe that this demise in responsiveness to kisspeptin involves some intrinsic change within the pituitary cells. A similar down-regulatory effect on kisspeptin response has recently been documented in the male rhesus monkey, in which continuous infusion elicited a brisk LH response for the first 3 h, followed by a precipitous fall in LH thereafter (40). Interestingly, this fall in LH response is not seen when repeated pulsatile administration of kisspeptin is given (41). The decline in LH response to continuous kisspeptin administration was countered with bolus injections of the GnRH agonist N-methyl-DL-aspartic, indicating the integrity of the GnRH neuron remains and the effect is possibly due to GPR54 receptor down-regulation (40). It would be instructive to examine expression of GPR54 mRNA expression in pituitary cells after various GnRH and/or kisspeptin treatments. Furthermore, action of kisspeptin on pituitary cells could be interrogated further by determination of alterations in postreceptor signaling.

There is no resounding evidence from our studies, or others, to suggest kisspeptin has a major stimulatory role directly targeting the pituitary gland. Our data in the sheep also show that kisspeptin does not augment the rise in LH seen with GnRH treatment in vitro or in vivo. Kisspeptin does appear to stimulate LH release from cultured pituitary, but this effect was seen only in pituitaries taken from follicular phase ewes and at a dose far exceeding that of the concentration of kisspeptin in the hypophysial portal circulation. No effect of kisspeptin on the pituitary was observed in HPD ewes in vivo, even when the hormonal milieu associated with the positive feedback effect of estrogen was invoked. Overall, these data suggest that the in vitro responses to kisspeptin seen in pituitary cells from follicular phase ewes represent a circumstance that is not relevant to in vivo function of kisspeptin.


    Acknowledgments
 
We thank Mr. B. Doughton, Ms. L. Morrish, Ms. E. Leeson, Ms. C. Woodd, and Ms. J. Thomas for technical assistance. We also thank Professor C. M. Clay (Colorado State University, Fort Collins, CO) for the ovine GPR54 genomic DNA sequence. Professor A. McNeilly (Medical Research Council Human Reproductive Sciences Unit, Edinburgh, UK) provided the prolactin antibody, and Professor M. Brandon (Melbourne University, Melbourne, Australia) provided the GH antibody.


    Footnotes
 
This work was supported by the National Health and Medical Research Council of Australia (384124). J.T.S. is supported by a Peter Doherty Fellowship (384362). A.C. is supported by an "Agence Nationale de la Recherche" grant (FrenchKiss no. BLAN 07-3_185025).

Disclosure Statement: The authors have nothing to disclose.

First Published Online December 27, 2007

Abbreviations: GPR, G protein-coupled receptor; HPD, hypothalamo-pituitary disconnection; OVX, ovariectomized.

Received October 18, 2007.

Accepted for publication December 17, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. de Roux N, Genin E, Carel JC, Matsuda F, Chaussain JL, Milgrom E 2003 Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc Natl Acad Sci USA 100:10972–10976[Abstract/Free Full Text]
  2. Seminara SB, Messager S, Chatzidaki EE, Thresher RR, Acierno Jr JS, Shagoury JK, Bo-Abbas Y, Kuohung W, Schwinof KM, Hendrick AG, Zahn D, Dixon J, Kaiser UB, Slaugenhaupt SA, Gusella JF, O’Rahilly S, Carlton MB, Crowley Jr WF, Aparicio SA, Colledge WH 2003 The GPR54 gene as a regulator of puberty. N Engl J Med 349:1614–1627[Abstract/Free Full Text]
  3. Irwig MS, Fraley GS, Smith JT, Acohido BV, Popa SM, Cunningham MJ, Gottsch ML, Clifton DK, Steiner RA 2004 Kisspeptin activation of gonadotropin releasing hormone neurons and regulation of KiSS-1 mRNA in the male rat. Neuroendocrinology 80:264–272[CrossRef][Medline]
  4. Lee DK, Nguyen T, O’Neill GP, Cheng R, Liu Y, Howard AD, Coulombe N, Tan CP, Tang-Nguyen AT, George SR, O’Dowd BF 1999 Discovery of a receptor related to the galanin receptors. FEBS Lett 446:103–107[CrossRef][Medline]
  5. Muir AI, Chamberlain L, Elshourbagy NA, Michalovich D, Moore DJ, Calamari A, Szekeres PG, Sarau HM, Chambers JK, Murdock P, Steplewski K, Shabon U, Miller JE, Middleton SE, Darker JG, Larminie CG, Wilson S, Bergsma DJ, Emson P, Faull R, Philpott KL, Harrison DC 2001 AXOR12, a novel human G protein-coupled receptor, activated by the peptide KiSS-1. J Biol Chem 276:28969–28975[Abstract/Free Full Text]
  6. Shahab M, Mastronardi C, Seminara SB, Crowley WF, Ojeda SR, Plant TM 2005 Increased hypothalamic GPR54 signaling: a potential mechanism for initiation of puberty in primates. Proc Natl Acad Sci USA 102:2129–2134[Abstract/Free Full Text]
  7. Kotani M, Detheux M, Vandenbogaerde A, Communi D, Vanderwinden JM, Le Poul E, Brezillon S, Tyldesley R, Suarez-Huerta N, Vandeput F, Blanpain C, Schiffmann SN, Vassart G, Parmentier M 2001 The metastasis suppressor gene KiSS-1 encodes kisspeptins, the natural ligands of the orphan G protein-coupled receptor GPR54. J Biol Chem 276:34631–34636[Abstract/Free Full Text]
  8. Dhillo WS, Chaudhri OB, Patterson M, Thompson EL, Murphy KG, Badman MK, McGowan BM, Amber V, Patel S, Ghatei MA, Bloom SR 2005 Kisspeptin-54 stimulates the hypothalamic-pituitary gonadal axis in human males. J Clin Endocrinol Metab 90:6609–6615[Abstract/Free Full Text]
  9. Gottsch ML, Cunningham MJ, Smith JT, Popa SM, Acohido BV, Crowley WF, Seminara S, Clifton DK, Steiner RA 2004 A role for kisspeptins in the regulation of gonadotropin secretion in the mouse. Endocrinology 145:4073–4077[Abstract/Free Full Text]
  10. Matsui H, Takatsu Y, Kumano S, Matsumoto H, Ohtaki T 2004 Peripheral administration of metastin induces marked gonadotropin release and ovulation in the rat. Biochem Biophys Res Commun 320:383–388[CrossRef][Medline]
  11. Messager S, Chatzidaki EE, Ma D, Hendrick AG, Zahn D, Dixon J, Thresher RR, Malinge I, Lomet D, Carlton MB, Colledge WH, Caraty A, Aparicio SA 2005 Kisspeptin directly stimulates gonadotropin-releasing hormone release via G protein-coupled receptor 54. Proc Natl Acad Sci USA 102:1761–1766[Abstract/Free Full Text]
  12. Clarke IJ, Cummins JT, de Kretser DM 1983 Pituitary gland function after disconnection from direct hypothalamic influences in the sheep. Neuroendocrinology 36:376–384[Medline]
  13. Fraser HM, Clarke IJ, McNeilly AS 1981 Effect of oestrogen and an LH-RH agonist on the release of gonadotrophins in ovariectomized ewes deprived of LH-RH. J Reprod Fertil 62:131–140[Abstract/Free Full Text]
  14. Gutierrez-Pascual E, Martinez-Fuentes AJ, Pinilla L, Tena-Sempere M, Malagon MM, Castano JP 2007 Direct pituitary effects of kisspeptin: activation of gonadotrophs and somatotrophs and stimulation of luteinising hormone and growth hormone secretion. J Neuroendocrinol 19:521–530[CrossRef][Medline]
  15. Navarro VM, Castellano JM, Fernandez-Fernandez R, Tovar S, Roa J, Mayen A, Barreiro ML, Casanueva FF, Aguilar E, Dieguez C, Pinilla L, Tena-Sempere M 2005 Effects of KiSS-1 peptide, the natural ligand of GPR54, on follicle-stimulating hormone secretion in the rat. Endocrinology 146:1689–1697[Abstract/Free Full Text]
  16. Navarro VM, Castellano JM, Fernandez-Fernandez R, Tovar S, Roa J, Mayen A, Nogueiras R, Vazquez MJ, Barreiro ML, Magni P, Aguilar E, Dieguez C, Pinilla L, Tena-Sempere M 2005 Characterization of the potent luteinizing hormone-releasing activity of KiSS-1 peptide, the natural ligand of GPR54. Endocrinology 146:156–163[Abstract/Free Full Text]
  17. Thompson EL, Patterson M, Murphy KG, Smith KL, Dhillo WS, Todd JF, Ghatei MA, Bloom SR 2004 Central and peripheral administration of kisspeptin-10 stimulates the hypothalamic-pituitary-gonadal axis. J Neuroendocrinol 16:850–858[CrossRef][Medline]
  18. Franceschini I, Lomet D, Cateau M, Delsol G, Tillet Y, Caraty A 2006 Kisspeptin immunoreactive cells of the ovine preoptic area and arcuate nucleus co-express estrogen receptor {alpha}. Neurosci Lett 401:225–230[CrossRef][Medline]
  19. Pompolo S, Pereira A, Estrada KM, Clarke IJ 2006 Colocalization of kisspeptin and gonadotropin-releasing hormone in the ovine brain. Endocrinology 147:804–810[Abstract/Free Full Text]
  20. Clarkson J, Herbison AE 2006 Postnatal development of kisspeptin neurons in mouse hypothalamus; sexual dimorphism and projections to gonadotropin-releasing hormone neurons. Endocrinology 147:5817–5825[Abstract/Free Full Text]
  21. Goodman RL, Lehman MN, Smith JT, Coolen LM, de Oliveira CV, Jafarzadehshirazi MR, Pereira A, Iqbal J, Caraty A, Ciofi P, Clarke IJ 2007 Kisspeptin neurons in the arcuate nucleus of the ewe express both dynorphin A and neurokinin B. Endocrinology 148:5752–5760[Abstract/Free Full Text]
  22. Clarke IJ, Cummins JT 1984 Direct pituitary effects of estrogen and progesterone on gonadotropin secretion in the ovariectomized ewe. Neuroendocrinology 39:267–274[Medline]
  23. Clarke IJ 2002 Two decades of measuring GnRH secretion. Reprod Suppl 59:1–13[Medline]
  24. Barker-Gibb ML, Scott CJ, Boublik JH, Clarke IJ 1995 The role of neuropeptide Y (NPY) in the control of LH secretion in the ewe with respect to season, NPY receptor subtype and the site of action in the hypothalamus. J Endocrinol 147:565–579[Abstract/Free Full Text]
  25. Roh SG, Doconto M, Feng DD, Chen C 2006 Differential regulation of GHRH-receptor and GHS-receptor expression by long-term in vitro treatment of ovine pituitary cells with GHRP-2 and GHRH. Endocrine 30:55–62[CrossRef][Medline]
  26. Wu D, Chen C, Zhang J, Bowers CY, Clarke IJ 1996 The effects of GH-releasing peptide-6 (GHRP-6) and GHRP-2 on intracellular adenosine 3',5'-monophosphate (cAMP) levels and GH secretion in ovine and rat somatotrophs. J Endocrinol 148:197–205[Abstract/Free Full Text]
  27. Matteri RL, Roser JF, Baldwin DM, Lipovetsky V, Papkoff H 1987 Characterization of a monoclonal antibody which detects luteinizing hormone from diverse mammalian species. Domest Anim Endocrinol 4:157–165[CrossRef][Medline]
  28. Thomas SG, Takahashi M, Neill JD, Clarke IJ 1998 Components of the neuronal exocytotic machinery in the anterior pituitary of the ovariectomised ewe and the effects of oestrogen in gonadotropes as studied with confocal microscopy. Neuroendocrinology 67:244–259[CrossRef][Medline]
  29. Clarke IJ, Cummins JT, Crowder ME, Nett TM 1987 Pituitary receptors for gonadotropin-releasing hormone in relation to changes in pituitary and plasma luteinizing hormone in ovariectomized-hypothalamo pituitary disconnected ewes. I. Effect of changing frequency of gonadotropin-releasing hormone pulses. Biol Reprod 37:749–754[Abstract]
  30. Clarke IJ, Cummins JT 1985 Increased gonadotropin-releasing hormone pulse frequency associated with estrogen-induced luteinizing hormone surges in ovariectomized ewes. Endocrinology 116:2376–2383[Abstract/Free Full Text]
  31. Clarke IJ 1993 Variable patterns of gonadotropin-releasing hormone secretion during the estrogen-induced luteinizing hormone surge in ovariectomized ewes. Endocrinology 133:1624–1632[Abstract/Free Full Text]
  32. Lee VW, Cumming IA, de Kretser DM, Findlay JK, Hudson B, Keogh EJ 1976 Regulation of gonadotrophin secretion in rams from birth to sexual maturity. I. Plasma LH, FSH and testosterone levels. J Reprod Fertil 46:1–6[Abstract/Free Full Text]
  33. Burger HG, Lee VW, Rennie GC 1972 A generalized computer program for the treatment of data from competitive protein-binding assays including radioimmunoassays. J Lab Clin Med 80:302–312[Medline]
  34. Han SK, Gottsch ML, Lee KJ, Popa SM, Smith JT, Jakawich SK, Clifton DK, Steiner RA, Herbison AE 2005 Activation of gonadotropin-releasing hormone neurons by kisspeptin as a neuroendocrine switch for the onset of puberty. J Neurosci 25:11349–11356[Abstract/Free Full Text]
  35. Parhar IS, Ogawa S, Sakuma Y 2004 Laser-captured single digoxigenin-labeled neurons of gonadotropin-releasing hormone types reveal a novel G protein-coupled receptor (Gpr54) during maturation in cichlid fish. Endocrinology 145:3613–3618[Abstract/Free Full Text]
  36. Pallais JC, Bo-Abbas Y, Pitteloud N, Crowley Jr WF, Seminara SB 2006 Neuroendocrine, gonadal, placental, and obstetric phenotypes in patients with IHH and mutations in the G-protein coupled receptor, GPR54. Mol Cell Endocrinol 254–255:70–77
  37. Suzuki S, Kadokawa H, Hashizume T 2008 Direct kisspeptin-10 stimulation on luteinizing hormone secretion from bovine and porcine anterior pituitary cells. Anim Reprod Sci 103:360–365[CrossRef][Medline]
  38. Estrada KM, Clay CM, Pompolo S, Smith JT, Clarke IJ 2006 Elevated KiSS-1 expression in the arcuate nucleus prior to the cyclic preovulatory gonadotrophin-releasing hormone/luteinising hormone surge in the ewe suggests a stimulatory role for kisspeptin in oestrogen-positive feedback. J Neuroendocrinol 18:806–809[CrossRef][Medline]
  39. Drouva SV, Gorenne I, Laplante E, Rerat E, Enjalbert A, Kordon C 1990 Estradiol modulates protein kinase C activity in the rat pituitary in vivo and in vitro. Endocrinology 126:536–544[Abstract/Free Full Text]
  40. Seminara SB, Dipietro MJ, Ramaswamy S, Crowley Jr WF, Plant TM 2006 Continuous human metastin 45–54 infusion desensitizes G protein-coupled receptor 54-induced gonadotropin-releasing hormone release monitored indirectly in the juvenile male Rhesus monkey (Macaca mulatta): a finding with therapeutic implications. Endocrinology 147:2122–2126[Abstract/Free Full Text]
  41. Plant TM, Ramaswamy S, Dipietro MJ 2006 Repetitive activation of hypothalamic G protein-coupled receptor 54 with intravenous pulses of kisspeptin in the juvenile monkey (Macaca mulatta) elicits a sustained train of gonadotropin-releasing hormone discharges. Endocrinology 147:1007–1013[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Integr. Comp. Biol.Home page
W. P. Williams III, E. M. Gibson, C. Wang, S. Tjho, N. Khattar, G. E. Bentley, K. Tsutsui, and L. J. Kriegsfeld
Proximate mechanisms driving circadian control of neuroendocrine function: Lessons from the young and old
Integr. Comp. Biol., November 1, 2009; 49(5): 519 - 537.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. E. Oakley, D. K. Clifton, and R. A. Steiner
Kisspeptin Signaling in the Brain
Endocr. Rev., October 1, 2009; 30(6): 713 - 743.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S. Li, Y. Zhang, Y. Liu, X. Huang, W. Huang, D. Lu, P. Zhu, Y. Shi, C. H K Cheng, X. Liu, et al.
Structural and functional multiplicity of the kisspeptin/GPR54 system in goldfish (Carassius auratus)
J. Endocrinol., June 1, 2009; 201(3): 407 - 418.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Magee, C. D. Foradori, J. E. Bruemmer, J. A. Arreguin-Arevalo, P. M. McCue, R. J. Handa, E. L. Squires, and C. M. Clay
Biological and Anatomical Evidence for Kisspeptin Regulation of the Hypothalamic-Pituitary-Gonadal Axis of Estrous Horse Mares
Endocrinology, June 1, 2009; 150(6): 2813 - 2821.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. M. Anderson, H.-L. Relf, M. Z. Rizwan, and J. J. Evans
Central and Peripheral Effects of RFamide-Related Peptide-3 on Luteinizing Hormone and Prolactin Secretion in Rats
Endocrinology, April 1, 2009; 150(4): 1834 - 1840.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Z. Rizwan, R. Porteous, A. E. Herbison, and G. M. Anderson
Cells Expressing RFamide-Related Peptide-1/3, the Mammalian Gonadotropin-Inhibitory Hormone Orthologs, Are Not Hypophysiotropic Neuroendocrine Neurons in the Rat
Endocrinology, March 1, 2009; 150(3): 1413 - 1420.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
A.K. Roseweir and R.P. Millar
The role of kisspeptin in the control of gonadotrophin secretion
Hum. Reprod. Update, March 1, 2009; 15(2): 203 - 212.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Ramaswamy, K. A. Guerriero, R. B. Gibbs, and T. M. Plant
Structural Interactions between Kisspeptin and GnRH Neurons in the Mediobasal Hypothalamus of the Male Rhesus Monkey (Macaca mulatta) as Revealed by Double Immunofluorescence and Confocal Microscopy
Endocrinology, September 1, 2008; 149(9): 4387 - 4395.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, J. T.
Right arrow Articles by Clarke, I. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, J. T.
Right arrow Articles by Clarke, I. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals