help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2007-1652
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bobe, J.
Right arrow Articles by Guiguen, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bobe, J.
Right arrow Articles by Guiguen, Y.
Endocrinology Vol. 149, No. 6 2980-2989
Copyright © 2008 by The Endocrine Society

A Novel, Functional, and Highly Divergent Sex Hormone-Binding Globulin that May Participate in the Local Control of Ovarian Functions in Salmonids

Julien Bobe, Sophie Mahé, Thaovi Nguyen, Hélène Rime, Denise Vizziano, Alexis Fostier and Yann Guiguen

Institut National de la Recherche Agronomique (INRA), Unité de Recherche 1037 (UR1037) SCRIBE, Institut Fédératif de Recherche 140, Ouest-Genopole, 35000 Rennes, France

Address all correspondence and requests for reprints to: Julien Bobe, Institut National de la Recherche Agronomique, Unité de Recherche 1037 SCRIBE, Institut Fédératif de Recherche 140, Ouest-Genopole, 35000 Rennes, France. E-mail: Julien.Bobe{at}rennes.inra.fr.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A cDNA encoding for a novel rainbow trout SHBG was identified and characterized. Phylogenetic analysis showed that this novel SHBG, named SHBGb, was a highly divergent paralog of the classical SHBG (SHBGa) form previously known in vertebrates including zebrafish, seabass, and rainbow trout. Using all available sequences, no SHBGb-like sequence could be identified in any fish species besides Atlantic salmon. Rainbow trout SHBGa and SHBGb share only 26% sequence identity at the amino acid level and exhibit totally distinct tissue distribution, thus demonstrating a functional shift of SHBGb. Indeed, shbga mRNA was predominantly expressed in liver and spleen but could not be detected in the ovary, whereas shbgb had a predominant ovarian expression but could not be detected in liver. Despite its high divergence, rainbow trout SHBGb expressed in COS-7 cells could bind estradiol and testosterone with high affinity and specificity. Both rainbow trout shbgb mRNA and proteins were localized to the granulosa cells of vitellogenic ovarian follicles, whereas SHBGb immunoreactivity was also found in theca cells. Finally, shbgb ovarian mRNA expression exhibited a significant drop between late vitellogenesis and oocyte maturation at a time when ovarian aromatase (cyp19a) gene expression and estradiol circulating levels exhibited a dramatic decrease. Together, these observations show that SHBGb is a functional and highly divergent SHBG paralog probably arising from a salmonid-specific duplication of the shbg gene.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SHBG IS A CARRIER PROTEIN mainly secreted by the liver into the blood where it binds sex steroids with a high affinity (1, 2). According to the free hormone hypothesis (3), these sex steroids would be kept inactive by binding to SHBG in the plasma, leading to the assumption that only the SHBG-free steroid fraction would remain available for cell membrane diffusion and mediation of the steroid action. However, some evidence also suggests that these proteins can mediate the sex steroid signal directly after binding to membrane-associated proteins and triggering a subsequent cAMP response (4). This assumption was in part suggested by the characterization of some extrahepatic sites of SHBG expression supporting, in these steroid target tissues, an implication of SHBG on the local steroid action (5). Among these tissues, SHBG expression has been found in testis (6), prostate (5), breast cysts (7), and ovary (8, 9) where this protein is supposed to act as a local regulator of tissue and organ functions.

SHBG proteins have been biochemically characterized in the blood of many different vertebrate species including lower vertebrates, i.e. reptiles (10), amphibians (11), and fish (12). In fish, the characterization of shbg genes has been reported in the zebrafish, Danio rerio (13), and the European sea bass, Dicentrarchus labrax (14, 15). These fish shbg share with their mammalian orthologs many common features including some amino acid conservation at key residues important for steroid binding, a predominant liver expression (13, 15), and a high binding affinity for sex steroids. They also exhibit some special characteristics such as the important expression of the zebrafish shbg in the gut (13) or the high affinity of sea bass shbg for the synthetic estrogen 17{alpha}-ethynylestradiol (14).

The rainbow trout, Oncorhynchus mykiss, is one of the most studied fish species with a long history of research carried out in physiology, nutrition, ecology, genetics, pathology, carcinogenesis, and toxicology (16). In addition to the whole fish genome duplication (17), rainbow trout also underwent, like all salmonids, an extra whole-genome duplication 25–100 million years ago (18), providing the opportunity to study the recent fate of newly duplicated genes. In comparison with other model fish, rainbow trout has a large body size and a slow development, providing interesting opportunities to carry out simultaneously biochemical, molecular, and physiological studies. Furthermore, increasing genomic resources are now available in this species (19, 20). Using cDNA microarray expression profiling, we recently identified a previously uncharacterized ovarian gene displaying an extremely good correlation with the aromatase (cyp19a) temporal expression profile (21). Using a partial amino acid sequence, this gene was initially automatically annotated as protein S (also known as vitamin K-dependant protein) based on the clustering of several expressed sequence tags (ESTs) available in public databases. However, significant sequence identities were also observed with other proteins, including SHBG. In the present work, we provide a functional and physiological description of this novel gene that we characterized as a highly divergent but still functional SHBG that may participate in the local control of ovarian functions in salmonids.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and tissue collection
Investigations were conducted according to the guiding principles for the use and care of laboratory animals and in compliance with French and European regulations on animal welfare. Rainbow trout (O. mykiss) from an autumn-spawning strain were obtained from an experimental fish farm (Sizun, France) approximately 1 month before spawning. Fish were held and sampled as previously described (22). Ovaries were sampled during late vitellogenesis (3–4 wk before expected spawning, n = 6), after vitellogenesis (before oocyte maturation but during spawning period, n = 6), and during oocyte maturation (n = 6). For tissue collection, trout were deeply anesthetized in 2-phenoxyethanol (1 ml/liter of water), killed by a blow on the head and bled by gill arch section. Ovarian aliquots were either frozen in liquid nitrogen and stored at –80 C until RNA extraction or fixed in Dietrick’s fixative (10% formaldehyde, 28.5% ethanol, 2% glacial acetic acid in water) at 4 C overnight, rinsed in tap water for 1 h, and held in 50% ethanol. For the tissue distribution study, different tissues were sampled from three post-vitellogenic females and pooled before RT. Testis samples were also obtained from three different males at stage II (initiation of spermatogenesis with only spermatogonia A and B) (23) and pooled before RT.

In vitro regulation by estradiol in ovarian follicles
Ovarian fragments were sampled from three female rainbow trout during early vitellogenesis (gonadosomatic index = 0.5%) under sterile conditions. Ovarian fragments were incubated at 12 C in 12-well culture plates at a ratio of 100 mg /ml of IM8/300 incubation medium [133 mM NaCl, 3.09 mM KCl, 0.28 mM MgSO4, 2.1 mM MgCl2, 4.5 mM CaCl2, 5.6 mM glucose, 20 mM HEPES (pH 8.0), 300 mOsm]. For each female, three ovarian fragments were incubated in presence of 40 nM estradiol, and three ovarian fragments were incubated in mineral medium alone and used as negative control. After 20 h incubation, ovarian fragments were frozen in liquid nitrogen and stored at –80 C until RNA extraction.

Sequence analysis
The cDNA clones tcbk0006.j.01 and tcay0036.n.19 corresponding to rainbow trout shbgb and originating from INRA-Agenae program (20) were fully sequenced in both directions as previously described (22). Prediction of potential signal peptide, N-glycosylation, and phosphorylation sites was performed using the prediction servers of the Center for Biological Sequences Analysis (www.cbs.dtu.dk) based on the deduced amino acid sequence. Multiple amino acid sequence alignments were constructed using ClustalW software.

Phylogenetic analysis
We performed the phylogenetic analysis by using the phylogenomic analysis pipeline available in the FIGENIX platform (http://www.up.univ-mrs.fr/evol/figenix/) (24). FIGENIX retrieved sequences, provided multiple sequence alignments, performed phylogenetic reconstruction, and deduced orthology and paralogy relationships (for a detailed description of pipelines and models used, see Ref. 24). A partial shbgb sequence deduced from some Atlantic salmon (Salmo salar) ESTs (GenBank accession nos. DY735728, DY694623, DY719210, DW561629, DY699232, CK884863, CA056042, DY699233, and DY719211) was entered into the phylogenomic inference task, which was run with the default parameters and with Ensembl and NCBI-NR databases. We chose the NJ (neighbor joining) topology for the graphical representation. The resulting tree (npl) is the fusion of neighbor joining (25), maximum parsimony, and maximum likelihood (26) trees. The Dayhoff PAM matrix provided the distance matrix for the NJ method. The evolutionary distance separating sequences is defined as the number of mutational events per site underlying the evolutionary history separating sequences. Thus, evolutionary relations among sequences are represented by the tree structure, where branch length represents the evolutionary distance (26, 27). In Fig. 1Go, for each node, bootstrap values are reported for each npl method. Bootstrapping was carried out using 1000 replications.


Figure 1
View larger version (32K):
[in this window]
[in a new window]

 
FIG. 1. Phylogeny of the SHBG/PROS1/GAS6 protein families in vertebrates including fishes. Bootstrap values for neighbor joining, maximum parsimony, and maximum likelihood methods, respectively, are indicated at each branch’s nodes to evaluate their robustness. The consensus tree was calculated with the FIGENIX automated phylogenomic annotation pipeline with the S. salar (*) partial shbgb protein-deduced sequence used as a bait (see Materials and Methods for details). Protein sequence accession numbers for each species are given under brackets on the right of the figure. The scale bar represents the number of changes per position and per unit of branch length.

 
Real-time PCR analyses
Real-time PCR was performed using an I-Cycler IQ (Bio-Rad, Hercules, CA) as previously described (28). Control reactions were run without reverse transcriptase. RT products, including control reactions, were diluted to 1/25, and 5 µl was used for each real-time PCR. Triplicates were run for each RT product. Real-time PCR was performed using a real-time PCR kit provided with a SYBR Green fluorophore (Eurogentec, Seraing, Belgium) with 600 nM of each primer. The following primers were used: shbga (CCCATTCTGGAACTTTGAGG/ACACCCCATAACCTGGTCAA) and shbgb (ACATGTGGGGGATGTTCATT/GAGGCCATGTTACGGTTTTG). The relative abundance of target cDNA within a sample set was calculated from a serially diluted cDNA pool (standard curve) using the I-Cycler IQ software. After amplification, a fusion curve was obtained to validate the amplification of a single PCR product. Before further analysis, real-time PCR data were normalized using 18S transcript abundance in the samples. The control reactions were used to calculate background expression level for each gene to identify the tissues exhibiting expression levels significantly higher than background.

In situ hybridization and immunocytochemistry
Ovarian tissue processing was carried out as previously described (29). Briefly, dehydration and paraffin infiltration were performed in a Citadel 1000 tissue processor (Shandon, Pittsburgh, PA). Dehydrated tissues were embedded in plastic molds in paraffin using a HistoEmbedder (TBS88; Medite, Burgdorf, Germany). In situ hybridization and immunocytochemistry were performed using the In situ Pro, Intavis AG robotic station. In situ hybridization was carried out as previously described with minor modifications (30). An antibody directed against rainbow trout SHBGb was generated by Eurogentec. Two rainbow trout SHBGb peptides (CRQDSSILERTLQDSK and CTDGDYELLKRVLSQP) that are not found in rainbow trout SHBGa were simultaneously used for immunization in rabbit. An ELISA was carried out for both peptides to select the peptide that had given the best response. The resulting antiserum was then further purified by immunoaffinity against the following peptide: CRQDSSILERTLQDSK. For immunocytochemistry, the purified SHBGb antibody was diluted to 1:100 and revealed using a fluorescein isothiocyanate-coupled antibody.

Expression of rainbow trout shbgb in COS-7 cells
COS-7 cells were maintained in high-glucose concentration DMEM (Sigma Chemical Co., St. Louis, MO), supplemented with 10% fetal bovine serum (FBS) (Roche Diagnostics, Mannheim, Germany), 2 mM L-glutamine, and antibiotic. Cells were grown in an atmosphere of 5% CO2 and 95% air at 37 C. A PCR product, including the complete shbgb open reading frame, was inserted into pCMV expression vector (Stratagene, La Jolla, CA). The resulting plasmid was used for transfection in subconfluent COS-7 cells (60–80% confluence) using Fugene HD reagent (Roche Diagnostics) according to manufacturer’s protocol. An 8:2 reagent to DNA ratio was used for transfection. Six hours after transfection, culture medium was removed. Cells were then washed in PBS twice to remove FBS and subsequently cultured for 48 h in 4.5 g/liter glucose DMEM without red phenol and FBS. After 48 h, the culture medium containing the recombinant protein was collected for further analysis.

Steroid-binding assays
Unlabeled steroids were obtained from Steraloids (Newport, RI). [2,4,6,7-3H]Estradiol-17β (E2) (3.40 TBq/mmol), [1,2,6,7-3H]testosterone (T) (3.59 Tbq/mmol), and [2,4,6,7-3H]cortisol (F) (2.55 Tb/mmol) were purchased from GE Healthcare Europe Gmbh (Saclay, France). COS-7 cell culture medium was centrifuged (3500 x g for 15 min) and frozen at –20 C before further analysis. Tritiated testosterone, estradiol-17β, and F binding were looked for in the transfected COS-7 cells using the method of Taylor et al. (31). No specific binding could be detected for any of the tested steroids (data not shown), and additional experiments were performed only on the culture medium.

Each sample was assayed in triplicate. Aliquots of COS-7 cell culture medium (200 µl) were incubated in 5-ml glass tubes with tritiated steroids (in 100 µl DMEM added with 0.1% gelatin) at a final concentration of 5 nM in presence (nonspecific binding) or absence (total binding) of a 500-fold excess of radioinert steroid (2.5 µM) for 16 h at 4 C.

Culture medium was incubated at 4 C for times ranging from 30 sec to 8 h to determine the association rate of 5 nM [3H]T. Its rate of dissociation was determined by incubation of culture medium at 4 C with 5 nM [3H]T followed by addition of 500-fold excess of unlabeled competitor for times ranging from 30 sec to 8 h. In each case, nonspecific binding was estimated by incubation in the presence of 2.5 µM radioinert steroid. Competitive binding assays were performed by fixing increasing concentrations (0.5 nM to 5 µM) of unlabeled competitor (E2, T, 11-ketotestosterone, 17-hydroxyprogesterone, F, 2-methoxyestradiol, and 5{alpha}-dihydrotestosterone) at the beginning of incubation.

Incubations were stopped by adding 200 µl ice-cold dextran-coated charcoal (DCC) solution [2.5% charcoal and 0.25% dextran in 50 mM phosphate buffer (pH 7.4) with 0.1% gelatin]. Tubes were quickly vortexed and incubated on ice for 5 min before centrifugation at 2000 x g and 4 C for 7 min. Aliquots of supernatant (400 µl) were added to 4 ml Picofluor 40 (PerkinElmer, Boston, MA) for radioactivity counting (32% efficiency).

Results are expressed as means ± SD, and the equilibrium dissociation constant (Kd) was determined by Scatchard analysis.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Sequence and phylogenetic analysis
The rainbow trout shbgb cDNA (GenBank EF577269) was 1797 bp in length with an open reading frame encoding a 412-amino-acid protein (GenBank ABQ45411). After performing a BLAST analysis, the deduced protein sequence had significant similarities with vertebrate growth arrest 6 (GAS6), vitamin k-dependent protein S precursor (PROS1), and SHBG. The phylogenetic analysis clearly showed that this protein belonged to the SHBG branch as indicated by the significant bootstrap values (Fig. 1Go). Within this branch, the SHBGb protein was clearly separated from SHBG from all vertebrate species, including rainbow trout. The protein characterized in the present study was therefore considered to be a paralog of the rainbow trout SHBG and was therefore named SHBG β-form (SHBGb) in agreement with existing gene nomenclature. Accordingly, the previously described rainbow trout classical SHBG protein will be referred to as rainbow trout SHBGa in the text. Apart from Atlantic salmon (S. salar) ESTs (see Materials and Methods), no cognate SHBGb sequence could be found in any vertebrate species including fish species with complete genome sequences. In the phylogenetic analysis (Fig. 1Go), the salmon sequence was grouped with the rainbow trout SHBGb sequence with highly significant bootstrap values.

The rainbow trout SHBGb protein sequence exhibited 26% sequence identity with rainbow trout SHBGa, 29% with zebrafish SHBG, and 29% with seabass SHBG. Similar degrees of sequence identities (28, 27, and 28%) were also found between the rainbow trout SHBGb and rat (Rattus norvegicus), rabbit (Oryctolagus cuniculus), and human SHBG sequences, respectively (Fig. 2Go). In addition, rainbow trout SHBGb also exhibited significant sequence similarities with vertebrate GAS6 and PROS1 proteins as previously reported for SHBG (32, 33). The rainbow trout SHBGb sequence displayed four cysteine residues at positions 191, 217, 375, and 402 that are conserved among all vertebrate SHBG sequences (Fig. 2Go). These cysteine residues allow the formation of disulfide bridges within the two laminin G-like domains found at positions 57–197 and 255–377. The N-terminal membrane receptor-binding domain (34) is one of the most conserved domain within all SHBG proteins, and this 10-amino-acid stretch is also the most conserved part of the SHBGb with eight residues identical to the human sequence (Fig. 2Go). The serine residue at position 42 (Ser42) of the mature human SHBG protein that is found in all fish SHBG sequences, including rainbow trout SHBGa sequence, is also present in the rainbow trout SHBGb sequence. In contrast, the aspartic acid residue at position 65 (Asp65) of human SHBG is not conserved in rainbow trout SHBGb. In human SHBG, these two residues bond with the functional groups at C3 and C17 of sex steroids that bind SHBG with high affinity (35, 36). Interestingly, the SHBG mammalian Asn82 residue that participates in the discrimination of some bound steroids (35) is replaced by a lysine in SHBG in all fish species including trout SHBGa, whereas it is replaced by a cysteine in trout SHBGb. The rainbow trout SHBGb sequence exhibits three predicted N-glycosylation sites at positions 48, 102, and 243 that are not conserved in other SHBG fish sequences (14).


Figure 2
View larger version (56K):
[in this window]
[in a new window]

 
FIG. 2. Amino acid sequence comparison between rainbow trout SHBGb, rainbow trout SHBGa (BAE48779 O. mykiss), zebrafish SHBG (NP_001007152 D. rerio), seabass SHBG (AAW23033 D. labrax), rat SHBG (NP_036782 R. norvegicus), rabbit SHBG (NP_001075839 O. cuniculus), and human SHBG (AAC18778 H. sapiens). The cysteine residues that form intramolecular disulfide bridges within the two laminin G-like (LG) domains and the Ser42 and Asp65 residues are indicated by an arrow. The amino acids corresponding to the signal peptide of rainbow trout SHBGb are underlined. The three N-glycosylation sites in the rainbow trout SHBGb sequence are marked by asterisks. The N-terminal membrane receptor-binding domain (34 ) conserved in SHBG proteins is boxed.

 
Tissue distribution and expression profiles in the ovary
The real-time PCR expression study carried out using 14 different tissues showed that rainbow trout shbgb transcript was strongly and predominantly expressed in the ovary. It was also detected at much lower levels in muscle and stomach but could not be significantly detected in any other tissues assayed including liver (Fig. 3AGo). In contrast, shbga transcript was strongly and predominantly expressed in liver and spleen. It was also present at low but significant levels in gills, pituitary, and stomach (Fig. 3BGo).


Figure 3
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 3. Tissue expression of rainbow trout shbga (A) and shbgb (B) transcripts. Real-time PCR analysis was conducted using total RNA originating from the following tissues sampled in three different fish: brain (Br), pituitary (Pi), gills (Gi), heart (He), liver (Li), spleen (Sp), stomach (St), intestine (In), head kidney (HK), trunk kidney (TK), muscle (Mu), skin (Sk), post-vitellogenic ovary (Ov), and stage II testis (Te). For each tissue, three separate RT reactions were carried out using separate RNA samples originating from three different fish. RT reactions were pooled and use to run real-time PCR in triplicates. Mean and SD are shown (n = 3). #, Expression levels not significantly different from background signal at P < 0.05. For both genes, one unit of the y-axis corresponds to the level of shbgb expression in the ovary.

 
In the preovulatory ovary, shbgb exhibited a marked down-regulation before meiosis resumption. Interestingly, a highly similar expression profile was observed for ovarian aromatase (cyp19a) (Fig. 4Go).


Figure 4
View larger version (12K):
[in this window]
[in a new window]

 
FIG. 4. Ovarian expression profiles of rainbow trout cyp19a and shbgb during late vitellogenesis, post-vitellogenesis, and oocyte maturation. During post-vitellogenesis, samples were collected during or after migration of the germinal vesicle (GV) in the periphery of the oocyte. During oocyte maturation, samples were collected during and after germinal vesicle breakdown (GVBD). Expression levels of both genes were monitored by real-time PCR in RNA samples originating from individual females. For each gene, expression data were standardized using 18S and subsequently median centered. For each gene, mRNA levels are expressed as a percentage of the expression level in the sample exhibiting the highest expression. Mean values (±SD) of triplicate PCR are shown for each sample.

 
In vitro regulation by estradiol
In vitro incubation showed that shbgb expression was higher in the E2-treated group than in the control group (Fig. 5Go), even though this difference was not significant in one of the females assayed.


Figure 5
View larger version (8K):
[in this window]
[in a new window]

 
FIG. 5. In vitro regulation of shbgb expression in ovarian fragments exposed to 40 nM E2 in ethanol vehicle for 20 h. Control incubations correspond to mineral medium alone supplemented with ethanol vehicle. Each experiment (Exp) corresponds to a different female. For each experiment, incubations were conducted in triplicate for both control and E2 treatments. RNA was extracted from each individual culture well and used for RT and further real-time PCR. For each experiment, shbgb expression was standardized using 18S and subsequently normalized to the expression in the control group. *, Significant differences between control and E2-treated groups at P < 0.05.

 
Cellular localization
In rainbow trout ovarian tissue, shbgb transcript was localized to the granulosa cell vitellogenic follicles (Fig. 6Go). In addition, the immunolocalization study showed that the SHBGb protein was present in both granulosa and theca cells of the vitellogenic follicles (Fig. 7Go).


Figure 6
View larger version (99K):
[in this window]
[in a new window]

 
FIG. 6. In situ localization of cyp19a and shbgb transcripts in the granulosa cells of rainbow trout ovarian follicles. Antisense (AS) and sense (S) probes were hybridized on adjacent sections. A and B, The shbgb transcript was present in granulosa (gr) cells of mid-vitellogenic (A) and late-vitellogenic (B) follicles but not in theca cells (th) and oocytes (oo). The zona radiata (zr) of the oocyte is also indicated. C, A similar expression pattern of cyp19a transcript was observed in late-vitellogenic follicles.

 

Figure 7
View larger version (9K):
[in this window]
[in a new window]

 
FIG. 7. Immunodetection of SHBGb in late-vitellogenic follicles. The protein was detected in granulosa (gr) and theca (th) cells but not in zona radiate (zr) or ooplasm (oo).

 
Biochemical analysis of rainbow trout SHBGb
[3H]T- and [3H]E2-specific binding was found in the culture medium of SHBGb-transfected COS-7 cells, whereas no binding could be detected for [3H]F (Fig. 8AGo). Saturation analysis and Scatchard plot showed the presence of a high-affinity (Kd = 0.77 nM; 95% confidence interval, 0.71–0.83) saturable single binding site for [3H]T (Fig. 8BGo). Both [3H]T association and dissociation kinetics were rapid, with 50% of maximal binding being reached after 3–4 min (Fig. 8Go, C and D). The apparent dissociation rate constant was 0.43 min–1 (95% confidence interval, 0.42–0.45). Competitive binding assays against T indicated that E2 and T had similar affinities, whereas 2-methoxyestradiol had a lower affinity (Table 1Go). In contrast, 11-ketotestosterone and 5{alpha}-dihydrotestosterone competed at a low level, whereas 17-hydroxyprogesterone and F showed negligible competition (Table 1Go).


Figure 8
View larger version (16K):
[in this window]
[in a new window]

 
FIG. 8. Binding characteristics of recombinant rainbow trout SHBGb. The DCC-adsorption method was used to separate free and bound fractions, and only specific binding [Bs = total binding (T) – nonspecific binding] is shown. A, Binding of [3H]E2, [3H]T, and [3H]F measured in culture medium of SHBG-transfected COS-7 cell; 5 nM of each tritiated steroid was incubated for 16 h at 4 C in the absence (total binding) or presence (nonspecific binding) of 500x the corresponding radioinert steroid (means ± SD, n = 3). Culture medium of COS-7 cells transfected with pCMV expression vector was used as negative control. B, Scatchard analysis of the binding of [3H]T. Aliquots of COS cell culture medium were incubated at 4 C with increasing concentration of [3H]T in the absence or presence of 500x radioinert T before DCC addition. Each point of the Scatchard plot is calculated from triplicate measurements of total and nonspecific binding. Dotted lines represent 95% confidence interval limits of the regression. C, Association rate of [3H]T; 5 nM [3H]T was incubated at 4 C with aliquots of COS cell culture medium, with or without 500x excess radioinert T, for 30 sec to 8 h before adding DCC (data are expressed as percentage of the maximal specific binding; means ± SD, n = 3). D, Dissociation rate of [3H]T; 5 nM [3H]T was incubated at 4 C for 16 h with aliquots of COS-7 cell culture medium, in the absence or presence of 500x radioinert T. Dissociation was induced by the addition of 500x radioinert T and the assay arrested by DCC after 30 sec to 8 h incubation (data are expressed as percentage of the maximal binding; means ± SD, n = 3). E, Total, specific, and nonspecific binding of testosterone in culture medium of COS-7 cells expressing rainbow trout SHBGb.

 

View this table:
[in this window]
[in a new window]

 
TABLE 1. Relative binding affinities of different steroids for rainbow trout SHBGb

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
SHBGb: a highly divergent SHBG paralog restricted to salmonids
Whole-genome duplications are considered as crucial events for species evolution (37), and this hypothesis has been extensively studied in ray-finned fishes in which an additional round of genome duplication occurred (17). In that regard, the novel rainbow trout shbgb gene reported here is rather intriguing. Based on its phylogenetic position that branched at the root of all classical tetrapod SHBG, this sequence is, without any ambiguity, a new member of the vertebrate SHBG family. However, apart from some Atlantic salmon ESTs, we have been unable to find any other shbgb orthologous counterpart within the ray-finned lineage, even in species with complete genome sequences (e.g. zebrafish and fugu). This strongly suggests that this shbgb gene is a rainbow trout paralog that arose from the salmonid-specific additional genome duplication (18). However, this paralogy relationship is not supported by the consensus tree topology that we obtained. This inconsistency may be explained by a long-branch attraction artifact (38) resulting from the dramatic divergence of this sequence. Such a high rate of molecular evolution appears to be quite frequent for many genes resulting from fish genome duplications, and these duplicated genes are often associated with functional shifts through either sub- or neofunctionalization (39). Gene duplication can also sometimes result in the loss of gene function (pseudogenization). Based on the huge divergence of this novel gene, the functionality of rainbow trout SHBGb was not obvious and had to be experimentally demonstrated. However, despite its high divergence, rainbow trout SHBGb still exhibits some conserved features typical of all vertebrate SHBG. Indeed, the conservation of the tandem repeats of laminin G-like domains that are crucial for steroid binding and dimer formation or of the N-terminal amino acid stretch that binds to the SHBG membrane receptor (34) suggest an overall good structural conservation, potentially indicating some conserved functionality. However, at least one key residue (human Asp65) that is crucial for the high-affinity interactions at C3 and at C17 of some steroids (36) and conserved in all other SHBG protein is no longer present in the rainbow trout SHBGb sequence, suggesting also some functional differences in steroid-binding affinities of the rainbow trout SHBGb. To use this divergent sequence for a comparative structure-function analysis, more structural information should be obtained. This could be developed either through in silico modeling approaches using the already available crystal structure of human SHBG steroid-binding site (40) or through the resolution of a partial crystal structure for this new SHBG.

Rainbow trout SHBGb, a functional steroid-binding protein
Circulating SHGB have been found in the plasma of many fish species (12, 41, 42, 43, 44, 45) including salmonids. In rainbow trout, Kd values of 2.6 nM for T and 2.1–16.8 nM for E2 have been reported (12, 46, 47, 48). Binding studies have shown that SHBG was present in trout liver (47, 49, 50) and testis (51). In competitive assays against [3H]T, E2 showed a lower affinity than T, whereas T and E2 showed similar affinity in competitive assays against [3H]E2. Altogether, these data indicate a slightly higher affinity of rainbow trout SHBGa for T than for E2. In comparison, SHBGb showed a higher affinity for [3H]T (Kd = 0.77 nM) than SHBGa, and E2 competed equally to T against [3H]T. It is also noteworthy that, similarly to the classical SHBG form (13, 14, 51), rainbow trout SHBGb has a low binding affinity for 11-ketotestosterone. However, in contrast to the zebrafish and seabass classical SHBG form, rainbow trout SHBGb was able to bind 2-methoxyestradiol but not 5{alpha}-dihydrotestosterone (13, 14). Together, our observations demonstrate that despite the high sequence divergence with classical SHBG proteins, the rainbow trout SHBGb is functional and has similar affinities for estradiol and testosterone. However, more studies are needed to better discriminate the steroid-binding characteristics of the two rainbow trout SHBG. Data on SHBGa have been obtained in studies performed on plasma that also contains other binding proteins such as albumin and corticosteroid-binding globulin (46), whereas our work has been carried out using a recombinant SHBGb. The comparison between the two recombinant proteins would be helpful. Besides, in view of some differences in amino acid sequences between SHBGa and SHBGb, a larger number of steroids should be screened in competition assays. This highly divergent SHBGb provides a good model for such studies aiming at investigating sex steroid binding evolution.

A subfunctionalization of SHBG genes in salmonids
In mammals, SHBG was at first considered as a plasma steroid transporter produced by the liver and involved in the release of steroids in target tissues (2). According to the free hormone hypothesis (3), steroids enter cells by passive diffusion through the plasma membrane after dissociation from their carrier proteins, which may regulate their bioavailability. However, there has been increasing evidence for other SHBG functions supported by interaction with receptors on cell membranes and SHBG internalization (52, 53, 54, 55, 56). This local action on target organs was often associated with the local expression of SHBG in several tissues, including the ovary (5, 8, 9). It seems therefore highly plausible that in addition to the classical steroid-carrier/delivery function, SHBG also has other functions in target organs, including the ovary. The strong expression of rainbow trout shbga in the liver observed in the present study is in total agreement with numerous studies in mammals (57, 58, 59) and fish (13, 15). In contrast, rainbow trout shbgb mRNA was predominantly expressed in the ovary but could not be detected in the liver, even though a sensitive detection method was used. In vertebrates, data on the expression of SHBG in the ovary are scarce. It seems, however, clear that SHBG is expressed in the granulosa cells of the human ovarian follicle (8). In contrast, no shbg expression could be detected in the zebrafish (Danio rerio) and seabass (Dicentrarchus labrax) during oogenesis (13, 15). A weak immunohistochemical signal for SHBG was, however, detected in the sea bass connective tissue around the immature ovary and some post-vitellogenic follicles, but it was attributed to a blood origin (15). In the present study, we clearly showed that rainbow trout SHBGb was locally synthesized in the granulosa layer of the late vitellogenic rainbow trout ovarian follicle. This local expression, along with the lack of expression in liver, is totally consistent with the hypothesis of a gene duplication event in salmonids followed by a rapid evolution of the shbgb paralog and its subsequent subfunctionalization characterized by at least a specific tissue expression pattern.

Evidence for the participation of SHBGb in the estrogenic control of ovarian functions in the trout ovary
In mammals, SHBG-like binding has been found in ovine and human ovarian follicular fluid (60, 61, 62, 63). It was originally hypothesized that SHBG could locally regulate the bioavailability of estradiol and androgens in the ovary. It was, however, stressed that the large quantity of E2 in human preovulatory follicles exceeds the binding capacity for SHBG, and it seemed unlikely that SHBG was regulating estrogen bioavailability in follicular fluid (61). Besides, the similar SHBG levels found in blood and follicular fluid excluded that SHBG was responsible for maintaining the concentration gradient of estradiol from follicle to plasma (60). Together, data available in mammals strongly suggest that SHBG has a specific function in the ovary that is not strictly related to its buffering capacity for steroids.

Using cDNA microarray gene expression profiling, we previously showed that rainbow trout shbgb and ovarian aromatase (cyp19a) exhibited highly correlated ovarian gene expression profiles during final oocyte maturation (21). In the present study, these observations were confirmed by quantitative PCR. Interestingly, a limited up-regulation of shbgb by E2 was observed in vitro during early vitellogenesis, a period when circulating E2 levels increase in vivo. It is, however, noteworthy that this up-regulation was found to be quite variable among females and not always significant. Together, these observations are consistent with the hypothesis of a coregulation of shbgb and cyp19a in the rainbow trout ovary. In addition, both SHBGb and cyp19a are synthesized in the granulosa cells of the late vitellogenic follicle. Thus, shbgb and cyp19a are spatially and temporally coexpressed during late vitellogenesis, post-vitellogenesis, and oocyte maturation. Expression of shbgb is high during late vitellogenesis, before oocyte maturation, at a time when aromatase activity and estradiol levels (64) are also high. Such high expression in granulosa cells of post-vitellogenic ovarian follicles, in species that do not possess an antrum (65), is consistent with the detection of SHBG in follicular fluid of developing dominant mammalian follicles at a time when aromatase activity and estradiol levels are also high (66). The decrease of rainbow trout shbgb and cyp19a gene expression occurs at a time when circulating E2 levels and aromatase activity exhibit a dramatic drop while androstenedione and testosterone levels increase (64, 67). Together, these observations, along with the ovarian-predominant expression of SHBGb suggest that SHBGb participates in the ovarian action of estrogens and/or androgens. Based on existing mammalian literature, SHBGb could either act by regulating estrogens and/or androgens bioavailability in the ovarian follicle or participate actively in the action of estrogens and/or androgens on follicular cells.


    Footnotes
 
These sequence data have been submitted to the GenBank database under accession no. EF577269.

Present address for D.V.: Facultad de Ciencias, Oceanología, Iguá 4225, Montevideo 11400, Uruguay.

Disclosure Statement: The authors have nothing to disclose.

First Published Online March 13, 2008

Abbreviations: DCC, Dextran-coated charcoal; E2, estradiol-17β; EST, expressed sequence tag; F, cortisol; FBS, fetal bovine serum; GAS6, growth arrest 6; PROS1, vitamin k-dependent protein S precursor; T, testosterone.

Received November 30, 2007.

Accepted for publication March 5, 2008.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Selby C 1990 Sex hormone binding globulin: origin, function and clinical significance. Ann Clin Biochem 27(Pt 6):532–541
  2. Siiteri PK, Murai JT, Hammond GL, Nisker JA, Raymoure WJ, Kuhn RW 1982 The serum transport of steroid hormones. Recent Prog Horm Res 38:457–510[Medline]
  3. Mendel CM 1989 The free hormone hypothesis: a physiologically based mathematical model. Endocr Rev 10:232–274[Abstract/Free Full Text]
  4. Kahn SM, Hryb DJ, Nakhla AM, Romas NA, Rosner W 2002 Sex hormone-binding globulin is synthesized in target cells. J Endocrinol 175:113–120[Abstract]
  5. Hryb DJ, Nakhla AM, Kahn SM, St George J, Levy NC, Romas NA, Rosner W 2002 Sex hormone-binding globulin in the human prostate is locally synthesized and may act as an autocrine/paracrine effector. J Biol Chem 277:26618–26622[Abstract/Free Full Text]
  6. Selva DM, Hammond GL 2006 Human sex hormone-binding globulin is expressed in testicular germ cells and not in Sertoli cells. Horm Metab Res 38:230–235[CrossRef][Medline]
  7. Rosner W, Khan MS, Breed CN, Fleisher M, Bradlow HL 1985 Plasma steroid-binding proteins in the cysts of gross cystic disease of the breast. J Clin Endocrinol Metab 61:200–203[Abstract/Free Full Text]
  8. Forges T, Gerard A, Hess K, Monnier-Barbarino P, Gerard H 2004 Expression of sex hormone-binding globulin (SHBG) in human granulosa-lutein cells. Mol Cell Endocrinol 219:61–68[CrossRef][Medline]
  9. Forges T, Gerard A, Monnier-Barbarino P, Gerard H 2005 Immunolocalization of sex hormone-binding globulin (SHBG) in human ovarian follicles and corpus luteum. Histochem Cell Biol 124:285–290[CrossRef][Medline]
  10. Salhanick AC, Callard IP 1980 A sex-steroid-binding protein in the plasma of the freshwater turtle, Chrysemys picta. Gen Comp Endocrinol 42:163–166[CrossRef][Medline]
  11. Paolucci M, Di Fiore MM 1994 Sex steroid binding proteins in the plasma of the green frog, Rana esculenta: changes during the reproductive cycle and dependence on pituitary gland and gonads. Gen Comp Endocrinol 96:401–411[CrossRef][Medline]
  12. Hobby AC, Geraghty DP, Pankhurst NW 2000 Differences in binding characteristics of sex steroid binding protein in reproductive and nonreproductive female rainbow trout (Oncorhynchus mykiss), black bream (Acanthopagrus butcheri), and greenback flounder (Rhombosolea tapirina). Gen Comp Endocrinol 120:249–259[CrossRef][Medline]
  13. Miguel-Queralt S, Knowlton M, Avvakumov GV, Al Nouno R, Kelly GM, Hammond GL 2004 Molecular and functional characterization of sex hormone binding globulin in zebrafish. Endocrinology 145:5221–5230[Abstract/Free Full Text]
  14. Miguel-Queralt S, Avvakumov GV, Blazquez M, Piferrer F, Hammond GL 2005 Sea bass (Dicentrarchus labrax) sex hormone binding globulin: molecular and biochemical properties and phylogenetic comparison of its orthologues in multiple fish species. Mol Cell Endocrinol 229:21–29[CrossRef][Medline]
  15. Miguel-Queralt S, Blazquez M, Piferrer F, Hammond GL 2007 Sex hormone-binding globulin expression in sea bass (Dicentrarchus labrax L.) throughout development and the reproductive season. Mol Cell Endocrinol 276:55–62[CrossRef][Medline]
  16. Thorgaard GH, Bailey GS, Williams D, Buhler DR, Kaattari SL, Ristow SS, Hansen JD, Winton JR, Bartholomew JL, Nagler JJ, Walsh PJ, Vijayan MM, Devlin RH, Hardy RW, Overturf KE, Young WP, Robison BD, Rexroad C, Palti Y 2002 Status and opportunities for genomics research with rainbow trout. Comp Biochem Physiol B Biochem Mol Biol 133:609–646[CrossRef][Medline]
  17. Meyer A, Van de PY 2005 From 2R to 3R: evidence for a fish-specific genome duplication (FSGD). Bioessays 27:937–945[CrossRef][Medline]
  18. Allendorf FW, Thorgaard GH 1984 Tetraploidy and the evolution of salmonid fishes. In: Turner BJ, ed. The evolutionary genetics of fishes. New York: Plenum Press; 1–53
  19. Rexroad CE, Lee Y, Keele JW, Karamycheva S, Brown G, Koop B, Gahr SA, Palti Y, Quackenbush J 2003 Sequence analysis of a rainbow trout cDNA library and creation of a gene index. Cytogenet Genome Res 102:347–354[CrossRef][Medline]
  20. Govoroun M, Le Gac F, Guiguen Y 2006 Generation of a large scale repertoire of expressed sequence tags (ESTs) from normalised rainbow trout cDNA libraries. BMC Genomics 7:196[CrossRef][Medline]
  21. Bobe J, Montfort J, Nguyen T, Fostier A 2006 Identification of new participants in the rainbow trout (Oncorhynchus mykiss) oocyte maturation and ovulation processes using cDNA microarrays. Reprod Biol Endocrinol 4:39[CrossRef][Medline]
  22. Kamangar BB, Gabillard JC, Bobe J 2006 Insulin-like growth factor-binding protein (IGFBP)-1, -2, -3, -4, -5, and -6 and IGFBP-related protein 1 during rainbow trout postvitellogenesis and oocyte maturation: molecular characterization, expression profiles, and hormonal regulation. Endocrinology 147:2399–2410[CrossRef][Medline]
  23. Billard R 1992 Reproduction in rainbow trout: sex differentiation, dynamics of gametogenesis, biology and preservation of gametes. Aquaculture 100:263–298[CrossRef]
  24. Gouret P, Vitiello V, Balandraud N, Gilles A, Pontarotti P, Danchin EG 2005 FIGENIX: intelligent automation of genomic annotation: expertise integration in a new software platform. BMC Bioinformatics 6:198[CrossRef][Medline]
  25. Saitou N, Nei M 1987 The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425[Abstract]
  26. Felsenstein J 1981 Evolutionary trees from DNA sequences: a maximum likelihood approach. J Mol Evol 17:368–376[CrossRef][Medline]
  27. Nei M 1996 Phylogenetic analysis in molecular evolutionary genetics. Annu Rev Genet 30:371–403[CrossRef][Medline]
  28. Bobe J, Nguyen T, Jalabert B 2004 Targeted gene expression profiling in the rainbow trout (Oncorhynchus mykiss) ovary during maturational competence acquisition and oocyte maturation. Biol Reprod 71:73–82[Abstract/Free Full Text]
  29. Mourot B, Nguyen T, Fostier A, Bobe J 2006 Two unrelated putative membrane-bound progestin receptors, progesterone membrane receptor component 1 (PGMRC1) and membrane progestin receptor (mPR) β, are expressed in the rainbow trout oocyte and exhibit similar ovarian expression patterns. Reprod Biol Endocrinol 4:6[CrossRef][Medline]
  30. Vizziano D, Randuineau G, Baron D, Cauty C, Guiguen Y 2007 Characterization of early molecular sex differentiation in rainbow trout, Oncorhynchus mykiss. Dev Dyn 236:2198–2206[CrossRef][Medline]
  31. Taylor CM, Blanchard B, Zava DT 1984 A simple method to determine whole cell uptake of radiolabelled oestrogen and progesterone and their subcellular localization in breast cancer cell lines in monolayer culture. J Steroid Biochem 20:1083–1088[CrossRef][Medline]
  32. Joseph DR, Baker ME 1992 Sex hormone-binding globulin, androgen-binding protein, and vitamin K-dependent protein S are homologous to laminin A, merosin, and Drosophila crumbs protein. FASEB J 6:2477–2481[Abstract]
  33. Joseph DR 1997 Sequence and functional relationships between androgen-binding protein/sex hormone-binding globulin and its homologs protein S, Gas6, laminin, and agrin. Steroids 62:578–588[CrossRef][Medline]
  34. Khan MS, Hryb DJ, Hashim GA, Romas NA, Rosner W 1990 Delineation and synthesis of the membrane receptor-binding domain of sex hormone-binding globulin. J Biol Chem 265:18362–18365[Abstract/Free Full Text]
  35. Avvakumov GV, Grishkovskaya I, Muller YA, Hammond GL 2002 Crystal structure of human sex hormone-binding globulin in complex with 2-methoxyestradiol reveals the molecular basis for high affinity interactions with C-2 derivatives of estradiol. J Biol Chem 277:45219–45225[Abstract/Free Full Text]
  36. Grishkovskaya I, Avvakumov GV, Hammond GL, Catalano MG, Muller YA 2002 Steroid ligands bind human sex hormone-binding globulin in specific orientations and produce distinct changes in protein conformation. J Biol Chem 277:32086–32093[Abstract/Free Full Text]
  37. Ohno S 1999 Gene duplication and the uniqueness of vertebrate genomes circa 1970–1999. Semin Cell Dev Biol 10:517–522[CrossRef][Medline]
  38. Delsuc F, Brinkmann H, Philippe H 2005 Phylogenomics and the reconstruction of the tree of life. Nat Rev Genet 6:361–375[Medline]
  39. Steinke D, Salzburger W, Braasch I, Meyer A 2006 Many genes in fish have species-specific asymmetric rates of molecular evolution. BMC Genomics 7:20[CrossRef][Medline]
  40. Grishkovskaya I, Avvakumov GV, Sklenar G, Dales D, Hammond GL, Muller YA 2000 Crystal structure of human sex hormone-binding globulin: steroid transport by a laminin G-like domain. EMBO J 19:504–512[CrossRef][Medline]
  41. Chang CF, Lee YH 1992 Purification of the sex steroid-binding protein from common carp (Cyprinus carpio) plasma. Comp Biochem Physiol B 101:587–590[CrossRef][Medline]
  42. Corvol P, Bardin CW 1973 Species distribution of testosterone-binding globulin. Biol Reprod 8:277–282[Abstract]
  43. Freeman HC, Idler DR 1971 Binding affinities of blood proteins for sex hormones and corticosteroids in fish. Steroids 17:233–250[CrossRef][Medline]
  44. Laidley CW, Thomas P 1997 Changes in plasma sex steroid-binding protein levels associated with ovarian recrudescence in the spotted seatrout (Cynoscion nebulosus). Biol Reprod 56:931–937[Abstract]
  45. Pasmanik M, Callard G 1986 Characteristics of a testosterone-estradiol binding globulin (TEBG) in goldfish serum. Biol Reprod 35:838–845[Abstract]
  46. Fostier A, Breton B 1975 Binding of steroids by plasma of a teleost: the rainbow trout, Salmo gairdneri. J Steroid Biochem 6:345–351[CrossRef][Medline]
  47. Pottinger TG, Pickering AD 1990 The effect of cortisol administration on hepatic and plasma estradiol-binding capacity in immature female rainbow trout (Oncorhynchus mykiss). Gen Comp Endocrinol 80:264–273[CrossRef][Medline]
  48. Tollefsen KE 2002 Interaction of estrogen mimics, singly and in combination, with plasma sex steroid-binding proteins in rainbow trout (Oncorhynchus mykiss). Aquat Toxicol 56:215–225[CrossRef][Medline]
  49. Foucher JL, Niu PD, Mourot B, Vaillant C, Le Gac F 1991 In vivo and in vitro studies on sex steroid binding protein (SBP) regulation in rainbow trout (Oncorhynchus mykiss): influence of sex steroid hormones and of factors linked to growth and metabolism. J Steroid Biochem Mol Biol 39:975–986[CrossRef][Medline]
  50. Foucher JL, Le Bail PY, Le Gac F 1992 Influence of hypophysectomy, castration, fasting, and spermiation on SBP concentration in male rainbow trout (Oncorhynchus mykiss). Gen Comp Endocrinol 85:101–110[CrossRef][Medline]
  51. Foucher JL, Le Gac F 1989 Evidence for an androgen binding protein in the testis of a teleost fish (Salmo gairdneri R.): a potential marker of Sertoli cell function. J Steroid Biochem 32:545–552[CrossRef][Medline]
  52. Caldwell JD, Suleman F, Chou SH, Shapiro RA, Herbert Z, Jirikowski GF 2006 Emerging roles of steroid-binding globulins. Horm Metab Res 38:206–218[CrossRef][Medline]
  53. Hammond GL 1995 Potential functions of plasma steroid-binding proteins. Trends Endocrinol Metab 6:298–304[CrossRef][Medline]
  54. Joseph DR 1994 Structure, function, and regulation of androgen-binding protein/sex hormone-binding globulin. Vitam Horm 49:197–280[Medline]
  55. Krupenko SA, Krupenko NI, Danzo BJ 1994 Interaction of sex hormone-binding globulin with plasma membranes from the rat epididymis and other tissues. J Steroid Biochem Mol Biol 51:115–124[CrossRef][Medline]
  56. Rosner W, Hryb DJ, Khan MS, Nakhla AM, Romas NA 1999 Sex hormone-binding globulin mediates steroid hormone signal transduction at the plasma membrane. J Steroid Biochem Mol Biol 69:481–485[CrossRef][Medline]
  57. Lee WM, Wong AS, Tu AW, Cheung CH, Li JC, Hammond GL 1997 Rabbit sex hormone binding globulin: primary structure, tissue expression, and structure/function analyses by expression in Escherichia coli. J Endocrinol 153:373–384[Abstract/Free Full Text]
  58. Noe G 1999 Sex hormone binding globulin expression and colocalization with estrogen receptor in the human Fallopian tube. J Steroid Biochem Mol Biol 68:111–117[CrossRef][Medline]
  59. Wong AS, Lui WY, Hui IT, Lee WM 2001 Rabbit sex hormone-binding globulin: expression in the liver and testis during postnatal development and structural characterization by truncated proteins. Int J Androl 24:165–174[CrossRef][Medline]
  60. Andersen CY 1990 Levels of steroid-binding proteins and steroids in human preovulatory follicle fluid and serum as predictors of success in in vitro fertilization-embryo transfer treatment. J Clin Endocrinol Metab 71:1375–1381[Abstract/Free Full Text]
  61. Ben Rafael Z, Mastroianni Jr L, Meloni F, Lee MS, Flickinger GL 1986 Total estradiol, free estradiol, sex hormone-binding globulin, and the fraction of estradiol bound to sex hormone-binding globulin in human follicular fluid. J Clin Endocrinol Metab 63:1106–1111[Abstract/Free Full Text]
  62. Campo SM, Carson RS, Findlay JK 1985 Distribution of specific androgen binding sites within the ovine ovarian follicle. Mol Cell Endocrinol 39:255–265[CrossRef][Medline]
  63. Martin B, Rotten D, Jolivet A, Gautray JP 1981 Binding of steroids by proteins in follicular fluid of the human ovary. J Clin Endocrinol Metab 53:443–447[Abstract/Free Full Text]
  64. Scott AP, Sumpter JP, Hardiman PA 1983 Hormone changes during ovulation in the rainbow trout (Salmo gairdneri Richardson). Gen Comp Endocrinol 49:128–134[CrossRef][Medline]
  65. Jalabert B, Fostier A, Breton B, Weil C 1991 Oocyte maturation in vertebrates. In: Pang P, Schreibman M, eds. Vertebrate endocrinology, fundamentals and biomedical implications. Vol 4. New York: Academic Press; 23–90
  66. Macklon NS, Fauser BC 1998 Follicle development during the normal menstrual cycle. Maturitas 30:181–188[CrossRef][Medline]
  67. Fostier A, Jalabert B 1986 Steroidogenesis in rainbow trout (Salmo gairdneri) at various preovulatory stages: changes in plasma hormone levels and in vivo and in vitro responses of the ovary to salmon gonadotropin. Fish Physiol Biochem 2:87–99[CrossRef]



This article has been cited by other articles:


Home page
EndocrinologyHome page
S. Miguel-Queralt, C. Underhill, R. H. Devlin, and G. L. Hammond
Characterization and Measurement of the Plasma {alpha}- and {beta}-Sex Hormone-Binding Globulin Paralogs in Salmon
Endocrinology, January 1, 2009; 150(1): 366 - 375.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Miguel-Queralt and G. L. Hammond
Sex Hormone-Binding Globulin in Fish Gills Is a Portal for Sex Steroids Breached by Xenobiotics
Endocrinology, September 1, 2008; 149(9): 4269 - 4275.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bobe, J.
Right arrow Articles by Guiguen, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bobe, J.
Right arrow Articles by Guiguen, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals