help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2008-0133
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pedram, A.
Right arrow Articles by Levin, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pedram, A.
Right arrow Articles by Levin, E. R.
Endocrinology Vol. 149, No. 7 3361-3369
Copyright © 2008 by The Endocrine Society

Estrogen Inhibits Cardiac Hypertrophy: Role of Estrogen Receptor-β to Inhibit Calcineurin

Ali Pedram, Mahnaz Razandi, Dennis Lubahn, Jinghua Liu, Mani Vannan and Ellis R. Levin

Department of Medicine (M.R., E.R.L.), Veteran’s Affairs Medical Center Long Beach, Long Beach, California 90822; Department of Medicine (A.P., M.V., E.R.L.), University of California, Irvine, Irvine, California 92697; and Department of Biochemistry (D.L., J.L.), University of Missouri, Columbia, Missouri 65211

Address all correspondence and requests for reprints to: Ellis R. Levin M.D., Medical Service (111-I), Long Beach Veteran’s Affairs Medical Center/University of California-Irvine, 5901 East 7th Street, Long Beach, California 90822. E-mail: ellis.levin{at}va.gov.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Estrogen has been reported to prevent development of cardiac hypertrophy in female rodent models and in humans. However, the mechanisms of sex steroid action are incompletely understood. We determined the cellular effects by which 17β-estradiol (E2) inhibits angiotensin II (AngII)-induced cardiac hypertrophy in vivo. Two weeks of angiotensin infusion in female mice resulted in marked hypertrophy of the left ventricle, exacerbated by the loss of ovarian steroid hormones from oophorectomy. Hypertrophy was 51% reversed by the administration of E2 (insertion of 0.1 mg/21-d-release tablets). The effects of E2 were mainly mediated by the estrogen receptor (ER) β-isoform, because E2 had little effect in ERβ-null mice but comparably inhibited AngII-induced hypertrophy in wild-type or ER{alpha}-null mice. AngII induced a switch of myosin heavy chain production from {alpha} to β, but this was inhibited by E2 via ERβ. AngII-induced ERK activation was also inhibited by E2 through the β-receptor. E2 stimulated brain natriuretic peptide protein expression and substantially prevented ventricular interstitial cardiac fibrosis (collagen deposition) as induced by AngII. Importantly, E2 inhibited calcineurin activity that was stimulated by AngII, related to E2 stimulating the modulatory calcineurin-interacting protein (MCIP) 1 gene and protein expression. E2 acting mainly through ERβ mitigates the important signaling by AngII that produces cardiac hypertrophy and fibrosis in female mice.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
FROM ANIMAL AND human studies, estrogen has been shown to modulate vascular tone and arterial resistance, arterial dilation, and blood flow; lower blood pressure; mitigate the damage of arteries and the heart to various forms of injury; decrease vascular inflammation and atherosclerosis; and prevent cardiac hypertrophy (reviewed in Ref. 1).

As a sequel to myocardial infarction or poorly controlled arterial hypertension, cardiac hypertrophy often results and is an independent risk factor for the development of ischemia, arrhythmia, and sudden death (2, 3). Many factors contribute to myocardial hypertrophy, but signaling by vascular hormones such as angiotensin II (AngII) and endothelin-1 (ET-1) is frequently involved (4). Downstream of the AngII or ET-1 receptors, G{alpha}q/11 activation (5) and increased calcium flux (6) stimulate kinases (e.g. ERK MAPK) and phosphatases that induce the expression of the hypertrophic gene program in ventricular myocytes (7). AngII signaling through the AT1 receptor stimulates calcium-related activation of protein phosphatase 2B (calcineurin) that dephosphorylates several members of the nuclear factor of activated T cells (NFAT) family of transcription factors. As a result, the NFATs translocate to the nucleus of the cardiomyocyte where they induce genes such as myosin heavy chain (MHC)-β that result in cardiomyocyte hypertrophy. The protein products result in remodeling of the muscle sarcomere and neurofilaments and increase protein synthesis, which leads to increased cell size.

Another prominent feature of the hypertrophied myocardium is interstitial fibrosis (8). Fibrosis interferes with coordinated excitation-contraction coupling of cardiomyocytes in systole and diastole and induces diastolic stiffness, impairing cardiac output (9). Increased expression of collagen genes is typically seen in hypertrophied myocardium, resulting in fibrosis.

Myocardial hypertrophy frequently develops in older humans. With aging, a sexual dimorphism appears, and the incidence of hypertrophy in postmenopausal women exceeds that of age-matched men (10). The latter can be reversed in postmenopausal women by hormone replacement therapy (11), suggesting that estrogen may oppose the developmental events in the cardiomyocyte and stroma that produce hypertrophy. Various animal studies also support the anti-hypertrophic action of estrogen in the heart. As an example, estrogen supplementation of ovariectomized female mice causes a 30% reduction in pressure overload-induced hypertrophy (12).

The mechanisms by which estrogen inhibits cardiac hypertrophy are not fully understood. Here we examined the role of estrogen receptor (ER) isoforms to mediate the anti-hypertrophic effects of 17β-estradiol (E2). Upon infusing AngII to create in vivo cardiac hypertrophy, E2 acts mainly through ERβ to prevent critical cellular and molecular events that characterize the pathological condition.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice models
All studies were approved by the Animal Use and Research and Development Committees at the Long Beach Veteran’s Affairs Medical Center and the University of California, Irvine. Thirty 10-wk-old female C57/BJ6 mice, intact or ovariectomized, were obtained from Harlan/Sprague Dawley and were housed in 12-h light, 12-h dark lighting and fed rodent chow devoid of soy or most plant products. Osmotic mini-pumps (Alzet, Durect Corp., Cupertino, CA) filed with AngII (1.1 mg/kg·d) in saline or saline alone provided a 14-d infusion after sc insertion under inhaled chlorofluorane anesthesia. In some mice, an E2 pellet (0.1 mg, 21-d-release pellets; Innovative Research of America, Sarasota, FL) or placebo pellet was also inserted under the skin. This pellet is well documented to produce physiological levels of E2 in the serum of mice (13). At inception and after 14 d, the mice were weighed. At 14 d, the hearts were arrested in diastole by injection of CdCl2 (0.1 mol/liter iv), followed by cervical dislocation. The hearts were removed and weighed, and the ratio of heart to total body weight was determined. Estrogen loss or administration did not significantly affect body weight over the 2-wk period of the study, but heart weight was normalized to initial body weight. Some mice also underwent echocardiographic assessment (see below). For comparison, ovariectomized female wild-type (WT) and ER{alpha} or ERβ gene-deleted mice were obtained from Dennis Lubahn (University of Missouri) (14). The ERβ mice were originally created by Drs. Smithies, Gustafsson, and colleagues (15), and control mice were WT littermates. These mice were subjected to the same conditions of AngII and E2, and all mice were identically housed and fed the same chow at the Veteran’s Affairs animal research facility.

Cardiac hypertrophy
In vivo assessment of various parameters was accomplished by transthoracic echocardiography. Mice were anesthetized with 2% isoflurane, and echocardiograms were performed (Sequoia; Siemens, Mountain View, CA) using a 14-MHz linear probe (15L8; Acuson). An advanced high-frame-rate imaging technique (Paragon; Siemens) was adopted to increase temporal resolution at a frame rate of 120 frames/sec. B-mode images of left ventricular (LV) parasternal long-axis, parasternal short-axis, and apical views were digitally acquired at two to three cardiac cycle lengths. Images of LV short axis were standardized at three levels, base, mid, and apex. M-mode imaging was unified according to American Society of Echocardiography guidelines for measurements of wall thickness, chamber dimensions, and functional parameters. LV wall thicknesses and cavity dimensions were measured on LV M-mode spectra. LV ejection fraction, fractional shortening, and wall thickness ratio were calculated. Vector velocity imaging was employed for quantifications of apical rotation (degrees), circumferential strain (percent), and radial strain (percent).

After 2 wk of hormone infusion, the mice were euthanized, and the hearts were removed and sectioned and stained with hematoxylin and eosin or Masson stain (for collagen). Eight sections per heart were created for analysis, and the data represent six to eight mice per condition. Ventricular protein and RNA was also extracted (16) for additional studies. Heart and body weights were also quantified for comparison among the different mice. Insufficient knockout (KO) mice were available to meaningfully carry out the echocardiographic studies that were done at a later date.

Gene expression and protein detection
RT-PCR was accomplished using the following primers, as we have previously described (16): MCIP1, 5'-GACTGGAGCTTCATTGACTGCGAGA and AAGGAACCTACAGCCTCTTGGAAAG; GAPDH, 5'-AGCCACATCGCTCAGAACAC and GAGGCATTGCTGATGATCTTG. GAPDH expression served as control gene for all studies.

For relative protein detection, immunoblots were carried out on protein extracted from the left ventricle of mice from all conditions, after separation by SDS-PAGE and transfer to nitrocellulose, as we described (17, 18). Cardiac MHC and modulatory calcineurin-interacting protein (MCIP) antibodies (Abcam, Cambridge, MA; and Santa Cruz Biotechnology Inc., Santa Cruz, CA), and brain natriuretic peptide (BNP) antibodies (Peninsula Labs, Mountain View, CA) were used.

Phosphatase and kinase activity
Total phosphatase activity was determined using a BIOMOL kit (Plymouth Meeting, PA) as per the manufacturer’s instructions from proteins isolated from the left ventricle of the various mice at 2 wk of treatment (17). Calcineurin activity was specifically determined by running duplicates of the samples in the presence of EGTA and subtracting this value from the total phosphatase activity. ERK activity was determined as previously described (17) by immunoprecipitating ERK protein from the ventricles of mice subjected to the various experimental conditions. ERK activity was determined in vitro against myelin basic protein substrate.

Fibrosis
Left ventricular tissues were fixed in 4% paraformaldehyde solution. Paraffin-embedded tissue sections (5 µm) were stained with Masson’s trichrome for the presence of interstitial collagen fiber accumulation indicative of cardiac fibrosis. The ratio of interstitial fibrosis to the total LV area was calculated from 10 randomly selected microscopic fields from each of five sections per heart using National Institutes of Health ImageJ analysis software (n = 5 mice per condition).

Further quantification of collagen deposition was made by ventricular content of hydroxyproline, a breakdown product of collagen, determined by a modified method of Bergman and Loxley (19). The ventricular tissues were homogenized and hydrolyzed in 6 N HCl at 110 C for 24 h in a sealed reaction vial. The sample was dried and the residue resuspended in sterile water. Then, 0.5 ml chloramine T was added for 5 min, and Ehrlich’s reagent (3 ml) was added and the mixture left for 18 h at room temperature. The intensity of the red coloration that developed was measured by a spectrophotometer at 558 nm.

Statistics
Data were compared by two-way ANOVA plus Scheffe’s test for significant differences between conditions. Statistical significance of difference was at the 0.05 level.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
E2 inhibits cardiac hypertrophy via ERβ
Female mice receiving AngII infusion over 2 wk demonstrated significant cardiac hypertrophy, especially of the left ventricle (Fig. 1AGo). AngII-induced hypertrophy was most significant in ovariectomized mice not receiving concomitant E2 replacement (about a 70% increase in heart/body weight, 5.2 ± 0.2 to 8.7 ± 0.3 mg/g). E2 replacement significantly reversed by 51% the ventricular enlargement caused by the hypertrophic agent (Fig. 1AGo). Functionally, AngII stimulated significantly increased LV wall thickness, apical rotation, and circumferential and radial strain as determined by echocardiography of anesthetized mice, and these parameters were significantly reversed by E2 (Table 1Go). The strain measurements indicated that AngII induced a hypertrophic muscle phenotype, whereas E2 prevented both the muscle shortening and the enhanced contraction seen. AngII infusion over this 2-wk period did not impair the LV ejection fraction, indicating functional compensation for the induced hypertrophy.


Figure 1
View larger version (50K):
[in this window]
[in a new window]

  		FIG. 1. E2 prevents cardiac hypertrophy induced by AngII. A, Whole hearts were removed and weighed for calculating the ratio of heart weight to body weight. The bar graph is the mean ± SEM from six to eight mice per condition. *, P < 0.05 for WT vs. same receiving AngII or ovariectomized (Ovx) WT vs. same plus AngII. +, P < 0.05 for Ovx WT plus AngII vs. same plus E2. Mice receiving E2 alone were similar to control mice (data not shown). Bar, 2 mm. B, Transverse sections of the ventricles stained with hematoxylin and eosin. a–c, WT mice; d and e, ER{alpha}KO mice; f and g, ERβKO mice; a is saline-infused control; b, d, and f are AngII infusion; and c, e, and g are AngII plus E2 replacement. All mice were ovariectomized. The bar graph represents six to eight mice per condition. *, P < 0.05 for WT (saline control) vs. other condition; +, P < 0.05 for AngII vs. same plus E2 for WT or ER{alpha}KO mouse. Bar, 2 mm.

 

View this table:
[in this window]
[in a new window]

  		TABLE 1. Effect of AngII and estrogen on cardiac parameters

 
We then determined which of the two ER isoforms, {alpha} or β (14, 15), mediates the ability of E2 to counteract the effects of AngII. E2 replacement prevented the hypertrophy induced by AngII in both ovariectomized WT and ER{alpha}KO mice (Fig. 1BGo). In contrast, ERβKO mice did not show reversal of AngII-induced hypertrophy upon administration of the sex steroid. Both ER{alpha} and ERβ are produced in isolated adult and neonatal rodent cardiomyocytes (17). We conclude that the anti-hypertrophic effects of E2 are mediated mainly via ERβ.

E2 inhibits fibrosis due to collagen deposition
An important contributor to the deterioration of cardiac function during prolonged hypertrophy is the development of interstitial fibrosis due to collagen deposition (9). In our model, AngII significantly increased collagen deposition in the interstitium of the left ventricle (Fig. 2AGo). As a novel finding, estrogen replacement inhibited as much as 90% of the fibrosis (Fig. 2Go, A and B) and reduced by about 70% the hydroxyproline content (collagen breakdown product) in the ventricle (Fig. 2CGo). This was seen in both ovariectomized WT and ER{alpha}KO mice. In contrast, E2 had no significant effects in the ERβKO mice. Thus, inhibition of cardiac fibrosis by E2 occurs via ERβ.


Figure 2
View larger version (49K):
[in this window]
[in a new window]

  		FIG. 2. E2 prevents AngII-induced cardiac fibrosis. A, Representative Masson trichrome staining of collagen deposition in the left ventricle of ovariectomized female mice exposed to the indicated conditions is shown (n = 5 mice per condition). Arrows indicate fibrosis. Bar, 0.1 mm. B, The percent area of fibrosis is quantified as described in Materials and Methods, and the bar graph data are the means ± SEM (n = 5 mice per condition). C, Hydroxyproline content of the ventricle was measured by spectrophotometry, and means ± SEM were calculated. *, P < 0.05 for control vs. AngII or vs. AngII plus E2 in the ERβKO mice; +, P < 0.05 for AngII vs. AngII plus E2.

 
E2 modulates important markers of cardiac hypertrophy
In response to agents such as AngII, the hypertrophic gene and protein program is induced. In the normal heart, myosin light chain {alpha} is dominantly expressed with little MHCβ produced, but this is reversed in the hypertrophic heart (20). Here, we find strong expression of MHC{alpha} protein in the ventricle of saline-infused, ovariectomized WT mice (control) and weak expression of MHCβ (Fig. 3AGo). The relative expression of MHC protein isoforms is reversed from 2 wk of AngII treatment, and the AngII effect is prevented significantly by E2 coadministration. Maintenance of normal MHC isoform expression by E2 is evident in the WT and ER{alpha}KO mice but is not seen in ERβKO mice (Fig. 3AGo). This is consistent with ERβ mediating the estrogen effects to prevent hypertrophy.


Figure 3
View larger version (36K):
[in this window]
[in a new window]

  		FIG. 3. E2 modulates important markers of cardiac hypertrophy. A, MHC{alpha} and -β proteins were determined by immunoblot from the pooled ventricles of six mice per condition. GAPDH is shown as a loading control. B, BNP expression in the left ventricle of mice. Individual mouse ventricles were processed for protein extraction to determine BNP expression by immunoblot (n = 6 per condition). *, P < 0.05 for control vs. AngII or E2 or both together. C, AngII activation of ERK is inhibited by E2. Kinase activity in the left ventricle was determined at 2 wk of treatment, from equal amounts of ERK2 protein immunoprecipitated from the three mouse models. Total ERK2 protein is shown as loading control. MBP is myelin basic protein substrate. Bar graph is the mean ± SEM of three experiments combined. *, P < 0.05 for control vs. AngII or AngII plus E2 in ERβKO mice; +, P < 0.05 for AngII vs. AngII plus E2.

 
We also determined the protein expression of BNP in the ventricles of the various mice. In WT mice, both AngII and E2 separately stimulated BNP production; the former probably occurs as compensation for increased cardiac hypertrophy (21) (Fig. 3BGo). Similarly, AngII and E2 each stimulated BNP in ER{alpha}KO mice (compared with saline-infused mice, control). However, only AngII caused this in ERβKO mice. Interestingly, the effect of E2 in ER{alpha}KO mice was approximately 50% reduced from the effects of the sex steroid in WT female mice. This suggests that the stimulation of BNP by E2 also occurs through ER{alpha}, perhaps as a heterodimer with ERβ. The latter idea is suggested by our finding that E2 has no significant effect in the ERβKO mice, where ER{alpha} homodimers are present. We previously showed that both atrial natriuretic peptide (ANP) and BNP production is stimulated by E2 in neonatal rat cardiomyocytes (17). We now report that in vivo, ER{alpha} and ERβ mediate chronic production of this important anti-hypertrophic peptide.

G protein-coupled receptors such as β-adrenergic and ET-1 receptors signal to cardiomyocyte hypertrophy in part through activating ERK (22). Here, we find that 2 wk of AngII administration induced a strong activation of ERK in the ventricles of all mouse models (Fig. 3CGo). E2 significantly inhibited ERK activation by AngII in both WT and ER{alpha}KO mice but failed to do so in ERβKO mice. These findings support our previous short-term observations in isolated cardiomyocytes (17) but additionally implicate ERβ as mediating the chronic inhibition of this hypertrophic signal in vivo.

Calcineurin activity is inhibited and MCIP1 gene expression is induced by E2
An important pathway for the induction of cardiac hypertrophy in response to several relevant stimuli depends upon the activation of calcineurin (protein phosphatase 2B) (23, 24). We now report that AngII strongly stimulates calcineurin activity in WT and either ERKO isoform mice (Fig. 4AGo). E2 significantly inhibits AngII-stimulated calcineurin by 60–75% in both WT and ER{alpha}KO mice, but has little effect in the absence of ERβ.


Figure 4
View larger version (26K):
[in this window]
[in a new window]

  		FIG. 4. Inhibition of calcineurin and stimulation of MCIP1 by E2. A, Calcineurin activity was determined in individual samples from six mouse ventricles per condition in WT or KO mice. *, P < 0.05 for control vs. AngII; +, P < 0.05 for AngII vs. AngII plus E2. B, MCIP gene and protein expression were determined by PCR (top panel) from the pooled ventricular samples of mice (n = 6 per condition) and by Western blot (bottom panel), respectively. Actin is shown as loading control.

 
An important protein that clamps calcineurin activity is MCIP1 (24, 25, 26). To understand whether the effect of E2 could be mediated through this protein, we determined the MCIP1 gene and protein expression in the left ventricle. MCIP expression was strongly stimulated by E2 in WT and ER{alpha}KO mice but much less so in ERβKO mice (Fig. 4BGo). Interestingly, AngII had no effect on this action of E2. We recently reported that E2 signaling through phosphoinositide-3 (PI3) kinase up-regulates MCIP1 gene expression in cultured cardiomyocytes. Furthermore, knockdown of MCIP1 with small interfering RNA in these cells reversed the ability of E2 to inhibit both calcineurin activity and cell hypertrophy in vitro (17). Our data here indicate that ERβ is particularly important for E2 to up-regulate MCIP1 expression in vivo. This is consistent with ERβ mediating E2 inhibition of calcineurin activity in the setting of induced hypertrophy (Fig. 4AGo). Based upon our in vitro and in vivo observations, we suggest this is an important mechanism by which E2 prevents the induction of the hypertrophic gene response to AngII (17).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Estrogen has been previously proposed to significantly prevent cardiac hypertrophy. In ovariectomized mice, E2 administration prevents ventricular remodeling after myocardial infarction (27). Compared with postmenopausal women not taking sex hormone replacement (HR), sex steroid use results in a significant decrease in LV mass (28). HR also decreases significantly the left ventricular mass index in hypertensive women (11, 29). Because blood pressure was not significantly affected in these studies, a direct action of sex steroids on the heart may have occurred. After myocardial infarction, heart failure and death occur less frequently in women taking HR (30). In all these studies, the mechanism of estrogen action was not determined.

In the studies here, we find that E2 strongly inhibits the hypertrophic response to AngII infusion in mice. This includes E2 inhibiting the increased interstitial fibrosis/collagen deposition that is induced by AngII and that eventually impairs cardiac function (8, 9). AngII acting through the type I receptor induces TGF-β1 and SMAD3, responsible for induction of cardiac fibrosis (32, 33). This may be in part related to perivascular fibrosis, resulting from altered extracellular matrix composition and from the transition of cardiac fibroblasts to myofibroblasts (33). At a cellular level, these changes may be related to the activation of c-Jun N-terminal kinase and activator protein I, stemming from reactive oxygen species (ROS) production that stimulates p38 and c-Jun N-terminal kinase (34, 35). ROS formation has increasingly been implicated in myocardial remodeling and hypertrophy (36, 37). We previously showed that E2/ER inhibits hypoxia/reoxygenation-induced ROS formation and resulting p38{alpha} activation, accounting for cell survival in cultured cardiomyocytes (18). We propose that similar mechanisms may underlie E2/ER prevention of cardiac hypertrophy and will serve as a basis for future investigation.

AngII activates several pathways to produce hypertrophy, but a prominent signal for many hypertrophic stimuli is calcium signaling to the up-regulation of calcineurin (protein phosphatase 2B) activity (23, 24, 25). Much data support a central role for calcineurin, and mice that are null for the catalytic subunit of this phosphatase show impaired hypertrophic responses to AngII, aortic constriction, or isoproterenol (38). When calcineurin is induced, it dephosphorylates and promotes the translocation of the transcription factor NFATc3 to the nucleus. In the nucleus, NFATc3 cooperates with GATA-4 and myocyte-enhancing factor transcription factors to stimulate hypertrophic gene expression (38, 39, 40). An important protein that prevents calcineurin activity is the anti-hypertrophic protein MCIP1. Functionally, overexpression of MCIP1 reduces cardiac hypertrophy after aortic banding (24, 25). Here we report that E2 inhibits calcineurin activity that is stimulated by AngII and up-regulates MCIP1 expression in the ventricle. We recently found that small interfering RNA directed to MCIP1 substantially reversed the inhibitory effects of E2 on calcineurin activity, new protein synthesis, and cardiomyocyte hypertrophy. This mechanism accounted for the modulation of NFAT protein translocation to the nucleus and related transcriptional activity, stimulated by AngII and inhibited by E2 (17).

There is also evidence that AngII administration in vivo causes hypertension (41), potentially inducing cardiac hypertrophy indirectly. Estrogen administration might decrease the resulting cardiac phenotype conceptually by lowering blood pressure. This probably occurs through ERβ stimulating nitric oxide synthase activity (42). Very recent studies from Jazbutyte et al. (43) show that administration of an ERβ-specific agonist, 8β-VE2 (Schering Pharmaceutical), to ovariectomized spontaneously hypertensive rats lowers systolic blood pressure and peripheral arterial resistance and attenuates cardiac hypertrophy. It is known that nitric oxide is an anti-hypertrophic factor (44), generated directly in the heart or in endothelial and vascular smooth muscle cells. In cultured rodent cardiomyocytes, we previously showed direct hypertrophic effects of AngII, mitigated by E2. This includes E2 stimulation of nitric oxide production from these cells (17). Thus, the interplay of these two hormones modulates cardiac hypertrophy through several in vivo mechanisms. Consistent with this, activation of ERK is a known stimulus for cardiomyocyte hypertrophy (22), and we find that AngII stimulation of this pathway occurs directly in these cells (17) and now in our in vivo models, both blocked by E2.

From our investigations, a potential mechanism for E2 action can be postulated to understand a model of hypertrophy in genetically altered mice. Targeted deletion of the FKBP12.6 gene from the cardiomyocyte leads to disordered calcium sparking through the ryanodine receptor (45). In these mice, only the postnatal males developed cardiac hypertrophy. However, female mice developed severe hypertrophy when administered the ER antagonist tamoxifen. It is unknown how estrogen modulates the dysregulation of intracellular calcium and downstream events to prevent this hypertrophic phenotype. We suggest that deleted FKBP12.6 enhances calcium-dependent calcineurin activity and subsequent cardiac hypertrophy. Estrogen would mitigate the loss of the FKBP12.6 gene by increasing MCIP1 to down-regulate calcium-induced calcineurin activity, preventing hypertrophy. Mutation and functional loss of FKBP12.6 also predisposes mice or humans to fatal cardiac arrhythmias (46), but it is unknown whether sexual dichotomy also exists in these respects.

As another reported mechanism of E2 action, the sex steroid up-regulates the ANP gene, and this induces a decrease in phenylephrine-induced cardiomyocyte hypertrophy (47). Genetic deletion of the guanylate cyclase A protein, the functional receptor for ANP and BNP, results in pronounced hypertrophy as induced by several stimuli (48). Here we found the BNP protein is stimulated by either AngII or E2. Natriuretic peptides inhibit ET-1 and AngII signaling to cardiomyocyte hypertrophy (49), and we showed that E2 stimulates ANP and BNP production in cultured cardiomyocytes (17).

We also determined that the ERβ mediates the anti-hypertrophic effects of E2. This finding is consistent with previous studies (50, 51), and we report the novel observations that inhibition of ERK and calcineurin activities, stimulation of MCIP1 and BNP, and inhibition of interstitial fibrosis are all mediated through ERβ. This receptor is present mainly in the mitochondria of cardiomyocytes (52), but we have also demonstrated the presence of both ER{alpha} and ERβ at the plasma membrane of adult and neonatal heart muscle cells (17). The membrane-localized ER population (and not the nuclear ER pool) is the one responsible for the modulation of rapid signal transduction in many organs (53). The ability of E2 to signal through PI3 kinase protects rats from ischemia-reperfusion injury in muscle (54), and it has recently been shown that this sex steroid modulates a variety of kinases in the in vivo heart and cultured cardiomyocytes (55). We previously reported that membrane ER/E2 induces PI3 kinase activity that up-regulates MCIP1 transcription (17) and now propose that ERβ mediates these in vivo effects of E2.

In summary, E2 and ERβ significantly inhibit AngII-induced cardiac hypertrophy through multiple novel mechanisms. Direct effects on the myocardium are summarized in Fig. 5Go. AngII-stimulated cardiac hypertrophy is a leading cause of this disorder in humans. If similar actions of E2 occur in women, E2 or ERβ agonist administration may pose a preventative strategy in some individuals. Selective ERβ agonists are particularly attractive for this purpose because they lack the breast and uterine proliferative effects of E2 or selective ER modulators that act at ER{alpha} and thus support the malignant transformation of these tissues (31, 56).


Figure 5
View larger version (52K):
[in this window]
[in a new window]

  		FIG. 5. E2 and ERβ inhibit AngII-induced cardiac hypertrophy. The illustration represents data from in vitro (17 ) and in vivo studies here. AngII binds the AT1 receptor that activates Gq{alpha} and Gβ{gamma} signaling to up-regulate calcium. This signaling induces the activity of protein phosphatase 2B (calcineurin), dephosphorylating NFAT transcription factors in the cytosol. As a result, NFAT proteins (especially NFATc3) move to the nucleus where they collaborate with GATA-4 and MEF-2 transcription factors to stimulate the hypertrophic gene program. AngII also stimulates ERK MAPK signaling to effect gene up-regulation. E2 acting through ERβ stimulates the MCIP1 gene via PI3 kinase (PI3K) signaling, the protein product of which binds/clamps the catalytic activity of calcineurin. This prevents NFAT translocation to the nucleus and inhibits the hypertrophic genes required for cardiomyocyte increase in size (hypertrophy). E2 activating both ER{alpha} and ERβ stimulates the ANP and BNP genes, whose secreted protein products bind the guanylate cyclase A receptor and inhibit AngII-induced ERK activation. NCX, Sodium/calcium exchanger.

 


   Footnotes
 
This work was supported by grants from the Research Service of the Department of Veteran’s Affairs and National Institutes of Health CA-100366 (to E.R.L.).

Disclosure Statement: The authors have nothing to disclose.

First Published Online March 27, 2008

Abbreviations: AngII, Angiotensin II; ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide; E2, 17β-estradiol; ER, estrogen receptor; ET-1, endothelin-1; HR, hormone replacement; KO, knockout; LV, left ventricular; MCIP, modulatory calcineurin-interacting protein; MHC, myosin heavy chain; NFAT, nuclear factor of activated T cells; ROX, reactive oxygen species; WT, wild type.

Received January 28, 2008.

Accepted for publication March 20, 2008.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kim J, Levin ER 2006 Estrogen signaling in the cardiovascular system. Nuclear Receptor Signaling 4:e013–e017
  2. Dunn FG, Pfeffer MA 1999 Left ventricular hypertrophy in hypertension. N Engl J Med 340:1279–1280[Free Full Text]
  3. Saxon LA, De Marco T 2002 Arrhythmias associated with dilated cardiomyopathy. Card Electrophysiol Rev 6:18–25[CrossRef][Medline]
  4. Wagenaar LJ, Voors AA, Buikema H, van Gilst WH 2002 Angiotensin receptors in the cardiovascular system. Can J Cardiol 18:1331–1339[Medline]
  5. D'Angelo DD, Sakata Y, Lorenz JN, Boivin GP, Walsh RA, Liggett SB, Dorn II GW 1997 Transgenic G{alpha}q overexpression induces cardiac contractile failure in mice. Proc Natl Acad Sci USA 94:8121–8126[Abstract/Free Full Text]
  6. Berridge MJ 2006 Remodeling Ca2+ signaling systems and cardiac hypertrophy. Biochem Soc Trans 34:228–231[CrossRef][Medline]
  7. Heineke J, Molkentin JD 2006 Regulation of cardiac hypertrophy by intracellular signaling pathways. Nat Rev Mol Cell Biol 7:589–600[CrossRef][Medline]
  8. Manabe I, Shindo T, Nagai R Gene expression in fibroblasts and fibrosis: involvement in cardiac hypertrophy. Circ Res 91:1103–1113
  9. Berk BC, Fujiwara K, Lehoux S 2007 ECM remodeling in hypertensive heart disease. J Clin Invest 117:568–575[CrossRef][Medline]
  10. Agabiti-Rosei E, Muiesan ML 2002 Left ventricular hypertrophy and heart failure in women. J Hypertens 20:S34–S38
  11. Miya Y, Sumino H, Ichikawa S, Nakamura T, Kanda T, Kumakura H, Takayama Y, Mizunuma H, Sakamaki T, Kurabayashi M 2002 Effects of hormone replacement therapy on left ventricular hypertrophy and growth-promoting factors in hypertensive postmenopausal women. Hypertens Res 25:153–159[Medline]
  12. van Eickels M, Grohe C, Cleutjens JP, Janssen BJ, Wellens HJ, Doevendans PA 2002 17β-Estradiol attenuates the development of pressure-overload hypertrophy. Circulation 104:1419–1423[CrossRef]
  13. Pare G, Krust A, Karas RH, Dupont S, Aronovitz M, Chambon P, Mendelsohn ME 2002 Estrogen receptor-{alpha} mediates the protective effects of estrogen against vascular injury. Circ Res 90:1087–1092[Abstract/Free Full Text]
  14. Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, Smithies O 1993 Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene. Proc Natl Acad Sci USA 90:11162–11166[Abstract/Free Full Text]
  15. Krege JH, Hodgin JB, Couse JF, Enmark E, Warner M, Mahler JF, Sar M, Korach KS, Gustafsson JA, Smithies O 1998 Generation and reproductive phenotypes of mice lacking estrogen receptor β. Proc Natl Acad Sci USA 95:15677–15682[Abstract/Free Full Text]
  16. Pedram A, Razandi M, Aitkenhead M, Hughes CC, Levin ER 2002 Integration of the non-genomic and genomic actions of estrogen: membrane initiated signaling by steroid (MISS) to transcription and cell biology. J Biol Chem 277:50768–50775[Abstract/Free Full Text]
  17. Pedram A, Razandi R, Aitkenhead M, Levin ER 2005 Estrogen inhibits cardiomyocyte hypertrophy in-vitro: antagonism of calcineurin-related hypertrophy through Induction of MCIP1. J Biol Chem 280:26339–26348[Abstract/Free Full Text]
  18. Kim JK, Pedram A, Razandi M, Levin ER 2006 Estrogen prevents cardiomyocyte apoptosis through inhibition of reactive oxygen species and differential regulation of p38 isoforms. J Biol Chem 281:6760–6767[Abstract/Free Full Text]
  19. Bergman I, Loxley R 1970 New spectrophotometric method for the determination of proline in tissue hydrolyzates. Anal Chem 42:702–706[Medline]
  20. Lompre AM, Schwartz K, d'Albis A, Lacombe G, Thiem NV, Swynghedauw B 1979 Myosin isozymes redistribution in chronic heart overloading. Nature 282:105–107[CrossRef][Medline]
  21. Woods RL 2004 Cardioprotective functions of atrial natriuretic peptide and B-type natriuretic peptide: a brief review. Clin Exp Pharmacol Physiol 31:791–794[CrossRef][Medline]
  22. Wang L, Proud CG 2002 Ras/Erk signaling is essential for activation of protein synthesis by Gq protein-coupled receptor antagonists in adult cardiomyocytes. Circ Res 91:821–829[Abstract/Free Full Text]
  23. Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Robbins J, Grant SR, Olson, EN 1998 A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell 93:215–228[CrossRef][Medline]
  24. Vega RB, Bassel-Duby R, Olson EN 2003 Control of cardiac growth and function by calcineurin signaling. J Biol Chem 278:36981–36984[Free Full Text]
  25. Rothermel BA, McKinsey TA, Vega RB, Nicol RL, Mammen P, Yang J, Antos CL, Shelton JM, Bassel-Duby R, Olson EN, Williams RS 2001 Myocyte-enriched calcineurin-interacting protein, MCIP1, inhibits cardiac hypertrophy in vivo. Proc Natl Acad Sci USA 98:3328–3333[Abstract/Free Full Text]
  26. Vega RB, Yang J, Rothermel BA, Bassel-Duby R, Williams RS 2002 Multiple domains of MCIP1 contribute to inhibition of calcineurin activity. J Biol Chem 277:30401–30407[Abstract/Free Full Text]
  27. Cavasin MA, Sankey SS, Yu AL, Menon S, Yang XP 2003 Estrogen and testosterone have opposing effects on chronic cardiac remodeling and function in mice with myocardial infarction. Am J Physiol Heart Circ Physiol 284:H1560–H1569
  28. Lim WK, Wren B, Jepson N, Roy S, Caplan G 1999 Effect of hormone replacement therapy on left ventricular hypertrophy. Am J Cardiol 83:1132–1134[CrossRef][Medline]
  29. Light KC, Hinderliter AL, West SG, Grewen KM, Steege JF, Sherwood A, Girdler SS 2001 Hormone replacement improves hemodynamic profile and left ventricular geometry in hypertensive and normotensive postmenopausal women. J Hypertens 19:269–278[CrossRef][Medline]
  30. Shlipak MG, Angeja BG, Go AS, Frederick PD, Canto JG, Grady D 2001 Hormone therapy and in-hospital survival after myocardial infarction in postmenopausal women. Circulation 104:2300–2304[Abstract/Free Full Text]
  31. Pearce ST, Jordan VC 2004 The biological role of estrogen receptors {alpha} and β in cancer. Crit Rev Oncol Hematol 50:3–22[Medline]
  32. Weber KT, Swamynathan SK, Guntaka RV, Sun Y 1999 Angiotensin II and extracellular matrix homeostasis. Int J Biochem Cell Biol 31:395–403[CrossRef][Medline]
  33. Sorescu D 2006 Smad3 mediates angiotensin II and TGF-β1-induced vascular fibrosis: Smad3 thickens the plot. Circ Res 98:988–989[Free Full Text]
  34. Mehta PK, Griendling KK 2007 Angiotensin II cell signaling: physiological and pathological effects in the cardiovascular system. Am J Physiol Cell Physiol 292:C82–C97
  35. Bagrodia S, D'Erijard B, Davis RJ, Cerione RA 1995 Cdc42 and PAK-mediated signaling leads to Jun kinase and p38 mitogen-activated protein kinase activation. J Biol Chem 270:27995–27998[Abstract/Free Full Text]
  36. Siwik DA, Tzortzis JD, Pimental DR, Chang DL, Pagano PJ, Singh K, Sawyer DB, Colucci WS 1999 Inhibition of copper-zinc superoxide dismutase induces cell growth, hypertrophic phenotype, and apoptosis in neonatal rat cardiac myocytes in vitro. Circ Res 85:147–153[Abstract/Free Full Text]
  37. Shiomi T, Tsutsui H, Matsusaka H, Murakami K, Hayashidani S, Ikeuchi M, Wen J, Kubota T, Utsumi H, Takeshita A 2004 Overexpression of glutathione peroxidase prevents left ventricular remodeling and failure after myocardial infarction in mice. Circulation 109:544–549[Abstract/Free Full Text]
  38. Bueno OF, Wilkins BJ, Tymitz KM, Glascock BJ, Kimball TF, Lorenz JN, Molkentin JD 2002 Impaired cardiac hypertrophic response in calcineurin Aβ-deficient mice. Proc Natl Acad Sci USA 99:4586–4591[Abstract/Free Full Text]
  39. Wilkins BJ, De Windt LJ, Bueno OF, Braz JC, Glascock BJ, Kimball TF, Molkentin JD 2002 Targeted disruption of NFATc3, but not NFATc4, reveals an intrinsic defect in calcineurin-mediated cardiac hypertrophic growth. Mol Cell Biol 22:7603–7613[Abstract/Free Full Text]
  40. Fuentes JJ, Genesca L, Kingsbury TJ, Cunningham KW, Perez-Riba M, Estivill X, de la Luna S 2000 DSCR1, overexpressed in Down syndrome, is an inhibitor of calcineurin-mediated signaling pathways. Hum Mol Genet 9:1681–1690[Abstract/Free Full Text]
  41. Kawada N, Imai E, Karber A, Welch WJ, Wilcox CS 2002 A mouse model of angiotensin II slow pressor response: role of oxidative stress. J Am Soc Nephrol 13:2860–2868[Abstract/Free Full Text]
  42. Zhu Y, Bian Z, Lu P, Karas RH, Bao L, Cox D, Hodgin J, Shaul PW, Thoren P, Smithies O, Gustafsson JA, Mendelsohn ME 2002 Abnormal vascular function and hypertension in mice deficient in estrogen receptor β. Science 295:505–508[Abstract/Free Full Text]
  43. Jazbutyte V, Arias-Loza PA, Hu K, Widder J, Govindaraj V, Poser-Klein C, Bauersachs J, Fritzemeier KH, Hegele-Hartung C, Neyses L, Ertl G, Pelzer T 2007 Ligand-dependent activation of ERβ lowers blood pressure and attenuates cardiac hypertrophy in ovariectomized spontaneously hypertensive rats. Cardiovasc Res 77:774–781[CrossRef][Medline]
  44. Brede M, Roell W, Ritter O, Wiesmann F, Jahns R, Haase A, Fleischmann BK, Hein L 2003 Cardiac hypertrophy is associated with decreased eNOS expression in angiotensin AT2 receptor-deficient mice. Hypertension 42:1177–1182[Abstract/Free Full Text]
  45. Xin HB, Senbonmatsu T, Cheng DS, Wang YX, Copello JA, Ji GJ, Collier ML, Deng KY, Jeyakumar LH, Magnuson MA, Inagami T, Kotlikoff MI, Fleischer S 2002 Oestrogen protects FKBP12.6 null mice from cardiac hypertrophy. Nature 416:334–338[CrossRef][Medline]
  46. Wehrens XH, Lehnart SE, Reiken SR, Deng SX, Vest JA, Cervantes D, Coromilas J, Landry DW, Marks AR 2004 Protection from cardiac arrhythmia through ryanodine receptor-stabilizing protein calstabin2. Science 304:292–296[Abstract/Free Full Text]
  47. Babiker FA, De Windt LJ, van Eickels M, Thijssen V, Bronsaer RJ, Grohe C, van Bilsen M, Doevendans PA 2004 17β-Estradiol antagonizes cardiomyocyte hypertrophy by autocrine/paracrine stimulation of a guanylyl cyclase A receptor-cyclic guanosine monophosphate-dependent protein kinase pathway. Circulation 109:269–276[Abstract/Free Full Text]
  48. Klinger JR, Warburton RR, Pietras L, Oliver P, Fox J, Smithies O, Hill NS 2002 Targeted disruption of the gene for natriuretic peptide receptor-A worsens hypoxia-induced cardiac hypertrophy. Am J Physiol Heart Circ Physiol 282:H58–H65
  49. Hayashi D, Kudoh S, Shiojima I, Zou Y, Harada K, Shimoyama M, Imai Y, Monzen K, Yamazaki T, Yazaki Y, Nagai R, Komuro I 2004 Atrial natriuretic peptide inhibits cardiomyocyte hypertrophy through mitogen-activated protein kinase phosphatase-1. Biochem Biophys Res Commun 322:310–319[CrossRef][Medline]
  50. Skavdahl M, Steenbergen C, Clark J, Myers P, Demianenko T, Mao L, Rockman HA, Korach KS, Murphy E 2005 Estrogen receptor-β mediates male-female differences in the development of pressure overload hypertrophy. Am J Physiol Heart Circ Physiol 288:H469–H476
  51. Babiker FA, Lips D, Meyer R, Delvaux E, Zandberg P, Janssen B, van Eys G, Grohe C, Doevendans PA 2006 Estrogen receptor β protects the murine heart against left ventricular hypertrophy. Arterioscl Thromb Vasc Biol 26:1524–1530[Abstract/Free Full Text]
  52. Yang SH, Liu R, Perez EJ, Wen Y, Stevens Jr SM, Valencia T, Brun-Zinkernagel AM, Prokai L, Will Y, Dykens J, Koulen P, Simpkins JW 2004 Mitochondrial localization of estrogen receptor β. Proc Natl Acad Sci USA 101:4130–4135[Abstract/Free Full Text]
  53. Razandi M, Alton G, Pedram A, Ghonshani S, Webb D, Levin ER 2003 Identification of a structural determinant for the membrane localization of ER{alpha}. Mol Cell Biol 23:1633–1646[Abstract/Free Full Text]
  54. Simoncini T, Hafezi-Moghadam A, Brazil DP, Ley K, Chin WW, Liao JK 2000 Interaction of oestrogen receptor with the regulatory subunit of phosphatidylinositol-3-OH kinase. Nature 407:538–541[CrossRef][Medline]
  55. Satoh M, Matter CM, Ogita H, Takeshita K, Wang CY, Dorn II GW, Liao JK 2007 Inhibition of apoptosis-regulated signaling kinase-1 and prevention of congestive heart failure by estrogen. Circulation 115:3197–3204[Abstract/Free Full Text]
  56. Shang Y 2006 Molecular mechanisms of oestrogen and SERMs in endometrial carcinogenesis. Nat Rev Cancer 6:360–368[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Cardiovasc ResHome page
A. Fritah, J. H. Steel, D. Nichol, N. Parker, S. Williams, A. Price, L. Strauss, T. A. Ryder, M. A. Mobberley, M. Poutanen, et al.
Elevated expression of the metabolic regulator receptor-interacting protein 140 results in cardiac hypertrophy and impaired cardiac function
Cardiovasc Res, January 21, 2010; (2010): cvp418v2 - cvp418.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
S. Soriano, A. B. Ropero, P. Alonso-Magdalena, C. Ripoll, I. Quesada, B. Gassner, M. Kuhn, J.-A. Gustafsson, and A. Nadal
Rapid Regulation of KATP Channel Activity by 17{beta}-Estradiol in Pancreatic {beta}-Cells Involves the Estrogen Receptor {beta} and the Atrial Natriuretic Peptide Receptor
Mol. Endocrinol., December 1, 2009; 23(12): 1973 - 1982.
[Abstract] [Full Text] [PDF]

Home page
 J. Physiol.Home page
E. R. Levin
Membrane oestrogen receptor \#945; signalling to cell functions
J. Physiol., November 1, 2009; 587(21): 5019 - 5023.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. R. Levin
Rapid signaling by steroid receptors
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2008; 295(5): R1425 - R1430.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pedram, A.
Right arrow Articles by Levin, E. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pedram, A.
Right arrow Articles by Levin, E. R.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals