help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2008-0353
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paluzzi, J.-P.
Right arrow Articles by Orchard, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paluzzi, J.-P.
Right arrow Articles by Orchard, I.
Endocrinology Vol. 149, No. 9 4638-4646
Copyright © 2008 by The Endocrine Society

Isolation, Cloning, and Expression Mapping of a Gene Encoding an Antidiuretic Hormone and Other CAPA-Related Peptides in the Disease Vector, Rhodnius prolixus

Jean-Paul Paluzzi, William K. Russell, Ronald J. Nachman and Ian Orchard

Department of Biology (J.-P.P., I.O.), University of Toronto Mississauga, Mississauga, Ontario, Canada L5L 1C6; Areawide Pest Management Research (R.J.N.), Southern Plains Agricultural Research Center, U.S. Department of Agriculture, College Station, Texas 77845; and Department of Chemistry (W.K.R.), The Laboratory for Biological Mass Spectrometry, Texas A&M University, College Station, Texas 77843

Address all correspondence and requests for reprints to: Jean-Paul Paluzzi, Department of Biology, University of Toronto Mississauga, South Building (Room 3016A), 3359 Mississauga Road North, Mississauga, Ontario, Canada L5L 1C6. E-mail: jeanpaul.paluzzi{at}utoronto.ca.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
After a blood meal, Rhodnius prolixus undergoes a rapid diuresis to eliminate excess water and salts. During the voiding of this primary urine, R. prolixus acts as a vector of Chagas’ disease, with the causative agent, Trypanosoma cruzi, infecting the human host via the urine. Diuresis in R. prolixus is under the neurohormonal control of serotonin and peptidergic diuretic hormones, and thus, diuretic hormones play an important role in the transmission of Chagas’ disease. Although diuretic hormones may be degraded or excreted, resulting in the termination of diuresis, it would also seem appropriate, given the high rates of secretion, that a potent antidiuretic factor could be present and act to prevent excessive loss of water and salts after the postgorging diuresis. Despite the medical importance of R. prolixus, no genes for any neuropeptides have been cloned, including obviously, those that control diuresis. Here, using molecular biology in combination with matrix-assisted laser desorption ionization-time of flight-tandem mass spectrometry, we determined the sequence of the CAPA gene and CAPA-related peptides in R. prolixus, which includes a peptide with anti-diuretic activity. We have characterized the expression of mRNA encoding these peptides in various developmental stage and also examined the tissue-specific distribution in fifth-instars. The expression is localized to numerous bilaterally paired cell bodies within the central nervous system. In addition, our results show that RhoprCAPA gene expression is also associated with the testes, suggesting a novel role for this family of peptides in reproduction.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE HEMATOPHAGOUS INSECT, Rhodnius prolixus, can transmit Chagas’ disease after feeding on humans in Central and South America where the insects are endemic (1, 2, 3, 4). The parasite, Trypanosoma cruzi, infects humans when it is passed out of the insect in the primary urine produced as a result of the large blood meal imbibed. The parasite often enters the human host through the wound left after the blood meal. The postprandial diuresis is under the neurohormonal control of serotonin [5-hydroxytryptamine (5-HT)] and various peptidergic diuretic hormone (DH) families acting on the Malpighian tubules (MTs) (5, 6, 7, 8, 9, 10, 11). In this regard, it might be stated that serotonin and the DHs aid in the transmission of Chagas’ disease; disrupting diuresis would therefore disrupt the transmission of the parasite. Despite the medical importance of R. prolixus, no genes have been cloned for any neuropeptides, although with the announcement of National Institutes of Health funding the R. prolixus genome project, prospects for the future are positive (http://www.genome.gov/13014443).

Much is known about the neurohormonal control of diuresis in insects, including R. prolixus, and a number of DH families have been identified. These peptide families include the corticotropin-releasing factor-related DHs, calcitonin-related DHs, kinin-related DHs, and cardioaccelatory peptide 2b (CAP2b)-related DHs (for review see Refs. 5, 6, 7, 8, 9, 10, 11, 12, 13).

In contrast to these diuretic factors that stimulate MT secretion, only a few antidiuretic factors that specifically inhibit MT secretion have been identified. Two peptides have been isolated from the yellow mealworm beetle, Tenebrio molitor, antidiuretic factor (ADF)-a and ADFb, which act via cGMP to inhibit basal as well as native corticotropin-releasing factor-stimulated secretion of tubules (14, 15, 16). Additional factors have been partially isolated from other insects such as the cricket, Acheta domesticus (17); the mosquito, Aedes aegypti (18); the forest ant, Formica polyctena (19); and the Colorado potato beetle, Leptinotarsa decemlineata (20). Interestingly, CAP2b, originally identified in Manduca sexta, has been shown to have antidiuretic activity in R. prolixus and appears to use cGMP as a second messenger (21). This is surprising because CAP2b-related peptides are potent stimulators of MT secretion in some other insects, including Drosophila melanogaster. Using a combination of immunohistochemical, physiological, and chromatographic methods, we recently partially isolated a native CAP2b-related peptide from the central nervous system (CNS) of R. prolixus that has antidiuretic activity. This endogenous antidiuretic factor appears to be released at a time when the cessation of diuresis is observed naturally and has a potent inhibitory effect on serotonin-stimulated fluid secretion and levates levels of its cognate intracellular mediator, cGMP (22). For a blood-gorging insect such as R. prolixus, which undergoes a very rapid diuresis after a blood meal, it is of importance to understand the efficient antidiuretic mechanism acting to prevent excessive loss of water and salts.

Here, using molecular biology in combination with matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) tandem mass spectrometry, we determined the sequence of the capability (CAPA) gene in R. prolixus, which encodes the peptidergic antidiuretic peptide, CAP2b. This peptide inhibits serotonin-stimulated diuresis and elevates cGMP content of serotonin-stimulated MTs. We characterized the expression of mRNA encoding these peptides in all postembryonic developmental stages and have examined the spatial expression pattern in various tissues of fifth-instars using RT-PCR. In addition, fluorescent in situ hybridization (FISH) using peroxidase-mediated tyramide signal amplification was used to monitor the cell-specific expression of the R. prolixus CAPA gene in fifth-instars. With the identification of this potent endogenous antidiuretic peptide, future investigations may focus on the design of mimetic analogs of this peptide that would serve as prospective pest management agents to inhibit the rapid production of primary urine that immediately follows blood gorging, thereby impeding the transmission of Chagas’ disease by this human blood-feeding disease vector.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
Fifth-instar R. prolixus Stål were reared at high relative humidity in incubators at 25 C and routinely fed on rabbits’ blood. Tissues were dissected from insects under physiological saline prepared as described previously (22) in diethyl pyrocarbonate-treated double distilled water to remove contaminating nucleases.

Degenerate primer design over conserved regions of insect CAPA precursors
Previously identified CAPA precursor sequences from D. melanogaster (23) and Manduca sexta (24) along with putative sequences from online genome databases (http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi?organism=insects) for Anopheles gambiae, Bombyx mori, and Tribolium castaneum, identified by tblastn search using the D. melanogaster precursor sequence (accession no. NP_524552.1), were aligned with ClustalW and conserved regions were used to design degenerate primers to amplify the CAPA precursor in R. prolixus. The amino acid sequence FPRVGR corresponding to the C-terminal region of the first commonly encoded peptide was chosen for design of the forward degenerate primers FPRVGR for1a and FPRVGR for1b with sequences of TTYCCNCGNGTNGGRCG and TTYCCNCGNGTNGGYCG, respectively. The amino acid sequence WFGPRLG corresponding to the C-terminal region of the third encoded peptide was chosen for design of the reverse degenerate primers WFGPRLG rev1a and WFGPRLG rev1b with sequences of CCNARNCKNGGRCCRAACCA and CCNARNCKNGGYCCRAACCA, respectively. Two primer variants were designed to lower the degeneracy and reduce amplification of nonspecific products.

Two-step RT-PCR methods
Synthesis of first-strand cDNA was carried out using the RevertAid H Minus first strand cDNA synthesis kit (Fermentas, Burlington, Ontario, Canada) following manufacturer recommendations. An aliquot of this first-strand synthesis reaction was used as a template for the subsequent PCR using the degenerate primers indicated above. Conditions for PCR were as follows: initial denaturation for 3 min at 95 C, 40 cycles of denaturation at 94 C for 45 sec, annealing at 57 C for 45 sec, and extension at 72 C for 1 min and a final extension at 72 C for 10 min. Based on CAP2b/CAPA encoding nucleotide sequences identified in other orders, the predicted size of the PCR product would be in the range of 100–300 bp.

Construction and screening of fifth-instar CNS cDNA library
The Creator SMART cDNA library construction kit (CLONTECH, Mountain View, CA) was used to produce a cDNA library from CNS tissues of fifth-instar R. prolixus. Briefly, 400 central nervous systems (CNSs) from insects fed 7–8 wk previously were dissected and mRNA isolated using the Quickprep micro-mRNA purification kit (GE Healthcare, Piscataway, NJ). Library construction followed a PCR-based protocol following the manufactures recommendations with some minor modifications. Specifically, 1.5 µg mRNA was used in the first-strand synthesis reaction and second-strand synthesis (cDNA amplification) was carried out using long-distance PCR with the fewest number of cycles recommended to reduce the number of nonspecific PCR products. Once cycling was complete, amplified transcripts were prepared for ligation to the supplied library cloning vector, pDNR-LIB. Transformation of recombinant plasmids into Escherichia coli was carried out using ElectroMAX DH5{alpha}-E cells (Invitrogen, Burlington, Ontario, Canada) and electroporator set at 1.8 kV. The final amplified library had a titer of greater than 1010 cfu/ml and recombinant efficiency of more than 90%.

Library plasmid DNA prepared by standard maxiprep procedure was used as template for 5' and 3' rapid amplification of cDNA ends (RACE) PCR. Gene-specific primers (gsp) were designed based on the partial sequence encoding a R. prolixus CAPA precursor obtained in the two-step RT-PCR using degenerate primers (see Results). 3' RACE gsp were as follows: CAPA FOR1, TGCAAGAAATTTCCCAGCC; CAPA FOR2, TTGGGGGATGATAGTCGG; and CAPA FOR3, CAAGAGGAACGGAGGTGG. These 3' RACE gsp were used successively combined with the plasmid reverse primer (pDNR-LIB REV1, with the sequence GCCAAACGAATGGTCTAGAAAG) in a seminested PCR approach to increase the specificity of the amplified 3' RACE products. Similarly, 5' RACE gsp were designed as follows: CAPA REV1, ATAGGCCTCCACCGTTTCC; CAPA REV2, CTTGGGGCCAGATCTTCC; and CAPA REV3, CTATCATCCCCCAAGTGGC. These 5' RACE gsp were used successively combined with the plasmid forward primer (pDNR-LIB FOR1, with the sequence GTGGATAACCGTATTACCGCC) in a seminested PCR approach to increase the specificity of the amplified 5' RACE products. Conditions for both 5' and 3' RACE PCR were as follows: 3 min initial denaturation at 95 C, 40 cycles of denaturation for 30 sec at 94 C, annealing for 30 sec at 61 C, extension for 1 min at 72 C, and a final extension for 10 min at 72 C. Amplified fragments were visualized on an agarose gel-stained with ethidium bromide, extracted, and cloned using the pGEM-T Easy Vector System (Promega, Madison, WI). Sequencing was carried out at the Centre for Applied Genomics at the Hospital for Sick Children (MaRS Centre, Toronto, Ontario, Canada), and sequences were confirmed from at least three independent clones to ensure base accuracy.

Genomic Southern blot analysis
High-molecular-weight genomic DNA was isolated from various tissues of fifth-instar R. prolixus and digested with a selection of restriction endonucleases. The digest reactions were carried out in a total volume of 500 µl, and additional enzyme was added every 6 h for a total incubation of 24 h to ensure complete digestion of genomic DNA. Fragmented DNA was then purified, electrophoresed on a 1% agarose gel for 4 h at 10 V/cm (2 µg per lane), and transferred to a positively charged nylon membrane (Roche, Mannheim, Germany) via downward capillary transfer. The membrane was then baked at 80 C for 2 h to bind the DNA and subsequently stored in a sealed plastic bag at room temperature until hybridization. Southern hybridization was carried out using the Gene Images AlkPhos direct labeling and detection system (GE Healthcare). Manufacturer recommendations were followed with some minor modifications and user-defined conditions. Specifically, hybridization included an alkaline phosphatase-labeled RhoprCAPA 675bp cDNA (nucleotide ranging 12–687) at a probe concentration of 25 ng/ml hybridization solution containing 4% block and 0.5 M NaCl and 60 C overnight (~18–20 h) incubation. Stringency washes and signal generation with ECF substrate were carried out following manufacturer recommendations. Signal development was monitored at various time points and detected using fluorescence scanning instrumentation (STORM 840; Molecular Dynamics, GE Healthcare, Piscataway, NJ) and analyzed using ImageQuant TL software (Amersham Biosciences, Piscataway, NJ).

Developmental and tissue-specific expression profile monitored with RT-PCR
Insects from each postembryonic developmental stage of R. prolixus subjected to similar feeding regimens were flash frozen in liquid nitrogen and ground using a mortar and pestle. The ground tissues were then used in mRNA isolation as discussed above. RhoprCAPA gene expression associated with each stage examined was monitored using a OneStep RT-PCR approach (QIAGEN, Mississauga, Ontario, Canada). The reaction parameters were as follows: forward, CAPA FOR2 (see above) and reverse primer, CAPA REVII (CAAGTATTACATAAAATGAAACGAGTGC); 20 ng template mRNA from each stage (first to fifth-instar and adult); reverse transcription for 30 min at 50 C followed directly by the initial PCR activation step for 15 min at 95 C, 33 cycles of denaturation for 30 sec at 94 C, annealing for 30 sec at 59 C, and extension for 1 min at 72 C. Lastly, the reaction included a final extension step for 10 min at 72 C. Similar experimental parameters were used for monitoring the spatial expression profile in various tissues of fifth-instar R. prolixus. Tissues were dissected from insects and stored in RNAlater solution (Ambion, Austin, TX) until mRNA was isolated as discussed above. Again, 20 ng mRNA from each tissue source were used as a template in RT-PCR, and all parameters were maintained as above with the following exceptions: a reduction to 30 cycles and different forward and reverse primers: RhoprSPISSfor, GCATGCGACATTGTTTTTTC and CAPA REV1 (see sequence above), respectively. For both the developmental and tissue-specific expression analysis, a Rhopr β-actin 317-bp fragment was amplified using forward and reverse primers, RhoprACTIN for1, ACACCCAGTTTTGCTTACGG and RhoprACTIN rev1, GTTCGGCTGTGGTGATGA, respectively, which served as a positive control to monitor the integrity of template mRNA.

Expression localization using FISH
Assessment of cell-specific spatial expression was accomplished using methods modeled on the FISH protocols optimized for D. melanogaster embryos and tissues using peroxidase-mediated tyramide signal amplification (25, 26, 27). Digoxigenin (DIG)-labeled RNA was synthesized from a linearized recombinant plasmid DNA containing a 716-bp RhoprCAPA cDNA fragment by in vitro transcription using the DIG RNA labeling kit SP6/T7 (Roche Applied Science, Mannheim, Germany) following manufacturer recommendations. Once DIG-labeled RNA synthesis was complete, template DNA was removed with deoxyribonuclease I, and the probe was precipitated by adding 0.1 vol 3 M sodium acetate and 2.5 vol 100% ice-cold ethanol and placed at –80 C overnight. The next day, precipitated labeled-RNA probe was pelleted by centrifugation, washed with ice-cold 70% ethanol, resuspended in 40 µl of ribonuclease-free double-distilled H2O, and stored at –80 C. Tissues were dissected in PBS and stored briefly (<5 min) in a microcentrifuge tube containing the same solution. Once enough tissue was dissected, the PBS was replaced with freshly prepared working-stock fixation solution (40% paraformaldehyde-PBS, 1:9) and incubated for 30 min at room temperature. After this primary fixation, tissues were washed five times with PBS and 0.1% Tween 20 (PBT) and subsequently incubated in 4% Triton X-100 (Sigma Aldrich, Oakville, Ontario, Canada) in PBT for 10 min at room temperature and an extended incubation on ice for 30 min. The detergent solution was then removed and tissues were washed several times in PBT for 5 min each to terminate digestion, with the final wash in PBT extended for 15 min.

Tissues were subsequently incubated at room temperature in working-stock fixation solution (see above). After this secondary fixation, tissues were washed five times with PBT for 2 min each to remove all remaining fixative. The tissues were then rinsed in a 1:1 mixture of PBT-RNA hybridization solution (50% formamide, 5x saline sodium citrate, 100 µg/ml heparin, 100 µg/ml sonicated salmon sperm DNA, and 0.1% Tween 20; filter sterilized through a 0.2-µm filter, and stored in aliquots at –20 C), which was then replaced by 100% RNA hybridization solution in which tissues were stored at –20 C for several days. An aliquot (300 µl/sample) of hybridization solution was boiled at 100 C for 5 min and then cooled on ice for a minimum of 5 min and used as the prehybridization solution. Samples were transferred to 0.5-ml microcentrifuge tubes and incubated with prehybridization solution in an incubator set at 56 C for a minimum of 1.5–2 h. Toward the end of the prehybridization incubation, an additional aliquot as above of hybridization solution plus 200 ng of antisense probe (or sense probe for controls) was incubated at 75 C for 3–4 min to denature the probe and cooled on ice for at least 5 min or until prehybridization was completed. At the end of the prehybridization, the solution was removed and replaced with hybridization solution containing labeled probe and incubated overnight (16–18 h) at 56 C. Wash solutions were preheated to 56 C and the hybridization solution-containing probe was removed and tissues rinsed twice with 400 µl fresh hybridization solution and incubated at 56 C for 10 min. The samples were then washed with 400 µl of prewarmed 3:1, 1:1, and 1:3 (vol/vol) mixtures of hybridization solution-PBT for 10 min each. The samples were then washed three times with prewarmed PBT and acclimatized to room temperature. Samples were then processed for signal development using PBT with 1% blocking reagent (PBTB) containing primary or secondary antibodies or tyramide substrate. PBT was removed from samples and replaced with 400 µl of PBTB and incubated at room temperature with constant mixing for 15 min.

After this initial block, tissue samples were incubated with biotin-SP-conjugated IgG fraction monoclonal mouse antidigoxin (Jackson ImmunoResearch Laboratories Inc., West Grove, PA) at a dilution of 1:400 for 2 h with constant mixing and protected from light. After this primary antibody incubation, tissues were washed for 2 h with several changes of PBTB. Tissues were then transferred to a 1:100 dilution of horseradish peroxidase-streptavidin stock solution (Molecular Probes, Eugene, OR) in PBTB and incubated for 1 h with constant mixing and protected from light. Tissue samples were then washed for 2 h with several changes of PBTB followed by two brief washes in PBT and three 5-min washes in PBS. Toward the end of the final wash, Alexa Fluor 568 tyramide working solution was prepared by diluting stock solution 1:100 in working stock amplification buffer containing 0.015% H2O2. The last PBS wash solution was removed from the samples and replaced with 50–100 µl of tyramide substrate and incubated in the dark for 2 h at room temperature with constant mixing. Once incubation was complete, the samples were rinsed three times with PBS and then washed at room temperature with constant mixing for 1 h, changing the wash buffer every 15 min. Tissues were then mounted onto slides in glycerol and viewed under a laser-scanning confocal microscope consisting of a helium-neon laser (543 nm line) and LSM Image browser software (Zeiss, Jena, Germany).

Sample preparation for MALDI TOF/TOF tandem mass spectrometry
The CNSs from 50 insects were dissected under saline, pooled in a 500-µl volume of methanol-acetic acid-water (90:9:1, by volume), and stored overnight at –20 C. Samples were then sonicated and centrifuged at 10,000 x g for 10 min. The supernatant was collected and dried in a Speed Vac concentrator (Savant, Farmingdale, NY) and then reconstituted in 0.1% trifluoroacetic acid (TFA). This sample was then applied to a C18 Sep-Pak cartridge (Waters Associates, Mississauga, Ontario, Canada) prepared as described previously (22). The loaded sample was initially washed with 0.1% TFA and subsequently eluted with 5 ml of 60% acetonitrile (Burdick and Jackson, Muskegon, MI) with 0.1% TFA. The eluant was dried in a Speed Vac concentrator, reconstituted in a small volume of pure water and transferred directly to a stainless steel MALDI plate insert (Applied Biosystems, Foster City, CA). Once the samples were dried, a small aliquot of {alpha}-cyano-4-hydroxycinnamic acid matrix solution (Agilent Technologies, New Castle, DE) was added on the dried samples and allowed to dry again. Mass spectrometric analysis was performed on the ABI 4800 proteomics analyzer (Applied Biosystems, Framingham, MA). Due to the nature of the samples, all acquisitions were taken in manual mode. Initially the instrument was operated in reflectron mode to determine the parent masses. For the tandem MS experiments, the collision-induced dissociation acceleration was 2 kV in all cases. An internal standard [des-Arg1-bradykinin (904.47)] was used to calibrate the masses. To change the net amount of activation energy imparted to the primary ions, the collision gas (atmospheric air) pressure was increased. Two gas pressures were used by selecting the following two instrument settings: none and high. The fragmentation patterns from these different settings were used to determine the sequence of the peptide with MH+ at 1107.58, the only one to have sufficient intensity to yield fragmentation data. An unambiguous assignment of internal Leu/Ile was achieved by means of collision-induced dissociation under high gas pressure that revealed unique and distinct patterns for the side chains of Leu and Ile (28). RhoprCAPA-2 was synthesized and purified according to previous methods (29).

Malpighian tubule fluid secretion assay and intracellular cGMP RIA
Antidiuretic activity of RhoprCAPA-2 was tested at various doses on upper segments of MTs stimulated with 5-HT and cGMP RIA performed as previously described (22). Values are expressed as mean ± SEM and, where appropriate, were analyzed using Student’s t test or one-way ANOVA with Tukey multiple comparison posttest.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Preliminary sequence and cloning of full-length cDNA of RhoprCAPA
Using degenerate primers designed against conserved C-terminal residues of peptides encoded by CAPA precursor proteins in other insects, a 177-bp partial sequence encoding an incomplete CAPA prepropeptide was isolated from R. prolixus. This partial sequence was then used for design of gene-specific primers used in 5' and 3' RACE that yielded the full-length sequence of the R. prolixus CAPA gene (RhoprCAPA gene) shown in Fig. 1Go (GenBank accession no. EF989016). The gene is 789 nucleotides long with an 85-nucleotide 5' untranslated region (UTR), a single open reading frame of 473 nucleotides (bases 86–559), and a 229-nucleotide 3' UTR. A putative polyadenylyation signal (AATAA) is present between bases 747 and 752. The single open reading frame encodes a prepropeptide of 157 amino acids containing a predicted signal peptide with likely cleavage occurring between residue 23 and 24 (Ser23 and Ala24; SignalP3.0, ExPASy Server) (30). The prepropeptide sequence encodes three deduced propeptides: two CAP2b-related peptides numbered in the order they appear on the gene, RhoprCAPA-1 (SPISSVGLFPFLRA, bases 206–247) and RhoprCAPA-2 (EGGFISFPRV, bases 311–340), and a third pyrokinin-related propeptide common to other insect CAPA prepropeptides, RhoprPK-1 (NGGGGNGGGLWFGPRL, bases 362–409). Each of these three deduced propeptides are flanked at their N terminus by dibasic (Lys-Arg) residues and at their C terminus by a monobasic (Arg) residue necessary for posttranslational proteolytic processing after cleavage of the signal peptide. In addition, each of the predicted peptides are flanked at their C terminus by a glycine residue, which is well known to provide the amino group for amidation, thus suggesting the mature peptides are amidated. Based on these proposed processing steps, the mature RhoprCAPA-1, RhoprCAPA-2, and RhoprPK-1 peptides would have predicted monoisotopic masses of 1489.83, 1107.58, and 1514.74 Da (PeptideMass, ExPASy Server) (31), respectively.


Figure 1
View larger version (53K):
[in this window]
[in a new window]

 
FIG. 1. Nucleotide cDNA sequence and deduced amino acid prepropeptide of the R. prolixus CAPA gene. Sequences are numbered on the right starting with the first nucleotide in the 5' UTR and initial methionine start codon (capitalized), respectively. The three encoded peptides are shown in bold, with N-terminal dibasic and C-terminal monobasic posttranslational cleavage sites shaded, and glycine residues required for amidation boxed. The highly predicted signal peptide required for processing in the secretory pathway is double underlined with predicted cleavage occurring between serine23 and alanine24. The predicted polyadenylation signal sequence is bold underlined in the 3' UTR.

 
Detection of predicted peptides from the R. prolixus CAPA gene
To confirm the presence of peptides predicted from the RhoprCAPA gene, extracts from CNS were directly analyzed using MALDI-TOF mass spectrometry. These preparations revealed the presence of three substances with mass of 1107.58, 1489.83, and 1514.74 Da, corresponding to the masses of RhoprCAPA-2, RhoprCAPA-1, and RhoprPK-1 predicted from the molecular data (see Fig. 2Go, A and B). One of the peaks (1107.58) was of sufficient intensity to allow for further fragmentation experiments (see Fig. 2AGo) and produced clear fragments under conditions of low energy fragmentation. Deduced sequence fragmentation data for RhoprCAPA-2 is shown in Fig. 2CGo along with a comparison of the fragmentation pattern of a synthetic replicate of RhorCAPA-2. The sequence, as predicted by the translation and subsequent processing of the RhoprCAPA-2 prepropeptide, was manually reconstructed from its fragment series, EGGFISFPRV-NH2 (1107.58 Da). The internal Ile could be unambiguously determined over the isosteric residue Leu (28).


Figure 2
View larger version (25K):
[in this window]
[in a new window]

 
FIG. 2. Detection of the peptides predicted from the CAPA gene in R. prolixus. MALDI-TOF mass spectrum of a central nervous system extract from R. prolixus fifth-instars. Focus is on the peptide with greatest intensity at MH+ 1107.58, RhoprCAPA-2 (A) and the other two predicted peptides at MH+ 1489.83 and 1514.74 (B), corresponding to RhoprCAPA-1 and RhoprPK-1, respectively. C, The peptide with MH+ at 1107.58 was selected for further fragmentation experiments. Prominent y- and b-type fragments of ion signal 1107.58 are labeled, analyzed manually, and the deduced sequence, an exact match to RhoprCAPA-2, is shown above the labeled fragments. A comparison with the fragmentation pattern of the synthetic replicate of RhoprCAPA-2 is depicted in the bottom half of C.

 
Genomic Southern blot analysis
Analysis of restriction fragments generated with restriction endonucleases lacking recognition sites over the RhoprCAPA cDNA used as a probe showed the presence of two or more positive bands in genomic Southern blot analysis (Fig. 3Go). This suggests there might be at least two copies or paralogs of the RhoprCAPA gene per haploid genome of R. prolixus.


Figure 3
View larger version (62K):
[in this window]
[in a new window]

 
FIG. 3. Genomic Southern blot using a RhoprCAPA cDNA fragment (12–687) as probe. Each lane contains 2 µg of R. prolixus genomic DNA digested with restriction enzymes lacking recognition sites over the length of the cDNA sequence used as a probe. DNA fragments were electrophoresed, transferred onto a nylon membrane overnight, and hybridized with alkaline phosphatase-labeled RhoprCAPA cDNA. Lanes 1–3: EcoRI, HindIII, and PstI, respectively.

 
Developmental and spatial expression profile of the RhoprCAPA gene in R. prolixus
Insects from each postembyronic developmental stage (first-instar to adult) were analyzed for expression of the CAPA gene by RT-PCR. The CAPA gene is expressed in all postembryonic developmental stages of R. prolixus (Fig. 4AGo), indicating a role in all juvenile and mature forms. To better understand the spatial localization of CAPA gene expression, mRNA was isolated from male fifth-instar tissues including CNS, MTs, anterior midgut, posterior midgut, hindgut, dorsal vessel, testes, and salivary glands. Expression was observed in CNS and, surprisingly, also in the testes; however, expression was absent in the other tissues examined (Fig. 4BGo). Samples that lacked the reverse transcription step were negative, as were samples deficient in template mRNA.


Figure 4
View larger version (64K):
[in this window]
[in a new window]

 
FIG. 4. RhoprCAPA developmental and spatial expression profile. A, Expression of the RhoprCAPA gene assessed in each developmental stage from first- to fifth-instars and adults. Primers were designed to generate a 413-bp fragment, which covered the majority of the coding region and 3' UTR. B, RhoprCAPA gene expression in different R. prolixus fifth-instar tissues: CNS, anterior midgut (AMG), posterior midgut (PMG), hindgut (HG), MT, dorsal vessel (DV), testes (TST), and salivary glands (SG). Primers were chosen to amplify a 341-bp fragment, which included the 5' UTR and a sizable region of the coding region of the precursor. For both the developmental and spatial expression profile, Rhopr β-actin primers were designed to amplify a 317-bp fragment to serve as a control for quality and integrity of RNA template.

 
Localization of RhoprCAPA gene expression using FISH
Full-length antisense DIG-labeled RNA probes were used to determine the spatial cell-specific expression pattern of the RhoprCAPA gene in fifth-instar R. prolixus. RhoprCAPA gene expression was observed in 26 cells of the CNS of starved fifth-instars (fed as fourth-instars 6–8 wk previously). In the brain, RhoprCAPA gene expression was detected in one bilateral pair of lateral cells located dorsally in the border region of the optic lobe and brain (Fig. 5AGo). RhoprCAPA gene-expressing cells were also observed in the subesophageal ganglion (SOG; Fig. 5BGo). Here two pairs of cells are both located along the ventral midline of the SOG. These pairs of cells differ substantially in size, with the more posterior pair of cells being much larger (75 µm) than the anterior pair (35 µm). Additional cells were observed lying immediately posterior of the esophageal foramen; however, these cells stained less intensely (Fig. 5BGo). Within the prothoracic ganglion, RhoprCAPA gene expression was detected in two bilateral pairs of cells located centrally on the ventral surface (Fig. 5CGo). The mesothoracic ganglionic mass (MTGM) also contained cells positive for expression of the RhoprCAPA gene. Specifically, three bilateral pairs of cells were observed on the ventral surface of the MTGM in the abdominal neuromeres, with the most posterior pair of cells being larger in size (~25 µm) relative to the two anterior pairs of cells (15 µm) (Fig. 5DGo). More anteriorly within the meso- and metathoracic neuromere, another two pairs of cells demonstrated RhoprCAPA expression; however, these cells were less intensely stained than the three pairs of cells mentioned earlier within the abdominal neuromeres (Fig. 5Go, D and E). To verify the specificity of the detection, control experiments were carried out in parallel in which tissues were hybridized with sense-labeled probe, which did not identify any cells (results not shown), thus demonstrating that the cells identified using antisense probe are indeed expressing RhoprCAPA mRNA. In view of the fact that our RT-PCR findings also demonstrated expression of RhoprCAPA within testes of fifth-instar males, FISH techniques were again used to determine the localization of expression associated with this tissue. Unlike the CNS, in which distinct cells were identified expressing the transcript, no specific cell bodies were detected expressing the RhoprCAPA transcript in testes.


Figure 5
View larger version (72K):
[in this window]
[in a new window]

 
FIG. 5. RhoprCAPA transcript expression in dorsal brain (A), ventral SOG (B), ventral prothoracic ganglion (C), and ventral MTGM (D) of R. prolixus fifth-instars. A, A single bilateral pair of cells are situated in the border region between the optic lobe and brain proper. Over the ventral surface of the SOG (B), two pairs of cells with prominent expression are observed located medially and an additional three pairs of cells, which stained more weakly, are observed just posterior of the esophageal foramen. C, Two small pairs of cells are observed lying medially in the ventral surface of the prothoracic ganglion. D, The posterior segment of the ventral MTGM contains three bilaterally paired RhoprCAPA-expressing cells within the abdominal neuromeres. In the more anterior segment of the ventral MTGM (the meso- and metathoracic neuromeres), two additional pairs of weakly stained cells are positive for RhoprCAPA expression. E, Cells in the anterior region of the MTGM within the mesothoracic neuromere that stained weakly for RhoprCAPA gene expression are shown at a higher magnification. In A–D, arrows and arrowheads denote strong and weak RhoprCAPA-expressing cells, respectively; in all figures. Scale bars, 100 µm.

 
Malpighian tubule fluid secretion assay and intracellular cGMP RIA
To confirm biological activity of the predicted antidiuretic peptide from the RhoprCAPA gene, RhoprCAPA-2, it was tested on 5-HT-stimulated MTs because unstimulated tubules in this species secrete at very low levels (~0.1 nl/min; see Ref. 8). RhoprCAPA-2 (1 µM) significantly inhibited 5-HT-stimulated secretion by MTs (Fig. 6AGo). RhoprCAPA-2 demonstrated a dose-dependent inhibition of 50 nM 5-HT-stimulated Malpighian tubule secretion rate, with a threshold below the nanomolar range, maximal inhibition at a dose of 1 µM, an IC50 of 4.16 nM, and 95% confidence interval of 0.88–19.77 nM (Fig. 6BGo). Thus, as predicted from the structural data, RhoprCAPA-2 indeed demonstrates potent antidiuretic activity on MTs stimulated with 5-HT. We then sought to confirm that RhoprCAPA-2 elevated levels of intracellular cGMP in tubules stimulated by 5-HT. In agreement with previous reports using M. sexta CAP2b or semipurified CNS extracts (22), 1 µM RhoprCAPA-2 elevates levels of intracellular cGMP in Malpighian tubules stimulated with 50 nM 5-HT (Fig. 6CGo).


Figure 6
View larger version (16K):
[in this window]
[in a new window]

 
FIG. 6. A, Inhibition of 5-HT (50 nM) stimulated secretion from MTs by the antidiuretic peptide, RhoprCAPA-2 (1 µM; EGGFISFPRV-NH2). B, Dose-dependent inhibition of 5-HT (50 nM) stimulated secretion from MTs by the antidiuretic peptide, RhoprCAPA-2. Data fitted by nonlinear regression using GraphPad Prism (version 3.02; San Diego, CA). The IC50 is 4.16 nM with 95% confidence interval = 0.88–19.77 nM. Secretion by unstimulated tubules in saline alone is very small (~0.1 nl/min; see Ref. 8 ) and is not shown here. C, RhoprCAPA-2 elevates levels of the intracellular messenger, cGMP, in tubules stimulated with 50 nM 5-HT. Tubules receiving 50 nM 5-HT alone show a significant decrease in cGMP levels. Values are mean ± SE for n = 8 (A), n = 8–20 (B), and n = 8–10 (C). In A, significant inhibition denoted by asterisk, where P < 0.0001, and in C, statistically different levels of cGMP from tubules treated with saline alone are denoted by asterisk, where P < 0.05.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This is the first study to isolate and characterize a gene encoding neuropeptides in the species-rich order, Hemiptera. The RhoprCAPA gene encodes three novel peptides from a single prepropeptide, which, through posttranslational modification and processing, generates the mature biologically active forms: RhoprCAPA-1 (SPISSVGLFPFLRA-NH2), RhoprCAPA-2 (EGGFISFPRV-NH2), and a third pyrokinin-related peptide, RhoprPK-1 (NGGGGNGGGLWFGPRL-NH2). The first gene encoding the peptide CAP2b in insects was identified in the fruit fly, D. melanogaster and called capability (CAPA) owing to its clear ability to encode neuropeptides belonging to the CAP2b family (23). Subsequently in the hawk moth M. sexta, in which the original Leptidopteran CAP2b peptide was first sequenced (32), the gene encoding two CAP2b-related peptides, Mas-CAPA-1 and -2, as well as a pyrokinin (PK)-related peptide, Mas-PK-1, was isolated and sequenced (24). Interestingly, the first two peptides encoded in analogous transcripts identified in other species all share the PRV-NH2 C-terminal motif, whereas in R. prolixus, only the second encoded peptide, RhoprCAPA-2, shares this motif; RhoprCAPA-1 contains a LRA-NH2 C-terminal sequence. This is quite surprising, considering the amino acid sequence characteristics of the CAP2b-related peptides recently identified in neurohemal organs of the more closely related southern green stink bug, Nezara viridula (33). In this hemipteran, the two CAP2b-related peptides each contain the PRV-NH2 C terminus common to CAP2b-related peptides found in other insects. The implications of this varied C terminus on the first encoded peptide, RhoprCAPA-1, are at this time, unknown but will be pursued in future investigations during which the physiological role of this unique peptide is studied. One could postulate, however, that this peptide lacks any involvement in the cessation of diuresis because it is known from previous studies (21, 22) that CAP2b-related peptides ending with a PRV-NH2 C terminus are antidiuretic in R. prolixus.

In support of this prediction, structure-activity analysis in a Dipteran species, Musca domestica, during which alanine-replacement CAP2b analogs were tested, showed that replacement of the arginine or valine at the C terminus resulted in greatly reduced efficacy of diuretic activity on MTs (29). Moreover, the significant finding here, demonstrating expression associated with a peripheral source, the testes, suggests that one or more of the RhoprCAPA peptides are involved in reproduction. It is worth emphasizing, though, that no cell bodies expressing RhoprCAPA were detected in the testes. Testes samples assessed by nonquantitative RT-PCR, however, required many more amplification cycles than did the CNS samples (data not shown), indicating that RhoproCAPA expression in the testes is much lower than that found in the CNS, so in situ hybridization may not be sufficiently sensitive to reveal low expression levels in these immature reproductive tissues at this developmental stage. Thus, future experiments investigating expression in other developmental stages such as adults, in which reproductive tissues are fully developed, may reveal more clearly the source of this expression. Alternatively, it is possible that RhoprCAPA expression detected in RT-PCR experiments may originate in the axonal domain of abdominal nerves originating from the MTGM, in which extensive CAP2b-like immunoreactivity has been recently identified (22). This would not be unusual because it is now well established that many RNA species, including those encoding neuropeptides, are localized to the axonal domain in addition to the cell bodies in both vertebrates and invertebrates (34, 35, 36, 37, 38, 39, 40). Nonetheless, the identification of cell bodies expressing the RhoprCAPA gene within the CNS are consistent with previously identified cells bodies expressing CAP2b-related peptides in R. prolixus (22) and other insects (for review see Ref. 41). For R. prolixus, all of the cells expressing the RhoprCAPA gene revealed immunohistochemical staining for CAP2b-related peptides except the cells localized within the PRO. These were not identified in previous studies and may contain peptides that are not immunologically detected using the antibody or may not undergo the appropriate processing steps to produce the mature peptides.

The occurrence of a varied C terminus on RhoprCAPA-1 suggests that RhoprCAPA-1 and RhoprCAPA-2 could facilitate their effects via unique receptors. Two independent studies have shown in D. melanogaster that DroCAPA-1 and DroCAPA-2, which share the PRV-NH2 C terminus, activate the same G protein-coupled receptor (GPCR) coded by the gene CG14575 (AF522193/AF505865) and with similar affinities (42, 43). However, the third CAPA peptide, DroPK-1, has its own unique GPCR coded by the D. melanogaster gene CG9918 (AF368273), which does not bind the CAP2b-related peptides (44). With the completion of sequencing and annotation of the R. prolixus genome in the near future, the database will serve as a tremendous tool to identify candidate GPCRs for many of the peptides and additional factors that are involved in diuresis and other feeding-related behaviors. Similar to studies carried out with Dipteran counterparts, expression and affinity analyses to determine natural ligands will be necessary, as will tissue and cell-specific expression studies, to determine target tissues of these peptides.

In Dipterans, CAP2b-related peptides stimulate secretion through a pathway involving a nitric oxide-dependent soluble guanylate cyclase (45, 46). Interestingly, both CAP2b and ADF peptides inhibit secretion and elevate levels of cGMP but in a nitric oxide-independent manner (14, 21, 22). Here we show that RhoprCAPA-2 has potent antidiuretic activity inhibiting secretion and elevating levels of intracellular cGMP in MTs stimulated with the diuretic hormone, 5-HT. It remains to be seen whether this in vitro activity can be confirmed in vivo. Our future studies will focus on elucidating the target sites and physiological significance and deducing the signal transduction pathways involved. For example, it is known that levels of cGMP increase in MTs stimulated with CAP2b-related peptides (21, 22); however, the source of this increase, a membrane-bound or atypical guanylate cyclase, is not known. In other insects, CAP2b-related peptides influence the activity of other tissues, such as the dorsal vessel (heart) in Lepidoptera and Diptera (32), and in addition, other myostimulatory effects have been demonstrated in several visceral muscle preparations in Blattaria (47). Studies conducted on Blattarian species have identified a number of CAPA orthologs termed the periviscerokinins (PVKs), which have been shown to exert myotropic effects on a number of different visceral tissues in insects (41). The designation as a PVK reflects the high abundance of these orthologs observed within the abdominal perivisceral/neurohemal organ systems of some insects (41); however, in R. prolixus (22) and similarly in other species (23, 24), these peptides are also associated with other neurohemal regions; thus, we avoid the PVK nomenclature.

The availability of the synthetic RhoprCAPA peptides should help in the determination of the physiological relevance of these neuropeptides. A comparison across Insecta reveals that these peptides have evolved unique and remarkably opposite functions: stimulation vs. inhibition of secretion by MTs. Here our results also suggest a novel function for these peptides, a role in sexual maturation or reproduction, because expression of the RhoprCAPA gene was localized to the testes. In addition, the identification of the native peptide, RhoprCAPA-2, which inhibits the rapid diuresis in this disease vector, may guide future studies focused on development of mimetic analogs (see Refs. 48, 49, 50, 51) for use in novel pest management strategies for interrupting the transmission of Chagas’ disease, which takes place as a result of the rapid diuresis after blood gorging.


    Footnotes
 
This work was supported by a Natural Sciences and Engineering Research Council of Canada discovery grant (to I.O.) and in part by Grant 0500-32000-001-01R from the Department of Agriculture/Department of Defense Deployed War Fighter Protection (DWFP) Initiative (R.J.N.) and Collaborative Research Grant LST.CLG.979226 from the North Atlantic Treaty Organization to (R.J.N.). Sequence data have been submitted to the DDBJ/EMBL/GenBank databases as R. prolixus CAPA gene GenBank accession no. EF989016.

Disclosure Statement: The authors have nothing to disclose.

First Published Online May 29, 2008

Abbreviations: ADF, Antidiuretic factor; CAPA, capability gene; CAP2b, cardioaccelatory peptide 2b; CNS, central nervous system; DH, diuretic hormone; DIG, digoxigenin; FISH, fluorescent in situ hybridization; GPCR, G protein-coupled receptor; gsp, gene-specific primers; 5-HT, 5-hydroxytryptamine; MALDI-TOF, matrix-assisted laser desorption ionization-time of flight; MT, Malpighian tubule; MTGM, mesothoracic ganglionic mass; PBT, PBS and Tween 20; PBTB, PBT with blocking reagent; PK, pyrokinin; PVK, periviscerokinin; RACE, rapid amplification of cDNA ends; RhoproCAPA gene, Rhodnius prolixus CAPA gene; SOG, subesophageal ganglion; TFA, trifluoroacetic acid; UTR, untranslated region.

Received March 13, 2008.

Accepted for publication May 19, 2008.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rabinovich JE, Himschoot P 1990 A population-dynamics simulation-model of the main vectors of Chagas-disease transmission, Rhodnius prolixus and Triatoma infestans. Ecol Model 52:249–266[CrossRef]
  2. Ramsey JM, Ordonez R, Cruz-Celis A, Alvear AL, Chavez V, Lopez R, Pintor JR, Gama F, Carrillo S 2000 Distribution of domestic triatominae and stratification of Chagas disease transmission in Oaxaca, Mexico. Med Vet Entomol 14:19–30[CrossRef][Medline]
  3. Monroy C, Rodas A, Mejia M, Rosales R, Tabaru Y 2003 Epidemiology of Chagas disease in Guatemala: infection rate of Triatoma dimidiata, Triatoma nitida, and Rhodnius prolixus (Hemiptera, Reduviidae) with Trypanosoma cruzi and Trypanosoma rangeli (Kinetoplastida, Trypanosomatidae). Mem Inst Oswaldo Cruz 98:305–310[Medline]
  4. Feliciangeli MD, Carrasco H, Patterson JS, Suarez B, Martinez C, Medina M 2004 Mixed domestic infestation by Rhodnius prolixus Stal, 1859 and Panstrongylus geniculatus Latreille, 1811, vector incrimination, and seroprevalence for Trypanosoma cruzi among inhabitants in El Guamito, Lara State, Venezuela. Am J Trop Med Hyg 71:501–505
  5. Maddrell SH 1963 Excretion in blood-sucking bug, Rhodnius prolixus Stal. 1. Control of diuresis. J Exp Biol 40:247–256[Abstract]
  6. Maddrell SH 1964 Excretion in blood-sucking bug Rhodnius prolixus Stal. 3. Control of release of diuretic hormone. J Exp Biol 41:459–472[Abstract/Free Full Text]
  7. Maddrell SHP, Herman WS, Mooney RL, Overton JA 1991 5-Hydroxytryptamine: a second diuretic hormone in Rhodnius prolixus. J Exp Biol 156:557–566[Abstract/Free Full Text]
  8. Te Brugge VA, Schooley DA, Orchard I 2002 The biological activity of diuretic factors in Rhodnius prolixus. Peptides 23:671–681[CrossRef][Medline]
  9. Te Brugge VA, Lombardi VC, Schooley DA, Orchard I 2005 Presence and activity of a Dippu-DH31-like peptide in the blood-feeding bug, Rhodnius prolixus. Peptides 26:29–42[CrossRef][Medline]
  10. Te Brugge, VA, Miksys, SM, Coast, GM, Schooley, DA, Orchard I 1999 The distribution of a CRF-like diuretic peptide in the blood-feeding bug Rhodnius prolixus. J Exp Biol 202:2017–2027[Abstract]
  11. Orchard I 2006 Serotonin: a coordinator of feeding-related physiological events in the blood-gorging bug, Rhodnius prolixus. Comp Biochem Phys A 144:316–324
  12. Coast GM, Orchard I, Phillips JE, Schooley DA 2002 Insect diuretic and antidiuretic hormones. In: Evans PD, ed. Advances in insect physiology. London: Academic Press; 279–409
  13. Coast G 2007 The endocrine control of salt balance in insects. Gen Comp Endocrinol 152:332–338[CrossRef][Medline]
  14. Eigenheer RA, Nicolson SW, Schegg KM, Hull JJ, Schooley DA 2002 Identification of a potent antidiuretic factor acting on beetle Malpighian tubules. Proc Natl Acad Sci USA 99:84–89[Abstract/Free Full Text]
  15. Eigenheer RA, Wiehart UM, Nicolson SW, Schoofs L, Schegg KM, Hull JJ, Schooley DA 2003 Isolation, identification and localization of a second beetle antidiuretic peptide. Peptides 24:27–34[CrossRef][Medline]
  16. Wiehart UIM, Nicolson SW, Eigenheer RA, Schooley DA 2002 Antagonistic control of fluid secretion by the Malpighian tubules of Tenebrio molitor: effects of diuretic and antidiuretic peptides and their second messengers. J Exp Biol 205:493–501[Abstract/Free Full Text]
  17. Spring JH, Morgan A, Hazelton SR 1988 A novel target for antidiuretic hormone in insects. Science 241:1096–1098[Abstract/Free Full Text]
  18. Petzel D, Conlon JM 1991 Evidence for an antidiuretic factor affecting fluid secretion in mosquito Malpighian tubules. FASEB J 5:A1059–A1059
  19. de Decker N, Hayes TK, Vankerkhove E, Steels P 1994 Stimulatory and inhibitory effects of endogenous factors in head extracts of Formica-Polyctena (Hymenoptera) on the fluid secretion of Malpighian tubules. J Insect Physiol 40:1025–1036[CrossRef]
  20. Lavigne C, Embleton J, Audy P, King RR, Pelletier Y 2001 Partial purification of a novel insect antidiuretic factor from the Colorado potato beetle, Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae), which acts on Malpighian tubules. Insect Biochem Mol 31:339–347[CrossRef]
  21. Quinlan M, Tublitz N, O'Donnell M 1997 Anti-diuresis in the blood-feeding insect Rhodnius prolixus Stal: the peptide CAP2b and cyclic GMP inhibit Malpighian tubule fluid secretion. J Exp Biol 200:2363–2367[Abstract]
  22. Paluzzi JP, Orchard I 2006 Distribution, activity and evidence for the release of an anti-diuretic peptide in the kissing bug Rhodnius prolixus. J Exp Biol 209:907–915[Abstract/Free Full Text]
  23. Kean L, Cazenave W, Costes L, Broderick KE, Graham S, Pollock VP, Davies SA, Veenstra JA, Dow JAT 2002 Two nitridergic peptides are encoded by the gene capability in Drosophila melanogaster. Am J Physiol Regul Integr Comp Physiol 282:R1297–R1307
  24. Loi PK, Tublitz NJ 2004 Sequence and expression of the CAPA/CAP2b gene in the tobacco hawkmoth, Manduca sexta. J Exp Biol 207:3681–3691[Abstract/Free Full Text]
  25. Saunders C, Cohen RS 1999 Double FISH and FISH-fluorescence immunolocalization procedures for whole-mount Drosophila ovaries. Biotechniques 26:186–188[Medline]
  26. Hughes SC, Krause HM 1998 Double labeling with fluorescence in situ hybridization in Drosophila whole-mount embryos. Biotechniques 24:530–532[Medline]
  27. Lecuyer E, Parthasarathy N, Krause HM 2008 Fluorescent in situ hybridization protocols in Drosophila embryos and tissues. In: Dahmann C, ed. Drosophila: methods and protocols. Chap 18. Totowa, NJ: Humana Press; 289–302
  28. Nachman RJ, Russell WK, Coast GM, Russell DH, Predel R 2005 Mass spectrometric assignment of Leu/Ile in neuropeptides from single neurohemal organ preparations of insects. Peptides 26:2151–2156[CrossRef][Medline]
  29. Nachman R, Coast G 2007 Structure-activity relationships for in vitro diuretic activity of CAP2b in the housefly. Peptides 28:57–61[CrossRef][Medline]
  30. Bendtsen JD, Nielsen H, von Heijne G, Brunak S 2004 Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340:783–795[CrossRef][Medline]
  31. Wilkins MR, Lindskog I, Gasteiger E, Bairoch A, Sanchez JC, Hochstrasser DF, Appel RD 1997 Detailed peptide characterization using PEPTIDEMASS—a World-Wide-Web-accessible tool. Electrophoresis 18:403–408[CrossRef][Medline]
  32. Huesmann GR, Cheung CC, Loi PK, Lee TD, Swiderek KM, Tublitz NJ 1995 Amino acid sequence of CAP2b, an insect cardioacceleratory peptide from the tobacco hawkmoth Manduca sexta. FEBS Lett 371:311–314[CrossRef][Medline]
  33. Predel R, Russell WK, Neupert S, Russell DH, Esquivel JF, Nachman RJ 2006 Identification of the first neuropeptides from the CNS of Hemiptera: CAPA peptides of the southern green stinkbug Nezara viridula (L.). Peptides 27:2670–2677[CrossRef][Medline]
  34. Van Minnen J, Vanderhaar C, Raap AK, Vreugdenhil E 1988 Localization of ovulation hormone-like neuropeptide in the central nervous-system of the snail Lymnaea stagnalis by means of immunocytochemistry and in situ hybridization. Cell Tissue Res 251:477–484[CrossRef][Medline]
  35. Van Minnen J, Smit AB, Joosse J 1989 Central and peripheral expression of genes-coding for egg-laying inducing and insulin-related peptides in a snail. Arch Histol Cytol 52:241–252[Medline]
  36. Van Minnen J 1994 RNA in the axonal domain—a new dimension in neuronal functioning. Histochem J 26:377[CrossRef][Medline]
  37. Mohr E, Richter D 2000 Axonal mRNAs: functional significance in vertebrates and invertebrates. J Neurocytol 29:783–791[CrossRef][Medline]
  38. Barth S, Grossmann R 2000 Localization of arginine vasotocin (AVT) mRNA in extrasomal compartments of magnocellular neurons in the chicken hypothalamo-neurohypophysial system. Comp Biochem Physiol B 125:189–195[CrossRef][Medline]
  39. Garside CS, Koladich PM, Bendena WG, Tobe SS 2002 Expression of allatostatin in the oviducts of the cockroach Diploptera punctata. Insect Biochem Mol 32:1089–1099[CrossRef]
  40. Lee S, Hollenbeck P 2003 Organization and translation of mRNA in sympathetic axons. J Cell Sci 116:4467–4478[Abstract/Free Full Text]
  41. Predel R, Wegener C 2006 Biology of the CAPA peptides in insects. Cell Mol Life Sci 63:2477[CrossRef][Medline]
  42. Iversen A, Cazzamali G, Williamson M, Hauser F, Grimmelikhuijzen CJP 2002 Molecular cloning and functional expression of a Drosophila receptor for the neuropeptides capa-1 and -2. Biochem Biophys Res Commun 299:628[CrossRef][Medline]
  43. Park Y, Kim Y, Adams ME 2002 Identification of G protein-coupled receptors for Drosophila PRXamide peptides, CCAP, corazonin, and AKH supports a theory of ligand-receptor coevolution. Proc Natl Acad Sci USA 99:11423–11428[Abstract/Free Full Text]
  44. Cazzamali G, Torp M, Hauser F, Williamson M, Grimmelikhuijzen CJP 2005 The Drosophila gene CG9918 codes for a pyrokinin-1 receptor. Biochem Biophys Res Commun 335:14–19[CrossRef][Medline]
  45. Davies SA, Stewart EJ, Huesmann GR, Skaer NJV, Maddrell SHP, Tublitz NJ, Dow JAT 1997 Neuropeptide stimulation of the nitric oxide signaling pathway in Drosophila melanogaster Malpighian tubules. Am J Physiol 273(2 Pt 2):R823–R827
  46. Broderick K, MacPherson M, Regulski M, Tully T, Dow JT, Davies S 2003 Interactions between epithelial nitric oxide signaling and phosphodiesterase activity in Drosophila. Am J Physiol Cell Physiol 285:C1207–C1218
  47. Predel R, Nachman RJ, Gade G 2001 Myostimulatory neuropeptides in cockroaches: Structures, distribution, pharmacological activities, and mimetic analogs. J Insect Physiol 47:311–324[CrossRef][Medline]
  48. Nachman RJ, Holman GM, Haddon WF 1993 Leads for insect neuropeptide mimetic development. Arch Insect Biochem Physiol 22:181–197[CrossRef][Medline]
  49. Nachman RJ, Roberts VA, Holman GM, Beier RC 1995 Pseudodipeptide analogs of the pyrokinin/PBAN (FXPRLa) insect neuropeptide family containing carbocyclic pro-mimetic conformational components. Regul Pept 57:359–370[CrossRef][Medline]
  50. Nachman RJ, Zabrocki J, Olczak J, Williams HJ, Moyna G, Ian Scott A, Coast GM 2002 cis-peptide bond mimetic tetrazole analogs of the insect kinins identify the active conformation. Peptides 234:709–716
  51. Taneja-Bageshwar S, Strey A, Kaczmarek K, Zabrocki J, Pietrantonio PV, Nachman RJ 2008 Comparison of insect kinin analogs with cis-peptide bond, type VI-turn motifs identifies optimal stereochemistry for interaction with a recombinant arthropod kinin receptor from the southern cattle tick Boophilus microplus. Peptides 29:295–301[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Exp. Biol.Home page
G. M. Coast
Neuroendocrine control of ionic homeostasis in blood-sucking insects
J. Exp. Biol., February 1, 2009; 212(3): 378 - 386.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paluzzi, J.-P.
Right arrow Articles by Orchard, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paluzzi, J.-P.
Right arrow Articles by Orchard, I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals