help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2008-0449
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mérot, Y.
Right arrow Articles by Flouriot, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mérot, Y.
Right arrow Articles by Flouriot, G.
Endocrinology Vol. 150, No. 1 200-211
Copyright © 2009 by The Endocrine Society

Different Outcomes of Unliganded and Liganded Estrogen Receptor-{alpha} on Neurite Outgrowth in PC12 Cells

Yohann Mérot, François Ferrière, Luc Gailhouste, Guillaume Huet, Frédéric Percevault, Christian Saligaut and Gilles Flouriot

Université de Rennes 1, Centre National de la Recherche Scientifique, Unité Mixte 6026, Equipe "Récepteur des œstrogènes et destinée cellulaire," 35042 Rennes, France

Address all correspondence and requests for reprints to: Gilles Flouriot, Equipe "Récepteur des œstrogènes et destinée cellulaire," Unité Mixte de Recherche Centre National de la Recherche Scientifique (UMR CNRS) 6026, Université de Rennes I, 35042 Rennes cedex, France. E-mail: gilles.flouriot{at}univ-rennes1.fr.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A precise description of the mechanisms by which estrogen receptor-{alpha} (ER{alpha}) exerts its influences on cellular growth and differentiation is still pending. Here, we report that the differentiation of PC12 cells is profoundly affected by ER{alpha}. Importantly, depending upon its binding to 17β-estradiol (17βE2), ER{alpha} is found to exert different effects on pathways involved in nerve growth factor (NGF) signaling. Indeed, upon its stable expression in PC12 cells, unliganded ER{alpha} is able to partially inhibit the neurite outgrowth induced by NGF. This process involves a repression of MAPK and phosphatidylinositol 3-kinase/Akt signaling pathways, which leads to a negative regulation of markers of neuronal differentiation such as VGF and NFLc. This repressive action of unliganded ER{alpha} is mediated by its D domain and does not involve its transactivation and DNA-binding domains, thereby suggesting that direct transcriptional activity of ER{alpha} is not required. In contrast with this repressive action occurring in the absence of 17βE2, the expression of ER{alpha} in PC12 cells allows 17βE2 to potentiate the NGF-induced neurite outgrowth. Importantly, 17βE2 has no impact on NGF-induced activity of MAPK and Akt signaling pathways. The mechanisms engaged by liganded ER{alpha} are thus unlikely to rely on an antagonism of the inhibition mediated by the unliganded ER{alpha}. Furthermore, 17βE2 enhances NGF-induced response of VGF and NFLc neuronal markers in PC12 clones expressing ER{alpha}. This stimulatory effect of 17βE2 requires the transactivation functions of ER{alpha} and its D domain, suggesting that an estrogen-responsive element-independent transcriptional mechanism is potentially relevant for the neuritogenic properties of 17βE2 in ER{alpha}-expressing PC12 cells.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
A wide range of physiological processes is controlled by the steroid hormone, 17β-estradiol (17βE2), both in females and in males (1). Notably, 17βE2 exerts crucial influences in growth, differentiation, and homeostasis of reproductive tracts, bone, liver, and cardiovascular and neuronal systems. The contribution of this hormone in regulating neuronal physiology mainly involves effects on neurogenesis, apoptosis, dendritic and axonal growth, and synaptogenesis (2, 3, 4, 5).

Many of the biological effects exerted by 17βE2 are mediated through binding and activation of intracellular receptors, the estrogen receptors {alpha} (ER{alpha}, NR3A1) and β (ERβ, NR3A2) (6). Among these two receptors, ER{alpha} is thought to mediate many of the trophic and protective effects of 17βE2 (7, 8). ERs belong to the nuclear receptor subfamily of ligand-inducible transcription factors whose members, based on structural and functional similarities, can be subdivided into six distinct regions termed A to F (9). The C and E domains are responsible for DNA and ligand binding, respectively [DNA- and ligand-binding domain (DBD and LBD)]. Ligand-induced transcription involves the action of distinct transactivation functions (AFs), located in the N-terminal A/B (AF-1) and the C-terminal E/F (AF-2) domains (10). Upon ligand binding, ERs undergo a conformational change that facilitates their recruitment onto the promoter regions of target genes (11). This can occur either directly through interaction with cognate DNA sequences [estrogen-responsive elements (EREs)] or through protein-protein interaction with other transcriptional factors.

In addition to its transcriptional task, ER{alpha} may also mediate the rapid and nongenomic actions of 17βE2 that involve plasma membrane-associated signaling (12). Although some of these actions are ER independent, others appear to be mediated by the anchorage of ER{alpha} on the plasma membrane, through posttranslational modifications and/or interactions with membrane proteins (12). These biological effects include changes in adenylyl cyclase, MAPKs, phosphatidylinositol 3-kinase (PI3K) activities, and the concentration of intracellular calcium (12). Although these rapid actions of 17βE2 are mainly characterized by processes affecting components of signal transduction pathways, the subsequent cellular response may ultimately be a regulation of gene expression (13, 14). ER{alpha}-mediated estrogen signaling in neuronal growth and cell differentiation may therefore involve both direct transcriptional actions and cross talks with second messenger signaling pathways.

To further define the mechanistic bases of these processes, we generated a series of stable PC12 rat pheochromocytoma cell lines expressing full-length or deleted forms of ER{alpha}. PC12 cells have been widely used to study the molecular mechanisms underlying cell differentiation (15, 16). Neurotrophic factors such as nerve growth factor (NGF) induce PC12 differentiation into cells exhibiting a neuron-like phenotype (15, 17). The present study demonstrates that in the absence of 17βE2, the expression of ER{alpha} partially inhibits the neurite outgrowth induced by NGF through the perturbation of MAPK and PI3K/Akt signaling pathways. This effect does not require transactivation and DBDs of ER{alpha}. On the other hand, once liganded, ER{alpha} enhances the differentiation of PC12 cells induced by NGF. Whereas 17βE2 has no impact on NGF-induced MAPK and Akt activities in these cells, it increases NGF-induced gene expression. This suggests that a transcriptional activity of ER{alpha} is required for 17βE2 to exert this action on PC12 cell differentiation. This hypothesis is further substantiated by the fact that the impact of liganded ER{alpha} on neurite outgrowth requires ER{alpha} domains involved in its actions on transcription. Unliganded and liganded ER{alpha} have therefore different outcomes on neurite outgrowth in PC12 cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
17βE2, 17{alpha}E2, diethylstilbestrol (DES), and recombinant NGF were purchased from Sigma Aldrich (St. Louis, MO). ICI 182,780 was purchased from Tocris Bioscience (Bristol, UK). Antibodies raised against ER{alpha} C-terminal (HC-20), phosphorylated (p)ERK1 (B-4), ERK1 (K-23), cAMP response element-binding protein (CREB) (240), pAkt (Ser 473-R), Akt1/2 (H-186), and c-fos (4) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The anti-pCREB antibody was from Millipore (Molsheim, France).

Plasmids
ER{alpha}, ER{alpha} {Delta}A (amino acids 39-595), ER{alpha} CF (amino acids 174-595), and ER{alpha} {Delta}AF-2 (amino acids 1-532) cDNAs have been already described (18, 19). ER{alpha} {Delta}A/Box1 (amino acids 80-595; Dr. F. Gannon, EMBL, Germany), ER{alpha} mutDBD (C202/205H), and ER{alpha} {Delta}DBD (deletion of amino acids 185-251) (Prof. P. Chambon, Institut de Génétique et de Biologie Moléculaire et Cellulaire, France) cDNAs are gifts. The cDNAs encoding ER{alpha} DF (amino acids 256-595) and ER{alpha} {Delta}D (deletion of amino acids 256-304) were obtained by PCR using ER{alpha} cDNA as template. Primer sequences are available upon request. All cDNAs were subcloned into the expression vector pCR3.1, with the exception of ER{alpha} DF cDNA, which was subcloned into pCDNA3.1 TOPO (Invitrogen, Carlsbad, CA). pCDNA3.1 HA-Ras G12V (RasV12) and MEKDD were kindly provided by Dr. A. Eychène (Unité Mixte de Recherche Centre National de la Recherche Scientifique 146, France) (20). The reporter plasmids ERE-tk-Luc and the internal control CMV-β-Gal have been previously described (18, 19). The VGF-Luc and NFLc-Luc reporter genes were obtained by the insertion of genomic PCR products (from –271 to +47 and –655 to +42, respectively) into the pGL2-basic vector (Promega Corp., Southampton, UK). The pDsRed2-C1 vector was purchased from BD Biosciences Clontech (Palo Alto, CA).

Generation of stable cell lines
PC12 cells were grown in phenol red-free DMEM/F12 (Sigma) containing 8% charcoal-stripped fetal calf serum (FCS; Sigma), 2% charcoal-stripped horse serum (Life Technologies, Pontoise, France), and antibiotics. Stably transfected PC12 clones (PC12 control, PC12 ER{alpha}, PC12 ER{alpha} {Delta}A, PC12 ER{alpha} {Delta}Box1, PC12 ER{alpha} CF, PC12 ER{alpha} DF, PC12 ER{alpha} {Delta}AF-2, PC12 ER{alpha} mutDBD, and PC12 ER{alpha} {Delta}D) were obtained after transfection of PC12 cells with the corresponding expression vectors using FuGENE 6 reagent (Roche Diagnostics, Bâle, Switzerland) and selection with 0.8 mg/ml G418 (Invitrogen).

Transient transfection experiments
For luciferase and β-galactosidase assays, transient transfections were performed with the FuGENE 6 transfection reagent (Roche Diagnostics), as recommended by the manufacturer, in 24-well plates. Total DNA mixture included 200 ng reporter genes, 150 ng CMV-βGal internal control, and 50–100 ng expression vectors. After 36 h transient transfection, cells were harvested and luciferase and β-galactosidase assays were performed as previously described (18). The reporter gene activity was obtained after normalization of the luciferase activity with the β-galactosidase activity.

For neurite outgrowth assays, PC12 cells were plated in six-well plates in complete medium and cells were transfected as described above with 0–1000 ng pcDNA3.1 HA-RasV12 or MEKDD together with 250 ng pDsRed2-C1. Thirty-six hours after transfection, the morphology of the cells was analyzed by epifluorescence microscopy. Cells expressing DsRed2 were assumed to express also HA-RasV12 or MEKDD.

Growth factor stimulation and cell lysate preparation
PC12 cells were starved overnight in DMEM/F12 containing 2% charcoal-stripped FCS and then treated for the indicated times at 37 C with chemicals (5 ng/ml NGF and/or 10 nM 17βE2, 17{alpha}E2, or DES). After stimulation, cells were washed once with ice-cold PBS containing 2 mM sodium orthovanadate and then lysed with lysis buffer [20 mM Tris HCl (pH 7.5), 150 mM NaCl, 1% Nonidet P-40, 10% glycerol, 1 mM MgCl2, 1 mM EGTA, 1 mM sodium orthovanadate, 20 mM β-glycerol-phosphate, 20 mM sodium fluoride, 1 mM phenylmethylsulfonyl fluoride, 1 µg/ml aprotinin]. Lysates were clarified by centrifugation, and protein concentrations were determined by the Bradford method. B-raf activity was determined using the B-Raf radiometric (32P) assay kit from Upstate as recommended by the manufacturer.

Western blot analysis
Forty micrograms of whole-cell extracts were denatured in a Laemmli buffer at 95 C for 5 min, resolved on a 10% SDS-PAGE, and electrotransferred onto polyvinylidene difluoride membranes (GE Healthcare, Orsay, France). The membranes were then blocked in PBS solution containing 0.1% Tween 20 and 5% nonfat milk powder for 1.5 h at room temperature and then incubated with the primary antibody in 5% milk/0.1% Tween/PBS for 1.5 h at room temperature. After washings, the blots were incubated with the appropriate secondary peroxidase-conjugated antibody for 1 h. Membrane-bound secondary antibodies were detected using enhanced chemiluminescence (ECL) from Amersham Biosciences. pERK/ERK and pAkt/Akt protein level ratios were analyzed by densitometric analyses using the ImageJ software.

Neurite outgrowth assay on PC12 clones
PC12 cells were plated at a density of 4 x 103 cells/cm2 on petri dishes. Twenty-four hours later, cells were transferred into phenol red-free DMEM/F12 containing 2% charcoal-stripped FCS and then challenged with indicated chemicals (5 ng/ml NGF and/or 10 nM 17βE2, 17{alpha}E2 or DES). Forty-eight hours later, cells were counted and scored as differentiated or undifferentiated cells. Differentiated cells were those having at least a neurite whose length was greater than one cell body (short neurites) or exhibiting a neurite whose length was greater than two cell bodies (long neurites). Cells were counted on at least 30 fields (10 fields for each separate experiment) in light microscopy.

Relative quantification of transcripts expression
Total RNA was extracted from PC12 cells by a single-step method using TRIzol reagent (Invitrogen). cDNA was synthesized from 1 µg total RNA using 50 U Long Expand reverse transcriptase, oligo-deoxythymidine primer (2.5 µM) in the conditions recommended by the supplier (Boehringer, Mannheim, Germany). Real-time PCR was then carried out on a MyiQ Thermal Cycler (Bio-Rad, Marnes-la-Coquette, France) using the IQ SYBR green Supermix (Bio-Rad), 300 nM forward and reverse primers, and diluted cDNAs in a total volume of 20 µl. After a polymerase activation step for 10 min at 95 C, 40 cycles of amplification were performed, as follows: 95 C for 15 sec and 60 C for 60 sec. A dissociation curve was systematically done at the end of each experiment to confirm the presence of a single PCR product. Gene-specific and intron-spanning primers were designed to yield amplicons less than 150 bp in size. Forward and reverse primers were, respectively, CATTTGCACGACCCCAGAGA and CCAACCCCCGGATGAGTAGA for VGF, CTGCCGGGGTATGAACGAAG and TCGTGCTTCGCAGCTCATTC for NFLc, GGGCATCCTGGGCTACACTG and GAGGTCCACCACCCTGTTGC for GAPDH, and ATCCGGGGGAGAGGGTGTAA and GCTTGCCGCTTCCCTTACCT for 28S. The PCR efficiency was systematically evaluated for each primer set, using a dilution of a pool of cDNA obtained from control and transfected cells. In each case, correlation fit a r2 >0.98, and a reaction efficiency (E) close to 2. Change in cycle threshold ({Delta}Ct) values were calculated using normalization to GAPDH and 28S, and the relative quantities of transcripts were calculated using the determined PCR efficiency (E{Delta}Ct) and expressed relative to the control. Additional control reactions were always performed on templates containing either total RNA or no cDNA and did not reveal any significant levels of contaminants.

Statistical analysis
For stably transfected clones, the significance of the treatments on neurite outgrowth and mRNA contents were determined using ANOVA followed by a Fisher’s post hoc test using the Statview 5.0 software (SAS Institute, Inc., Cary, NC), with significance determined at P < 0.05. In all these experiments, data resulted from three separate experiments and were expressed as mean ± SEM.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Unliganded and liganded ER{alpha} differently impact NGF-induced neurite outgrowth in PC12 cells
To investigate the impact that the expression of ER{alpha} expression may have on neurite outgrowth, PC12 cells, which do not express ERs in their naive state, were stably transfected with plasmids encoding or not wild-type ER{alpha}. Three series of distinct transfection were performed. For each series, both PC12 control and ER{alpha} clones were selected by Western blotting for subsequent studies (Fig. 1AGo). The amounts of ER{alpha} in these PC12 clones were shown to parallel those measured in the ER{alpha}-positive breast cancer MCF7 cell line (data not shown). The correct functionality of ER{alpha} in these PC12 clones was controlled through the transient transfection of an ERE-tk-Luc reporter, as exemplified by the ligand-dependent induction shown within Fig. 1BGo. As previously described, 17βE2 alone was unable to elicit a neurite outgrowth of PC12 cells, whatever the ER{alpha} status of cells (Fig. 1CGo) (21). In contrast, treating the PC12 clones with NGF led to a robust neurite outgrowth. Importantly, the differentiation efficiency of PC12 control cells was similar to naive PC12 (data not shown), with approximately 70% of treated cells exhibiting short neurites and 50% long neurites (Fig. 1CGo). Surprisingly, the neurite outgrowth induced by NGF was dramatically reduced in PC12 ER{alpha} clones (Fig. 1CGo). This reduction was also apparent in conditions using higher doses of NGF or a prolonged exposure (data not shown). A cotreatment of the PC12 ER{alpha} cells with 17βE2 seemed to overcome this inhibition, because it enhanced neurite outgrowth (Fig. 1CGo). Importantly, 17βE2 was unable to stimulate the neurite outgrowth of control cells even at lower doses of NGF, which induced less differentiation (data not shown). This likely excludes the possibility that a putative maximal activity of the NGF signaling pathway might explain the inability of 17βE2 to stimulate the differentiation of these control PC12 cells. Rather, this observation indicates that the repressive and stimulatory effects of 17βE2 mediated by ER{alpha} engage different mechanisms.


Figure 1
View larger version (25K):
[in this window]
[in a new window]

  		FIG. 1. Unliganded and liganded ER{alpha} differently impact the NGF-induced neurite outgrowth of PC12 cells. A, Western blot probing the expression of ER{alpha} expression in individual PC12 clones. β-Actin was used as a loading control. B, Control and ER{alpha} PC12 clones transiently transfected with the ERE-tk-Luc reporter gene and the CMV-βGal internal control were treated for 24 h with 17βE2 (E2, 10 nM), ICI 182,780 (ICI, 10 µM), or ethanol as vehicle control (veh). Normalized luciferase activities correspond to the mean ± SEM of four separate experiments. C, The neurite outgrowth of three independent series of PC12 clones (an ER{alpha} clone with its related control clone) was quantified, as described in Materials and Methods, after a 2-d treatment with NGF (5 ng/ml) in the presence or not of 10 nM 17βE2. Results shown are the mean ± SEM of three separate experiments. D, The expression of VGF and NFLc mRNAs was monitored by real-time PCR in PC12 clones (series 1) after a treatment with NGF (5 ng/ml) in the presence or not of 10 nM 17βE2. VGF and NFLc mRNA levels were normalized against invariant GAPDH and 28S RNAs. Values were standardized to the expression level measured in ER{alpha} PC12 cells treated with NGF and correspond to the mean ± SEM of three separate experiments. In C (separate analysis for short and long neurites and for each clone series) and D, columns with different superscripts differ significantly (P < 0.05).

 
The putative interaction between signaling pathways initiated by ER{alpha} and NGF were further explored through the evaluation of the expression of VGF and neurofilament light chain (NFLc) genes, which are stimulated by NGF (22, 23). After 24 h treatment with NGF and/or 17βE2, the relative amounts of VGF and NFLc mRNAs were then monitored by RT-quantitative PCR (qPCR). In control PC12 cells, the amount of VGF mRNA was not modified by 17βE2 but was markedly enhanced by NGF (Fig. 1DGo). In accordance with the observed effect of ER{alpha} expression on neurite outgrowth, the induction of VGF mRNA by NGF was reduced in ER{alpha}-expressing cells and partially restored upon addition of 17βE2. In contrast to VGF, 24 h exposure to NGF did not induce the amounts of NFLc in control cells (Fig. 1DGo). However, this analysis clearly evidenced the strong impact exerted by ER{alpha} on NFLc basal expression. This inhibition was partially removed in the presence of NGF and further reduced upon addition of 17βE2. Importantly, these experiments were performed on two series of clones and generated similar results (data not shown). These data therefore indicate that an expression of ER{alpha} renders PC12 cells less sensitive to a differentiation induced by NGF. However, in parallel, this differentiation then becomes sensitive to estrogens. We next explored the mechanisms involved in these two effects provoked by ER{alpha}.

Unliganded ER{alpha} represses NGF signaling through its D domain
To identify the molecular mechanisms underlying the repressive activity exerted by ER{alpha} on PC12 differentiation, we first sought to delineate the regions of ER{alpha} involved in this process. For this purpose, PC12 clones stably expressing different mutants of ER{alpha} deficient for classical functions were generated. The expression of these ER{alpha} variants in PC12 clones was confirmed by Western blotting (data not shown). For all subsequent analysis, at least two individual PC12 clones expressing the different mutants were studied and gave similar results. As shown in Fig. 2AGo, cells producing ER{alpha} forms progressively deleted in the N-terminal region [ER {Delta}A (deletion of the A domain), ER{alpha} {Delta}A/box1 (deletion of the A domain and of an AF-1 subregion termed box 1), and ER{alpha} CF (lacking the entire A/B domain and deficient for the full AF-1 function)] still exhibited an inhibition of their neurite outgrowth by NGF. Likewise, the deletion of the ER{alpha} C-terminal region containing the helix 12 (ER{alpha} {Delta}AF-2), which is a critical secondary structure for AF-2 transactivation efficiency, had no impact on the repressive action of ER{alpha}. Therefore, both AF-1 and AF-2 transactivation domains are not involved in the inhibitory effect of unliganded ER{alpha}, suggesting that a direct transcriptional activity of ER{alpha} is not required. This hypothesis is further substantiated by the observation that the inhibition of NGF-induced neurite outgrowth was still occurring in cells expressing either ER{alpha} DF (lacks the A/B and DBD domains) or an ER{alpha} harboring point mutations in its DBD that impedes ERE-binding and consequent transcriptional activity (ER{alpha} mutDBD). Interestingly, in contrast to the other ER{alpha} mutants, the single deletion of the D domain (or hinge region) totally abolished the repressive action of ER{alpha} on PC12 differentiation, with a NGF-induced neurite outgrowth similar to that observed in control cells. Although potentially useful for the study, we did not succeed in establishing PC12 clones expressing EF domains. We presume that the ER{alpha} EF region is improperly folded and/or rapidly degraded in PC12 cells. Altogether, our data strongly suggest that the D domain plays a main role in the repressive action exerted by unliganded ER{alpha} on NGF-induced neuronal differentiation.


Figure 2
View larger version (31K):
[in this window]
[in a new window]

  		FIG. 2. Unliganded ER{alpha} represses NGF signaling through its D domain. A, ER{alpha} mutants deficient for classical ER{alpha} functions were stably transfected in PC12 cells and then analyzed for their impact on NGF-induced neurite outgrowth. Differentiation was quantified as described in Materials and Methods. *, Significant effect in reference with the control clone, P < 0.05. B, The activities of ERK1/2 and Akt in control and ER{alpha} PC12 clones were monitored during NGF treatment (5 ng/ml, 0–120 min) by Western blots using antibodies directed against the phosphorylated forms of the two kinases. Total ERK1/2 and Akt amounts were controlled. The expression of ER{alpha} expression was also followed. Histograms represent the mean ± SD of pERK/ERK or pAkt/Akt ratios from three separate experiments. C, After a 30-min treatment with NGF (5 ng/ml), the activities of ERK1/2 and Akt were evaluated as above in depicted PC12 clones. D, The activity of B-raf in the indicated PC12 clones was measured 15 min after a NGF treatment using a B-Raf radiometric (32P) assay kit. E, Western blot analysis of pCREB, CREB and c-fos in control and ER{alpha} PC12 clones treated with NGF (5 ng/ml) for 0–120 min. F, The levels of VGF in control and mutated ER{alpha} PC12 clone mRNAs were evaluated by qPCR after treatment or not with NGF (5 ng/ml) for 24 h. Values were standardized to the expression level measured in untreated control cells. Results represent the mean ± SEM of three separate experiments.

 
Activation of the MAPK and PI3K/Akt signaling pathways is an essential step in promoting neuronal differentiation of PC12 cells upon NGF treatment (16, 24). Because the repressive effects played by unliganded ER{alpha} did not involve conventional domains required for transcriptional activity, we therefore evaluated the influences that ER{alpha} expression may have on MAPK and PI3K/Akt signal transduction cascades. For this purpose, serum-starved cells were treated with NGF (5 ng/ml) for 15–120 min, and the activation of ERK1/2 and Akt was monitored by Western blotting. As evidenced in Fig. 2BGo, the expression of ER{alpha} clearly reduced the levels of phosphorylated ERK1/2 after NGF treatment, whereas total ERK1/2 amounts remained unaltered. A similar observation was done when using a phosphospecific antibody raised against the activated form of Akt (Fig. 2BGo). Interestingly, it should be noted that the NGF treatment enhanced the amounts of ER{alpha} protein (Fig. 2BGo). Corroborating their impact on neurite outgrowth, ER{alpha} CF, ER{alpha} {Delta}AF-2, ER{alpha} DF, and ER{alpha} mutDBD but not ER{alpha} {Delta}D provoked a decrease in both active ERK1/2 and active Akt amounts (Fig. 2CGo). Moreover, the activity of B-raf, which is the main effector of MAPKs in PC12 cells, was also repressed in ER{alpha} and ER{alpha} CF clones but not in ER{alpha} {Delta}D cells (Fig. 2DGo).

Once activated by NGF, ERK1/2 and Akt promote the differentiation of PC12 cells into neuron-like cells partly through the modulation of gene expression controlled by phosphorylatable transcription factors (25). For instance, the nuclear transcription factor CREB, which is a major downstream target of ERK1/2 signaling, contributes to the neuronal differentiation of PC12 cells (26). Because ER{alpha} opposed endogenous ERK1/2 phosphorylation, CREB activity, which is triggered by the phosphorylation of its serine 133, should be inhibited as well. Accordingly, after NGF treatment, the activation of CREB, monitored by Western blot using an antibody directed against its phosphorylated Ser133, was strikingly reduced in ER{alpha} cells compared with control cells (Fig. 2EGo). As a result, the expression of the transcription factor c-fos, which is one of the best characterized targets of activated CREB in PC12 cells (27), was poorly induced by NGF in ER{alpha} cells (Fig. 2EGo). Furthermore, the phosphorylation and stabilization of c-fos protein by ERK1/2 (28) was also reduced in ER{alpha} cells, as revealed by the lower intensity of the upper band compared with control cells. Finally, the expression of VGF, which is a target of these signaling pathways, was strongly reduced in cells expressing ER{alpha} mutants exhibiting a decrease in MAPK and PI3K/Akt signaling pathways, such as ER{alpha} CF and ER{alpha} DF clones (Fig. 2FGo). In contrast, the levels of VGF mRNA measured in cells producing the {Delta}D ER{alpha} were similar to those detected in control cells.

Altogether, these results demonstrate that MAPK and the Akt signaling pathways are both inhibited in ER{alpha}-expressing cells, leading to a negative regulation of downstream events involved in the differentiation of PC12 cells induced by NGF.

Constitutively active forms of Ras and MAPK kinase (MEK) do not suppress the repressive action of the unliganded ER{alpha} on NGF signaling
In the absence 17βE2, the expression of ER{alpha} in PC12 cells therefore reduces B-raf, ERK1/2, and Akt activity. We next sought to determine precisely the location of ER{alpha} influence within the NGF/Ras/B-Raf/MEK/ERK signaling pathway. For this purpose, we evaluated, in control and ER{alpha} PC12 clones, the impact of a constitutively active form of Ras (RasV12) on NGF-induced neurite outgrowth and on the activity of NGF target genes. As shown in Fig. 3AGo, after the transient transfection of RasV12, a similar percentage of cells bearing long neurites was observed in control and ER{alpha} cells upon NGF treatment. In these conditions, ER{alpha} PC12 clones developed, however, very large neurite processes, whereas control cells extended thin neurites that were indistinguishable from those induced by NGF (data not shown). These data suggest therefore that signaling events occurring between RasV12 and B-Raf are altered in ER{alpha} PC12 clones. To confirm this assumption, a constitutive active form of MEK, MEKDD was also transfected in PC12 clones. Because MEK is downstream of B-raf, the overexpression of MEKDD was thus expected to lead to similar neurite outgrowth in both control and ER{alpha} PC12 cells. Surprisingly, the NGF-induced neurite outgrowth was lower in ER{alpha}-expressing cells than control cells in the presence of MEKDD. Luciferase assays were then carried out on PC12 clones transiently transfected with RasV12 or MEKDD, together with a VGF-Luc or NFLc-Luc reporter gene previously described as sensitive to NGF (22, 23). The results obtained by this approach clearly show that NGF, RasV12, and MEKDD induce VGF and NFLc promoter activities in a more efficient manner in control than in ER{alpha}-expressing cells (Fig. 3BGo). Therefore, the repressive action exerted by unliganded ER{alpha} on the NGF/Ras/B-Raf/MEK/ERK signaling pathway is not totally abolished by the use of constitutively active Ras and MEK forms. This suggests that unliganded ER{alpha} may control this signaling pathway at multiple levels or, alternatively, that ER{alpha} may impact widely this pathway by an indirect mechanism.


Figure 3
View larger version (14K):
[in this window]
[in a new window]

  		FIG. 3. Constitutively active forms of Ras and MEK do not suppress the repressive action exerted by unliganded ER{alpha} on NGF signaling. A, Control and ER{alpha} PC12 cells were transiently transfected with pDsRed2-C1 together with increasing amounts (0–1000 ng) of pcDNA3.1 RasV12 or MEKDD. Thirty-six hours after transfection, the percentage of transfected cells bearing long neurites was determined under epifluorescence microscopy. Shown are mean ± SEM of three separate experiments. B, Control and ER{alpha} PC12 cells were transiently transfected with the VGF-Luc or NFLc-Luc reporter genes, together with CMV-βGal internal control as well as with empty, RasV12, or MEKDD pcDNA3.1 plasmids. Cells transfected with empty pcDNA3.1 were then treated or not with NGF (5 ng/ml) for 36 h. Normalized luciferase activities were reported relative to the activity obtained in untreated cells transfected with the empty expression vector. Values are the average ± SD from three separate experiments. C, Naive PC12 cells were transiently transfected with pDsRed2-C1 together with pCR3.1, pCR ER{alpha}, or pCR ER{alpha} CF. After transfection, cells were challenged during 2 d with NGF (5 ng/ml) in the presence or not of 10 nM 17βE2 (E2). Neurite outgrowth was quantified as in A, and the results were standardized to NGF-treated cells transfected with pCR3.1 and represent the mean ± SEM of four separate experiments.

 
Finally, the transient expression of ER{alpha} in PC12 cells was inefficient in repressing NGF-induced neurite outgrowth, although it was able to set up a competent environment for the estrogenic stimulation of PC12 differentiation induced by NGF (Fig. 3CGo). These experiments therefore suggest that a long-term expression of ER{alpha} is necessary to impact NGF signaling. Furthermore, the uncoupling between effects mediated by unliganded and liganded ER{alpha} suggests that these processes are independent and therefore rely on distinct mechanisms.

The stimulation of NGF-induced neurite outgrowth by liganded ER{alpha} does not rely on changes in ERK1/2 and Akt activities
Many studies ascribed the neuritogenic potency of 17βE2 to its ability to activate the Ras-ERK1/2 signaling pathway (29, 30). We therefore examined whether a 17βE2 treatment is able to elicit a phosphorylation of ERK in PC12 clones. Surprisingly, Western blots probing the phosphorylated form of ERK1/2 revealed that 17βE2 elicits an activation of ERK1/2 in an ER{alpha}-independent process, because it was detected in ER{alpha} cells but also in control PC12 cells (Fig. 4AGo). Importantly, as it occurred upon NGF induction, the phosphorylation of ERK1/2 induced by 17βE2 was markedly reduced in ER{alpha} PC12 cells compared with control ones. The ligand specificity of this activation of ERK1/2 was further investigated using the natural enantiomer 17{alpha}E2 and the ER-agonist DES. As shown in Fig. 4AGo, an exposure of the cells to 17{alpha}E2 also elicited a phosphorylation of ERK1/2, whereas no activation was detected after the treatment with DES. These pharmacological data are in sharp contrast with the results of neurite outgrowth assays performed with these compounds (Fig. 4BGo). Indeed, as expected from results obtained with 17βE2 alone, neither 17{alpha}E2 nor DES exhibited a neuritogenic potency in control PC12 cells. Furthermore, 17{alpha}E2 did not increase the neurite outgrowth of NGF-treated ER{alpha} cells, in contrast to the ER{alpha} agonists DES and 17βE2. No further effects were observed with higher doses of 17{alpha}E2 (0.1–1 µM) (data not shown). This rules out the hypothesis that the inability of 17{alpha}E2 to promote PC12 differentiation may be caused by its reduced affinity for ER{alpha}.


Figure 4
View larger version (28K):
[in this window]
[in a new window]

  		FIG. 4. Stimulation of NGF-induced neurite outgrowth by liganded ER{alpha} does not rely on changes in ERK1/2 and Akt activities. A, Western blot probing the total and phosphorylated ERK1/2 in control and ER{alpha} clones after 15 min treatment with 10 nM 17βE2 (E2), 17{alpha}E2 ({alpha}E2), DES, or ethanol as vehicle control (Veh). B, The neurite outgrowth of control and ER{alpha} PC12 clones was quantified as described in Materials and Methods, after 2 d treatment with NGF (5 ng/ml) in the presence of 10 nM E2, {alpha}E2, DES, or vehicle. Results shown are the mean ± SEM of three separate experiments. Columns with different superscripts differ significantly (P < 0.05). C, Control and ER{alpha} PC12 cells were treated with NGF (5 ng/ml) together with 10 nM E2 or vehicle for 0–120 min. ERK1/2, pERK 1/2, Akt, pAkt, pCREB, c-fos, and ER{alpha} were analyzed by Western blots as described in Fig. 2Go. Shown are pictures from a representative experiment, and pERK/ERK and pAkt/Akt ratios correspond to the mean ± SD of at least three separate experiments.

 
Because the neuritogenic properties of 17βE2 were observed only in the presence of NGF, we next determined whether the potentiation of neurite outgrowth by 17βE2 in PC12 ER{alpha} cells would rely on a modification of the activities of ERKs and Akt. As shown in Fig. 4CGo, the activation of ERK1/2 and Akt signaling by NGF was not affected by 17βE2 treatment in ER{alpha} PC12 clones. Longer periods of 17βE2 exposure led to similar results (data not shown). In addition, no further changes in CREB and c-fos phosphorylation were observed in ER{alpha} cells when 17βE2 was added to NGF (Fig. 4CGo). Changes in the ER{alpha} expression level induced by the NGF treatment were also not affected by 17βE2. Altogether, these results indicate that, in PC12 cells, the stimulation of the NGF-induced neurite outgrowth by liganded ER{alpha} does not depend on changes in the MAPK and Akt signaling pathways. The mechanisms underlying this process are thus unlikely to rely on a suppression of those engaged by unliganded ER{alpha} when repressing the differentiation of PC12 cells.

Stimulation of NGF-induced neurite outgrowth by liganded ER{alpha} might rely on an ERE-independent transcriptional mechanism
In an attempt to identify the molecular mechanisms engaged by 17βE2 to stimulate the neurite outgrowth induced by NGF, we sought to determine which of the regions of ER{alpha} were involved. Neurite outgrowth assays were therefore performed with the array of PC12 clones described before. We previously reported in stable (21) or transiently transfected PC12 cells (Fig. 3CGo) that the A/B domain of ER{alpha} is critical in mediating the stimulation of NGF-induced neurite outgrowth by 17βE2. Interestingly, in contrast to ER{alpha} CF-expressing cells, the NGF-induced differentiation of those expressing ER{alpha} {Delta}A or ER{alpha} {Delta}A/box1 were still increased by 17βE2 (Fig. 5AGo). The region 80–174 encompassing the AF-1 subregion termed Box2/3 seems therefore necessary for mediating this effect of 17βE2. In parallel, an enhancement of neurite outgrowth by 17βE2 was also abolished in cells expressing ER{alpha} mutDBD, ER{alpha} {Delta}D, and ER{alpha} {Delta}AF-2. On the other hand, although devoid of A/B and DBD domains, ER{alpha} DF was also efficient in mediating the stimulation of NGF-induced differentiation by 17βE2 (Fig. 5AGo). Accordingly, the addition of the DBD to the truncated ER{alpha} DF form is likely to impose a requirement for the presence of the AF-1 Box2/3 to preserve the estrogenic responsiveness. From these results, it also seems that liganded ER{alpha} requires both of its transactivation functions to impact the differentiation of PC12 cells. This suggests that the action of liganded ER{alpha} involves transcriptional regulations.


Figure 5
View larger version (12K):
[in this window]
[in a new window]

  		FIG. 5. Stimulation of NGF-induced neurite outgrowth by liganded ER{alpha} requires the transactivation functions and D domain of the receptor. A, PC12 clones stably expressing various ER{alpha} mutants deficient for classical ER{alpha} functions were treated during 2 d with NGF (5 ng/ml) in the presence or not of 10 nM 17βE2 (E2). Neurite outgrowth (short neurites) was then quantified as described in Materials and Methods. B, After a 24-h exposure time with NGF (5 ng/ml) together or not with 10 nM E2, the amounts of VGF mRNA present within indicated PC12 clones were evaluated by qPCR. In both panels, the results are expressed for each clone relative to the level obtained in cells treated with NGF alone. Data shown in A and B are the mean ± SEM of three separate experiments. *, Significant effect of 17βE2 for each clone, P < 0.05.

 
Although unable to regulate the NGF-induced MAPK signaling pathway (Fig. 4CGo), 17βE2 was able to enhance the response of neuronal markers such as VGF to NGF in ER{alpha}-expressing cells (Fig. 1DGo). We therefore determined whether the estrogenic regulation of VGF transcription required domains of ER{alpha} similar or different from those involved in the effects exerted by 17βE2 on neurite outgrowth. We thus used real-time PCR to evaluate the levels of VGF mRNA present in major ER{alpha} mutant PC12 clones exhibiting distinct effects of E2 on neurite outgrowth, such as the ER{alpha} CF, ER{alpha} DF, and ER{alpha} {Delta}D clones. The results of these experiments are in total accordance with neurite outgrowth data and show that ER{alpha} DF still promotes a stimulation of NGF-induced VGF expression by estrogen, whereas ER{alpha} CF and ER{alpha} {Delta}D expression are ineffective (Fig. 5BGo).

To strengthen the hypothesis that ER{alpha} may directly activate the transcription of VGF, we transiently transfected PC12 cells with the VGF-Luc reporter gene together with wild-type or mutated forms of ER{alpha}. As shown in Fig. 6Go, the expression of the wild-type form of ER{alpha} allowed 17βE2 to increase the VGF promoter activity in the presence of NGF. This demonstrates that the VGF promoter proximal region (–247/+47), which is devoid of EREs, can respond to estrogen. Interestingly, similar results were obtained using the NFLc-Luc reporter gene (data not shown). In agreement with the neurite outgrowth data, the expression of ER{alpha} {Delta}A/Box1 still allowed 17βE2 to increase the VGF promoter activity in the presence of NGF, whereas ER{alpha} CF was unable to do so. The enhancement of the VGF promoter activity by 17βE2 also depends upon the AF-2 and D domain of ER{alpha}, as demonstrated, respectively, by transiently expressing ER{alpha} {Delta}AF-2 and ER{alpha} {Delta}D. Interestingly, although the destruction of the first zinc finger of the DBD by the C202/205H mutations impaired the estrogen responsiveness of the VGF promoter, the deletion of the entire DBD did not reproduce this effect. Finally, contrasting with the neurite outgrowth data, the transient expression of the ER{alpha} DF did not convey estrogen responsiveness to the VGF promoter (Fig. 6Go).


Figure 6
View larger version (18K):
[in this window]
[in a new window]

  		FIG. 6. Comparative determination of ER{alpha} domains involved in the estrogenic regulation of VGF and an ERE-driven gene. Naive PC12 cells were transiently transfected with VGF-Luc or ERE-tk-Luc reporter genes together with CMV-βGal and pCR3.1 plasmid encoding or not various ER{alpha} mutants. Twelve hours after transfection, the cells were treated or not with NGF (5 ng/ml) in the presence or not of 17βE2 (E2, 10 nM) during 24 h. Normalized luciferase activities were standardized to the reporter gene activity measured in either untreated pCR3.1 transfected cells for VGF-Luc reporter gene (left) or NGF-treated pCR3.1 transfected cells for the ERE-tk-Luc (right). Values represent the mean ± SEM of three experiments.

 
In parallel, we evaluated the transactivation efficiency of the different forms of ER{alpha} on an ERE-driven reporter gene (ERE-tk-Luc) in PC12 cells treated with NGF. As shown within Fig. 6Go, the ERE-tk-Luc reporter activity was enhanced by 17βE2 notably in cells expressing ER{alpha} CF, ER{alpha} {Delta}D, and ER{alpha} {Delta}AF-2. Importantly, these deleted forms of ER{alpha} forms were totally inefficient in mediating the stimulation of PC12 differentiation by estrogens.

Altogether, these data indicate that an ERE-independent transcriptional mechanism is likely involved in the neuritogenic properties exerted by 17βE2 on ER{alpha}-expressing PC12 cells.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The current study aimed at determining the molecular mechanisms involved in the specific neurotrophism induced by estrogen, upon expression of ER{alpha} in a well-studied model system, the PC12 cells.

Inhibition of NGF signaling by ER{alpha} expression
We first demonstrated that the expression of ER{alpha} in itself partly inhibits NGF-induced neuronal differentiation of PC12 cells. Precisely, in the absence of 17βE2, ER{alpha} reduces NGF-induced neurite outgrowth and NGF-induced expression of neuronal markers. Such processes are, at least partly, due to a profound repression of both MAPK/ERK and PI3K/Akt signaling pathways. These data are consistent with the observation that the responsiveness of ERK1/2 to neurotrophin was enhanced in cortical explants from ER{alpha}–/– mice (31). Similarly, long-term treatment of ER{alpha}-positive breast tumor cell line (MCF7) with the antiestrogen ICI 182,780 has been shown to inhibit ER{alpha} expression and, concomitantly, to enhance the activity of the epidermal growth factor signaling pathway (32). ER{alpha} has also been proposed to be anchored on the plasma membrane either through posttranslational modifications and/or through interactions with multimolecular complexes involved in signal transduction (12, 13). For instance, palmitoylation of ER{alpha} allows its association with the plasma membrane and an interaction with the scaffolding protein caveolin-1. Importantly, this protein is an integral component of caveolae membrane invaginations that are enriched in proteins involved in the MAPK signaling pathways (33). ER{alpha} also interacts directly to c-src nonreceptor tyrosine kinase, the p85{alpha} regulatory subunit of PI3K and G proteins (G{alpha}i) in breast cancer and/or endothelial cells (34, 35, 36). In cortical explants, ER{alpha} is thought to be part of a complex comprising the heat-shock protein HSP-90 and B-Raf, the major Raf isoform activated by NGF in PC12 cells (31). To identify the components of the signaling cascade that are targeted by unliganded ER{alpha} in PC12 cells, we used constitutively active forms of Ras (RasV12) and MEK (MEKDD) in our experiments. The data obtained on MAPK/ERK and PI3K/Akt signaling pathways indicated that ER{alpha} might act in the early steps of the cascades. However, the transcriptional activities resulting from RasV12 and MEKDD expression were still inhibited in ER{alpha}-expressing cells, suggesting that ER{alpha} acts also downstream of MEK. Unliganded ER{alpha} might therefore repress NGF signaling either directly at several levels in the cascades or indirectly via a protein which activity has a broad impact on cell signaling.

Interestingly, the repressive action of ER{alpha} on the neurite outgrowth induced by NGF was not observed after a transient expression of receptor. This indicates that the setting up of the process requires a long-term expression of ER{alpha}. Therefore, instead of a direct impact of unliganded ER{alpha} on compounds of the NGF signaling pathway, ER{alpha} might also inhibit NGF signaling through epigenetic regulations or changes in gene expression; processes that require longer times. Obviously, additional investigations should be done to clearly identify the mechanism of the repression to test whether one of these mechanisms is solely responsible for ER{alpha} repressive influence on NGF signaling or not.

To gain preliminary mechanistic details in this process, we evaluated the potential contribution of ER{alpha} domains necessary for classical nuclear function toward the inhibition of NGF signaling. The analysis of a series of PC12 clones expressing variant forms of ER{alpha} strongly suggests that the influence exerted by ER{alpha} on the establishment of a neuronal phenotype does not rely on its ability to transactivate. Indeed, both AF-1 and AF-2 transactivation functions of ER{alpha} were not required for this process to occur. In contrast, DF domains were sufficient to mediate the inhibition of NGF-induced neuronal differentiation. Interestingly, the A/B and C domains of ER{alpha} do not contribute to membrane ER{alpha} localization, palmitoylation, and association with caveolin-1 (33). Finally, an ER{alpha} variant lacking the D domain failed to set up the repression. Although we cannot totally rule out that this deletion directs an improper folding of the receptor, these data suggest that the amino acids present in the D domain are directly involved in the ER{alpha} repressive effect. Of interest, Gallo et al. (37) have recently reported that a synthetic peptide corresponding to the P295-T311 sequence mainly located in the D domain, elicits estrogenic responses in ER{alpha}-positive breast cancer cell lines. The authors have ascribed this effect to a competitive mechanism that disrupts the repressive conformation of the aporeceptor. Besides, the authors suggested that such peptides might be generated intracellularly by proteasomal degradation of ER{alpha} (38). In view of these data, a screening for D domain-dependent partners of ER{alpha} would be therefore informative and of importance.

17βE2 promotes NGF-induced differentiation of PC12 cells through ER{alpha}
The results obtained in this study clearly show that 17βE2 enhances the neurite outgrowth induced by NGF in PC12 cells expressing ER{alpha} but not in control cells. Similarly, 17βE2 increased the mRNA amounts of two markers of neuronal differentiation (VGF and NFLc) only in PC12 cells expressing ER{alpha}.

To define the bases of this mechanism, we explored the possibility that 17βE2 might act through rapid actions originating from the membrane. We thus first tested the impact of 17βE2 alone on the MAPK/ERK signaling pathway. 17βE2 was able to weakly induce ERK phosphorylation in ER{alpha}-expressing clones but also in control and naive PC12 cells, which do not express ER{alpha} or ERβ (Fig. 1AGo, data not shown). These results suggested the existence of an ER-independent activation of intracellular signaling pathways, as recently reported (39, 40, 41). The accuracy of this ER-independent mechanism was strengthened by the finding that the natural enantiomer 17{alpha}E2 also activated ERK1/2 in PC12 cells, whereas DES, an agonist ligand of ER{alpha}, was inefficient. However, the functional consequences of this activation of ERK by 17βE2 or 17{alpha}E2 on the differentiation of naive PC12 are unclear. Indeed, although both enantiomers act on the ERK pathway, they do not modify neurite outgrowth in our experimental system.

The effect of 17βE2 on PC12 differentiation was observed only in ER{alpha}-expressing PC12 cells treated with NGF. Another possible explanation for this process might thus rely on a release from the inhibition mediated by unliganded ER{alpha}. However, some of our data are not favoring this hypothesis. For instance, whereas unliganded ER{alpha} strongly repressed the NGF-induced phosphorylation of ERK1/2, Akt, CREB, and c-fos, the phosphorylation state of these proteins was not enhanced in the presence of 17βE2. The stimulation of NGF-induced differentiation by 17βE2 is therefore unlikely to depend upon changes in the activity of MAPK/ERK and PI3K/Akt signaling pathways. The hypothesis that unliganded and liganded ER{alpha} engage independent mechanisms to influence neurite growth in PC12 cells is strengthened by the observation that both processes can be uncoupled. Indeed, although 17βE2 was able to enhance neurite outgrowth after the transient transfection of ER{alpha} in PC12 cells, no repression was observed minus ligand.

Our data suggest that the action of liganded ER{alpha} on PC12 differentiation might be mediated by a mechanism originating at the transcriptional level. Indeed, the regions of ER{alpha} required for the occurrence of this process are those classically involved in the transcriptional activity of the receptor. More precisely, the deletion of either the AF-1 subregion termed Box2/3 (amino acids 79-183) (42) or the AF-2 prevented 17βE2 from stimulating NGF-induced neurite outgrowth. Therefore, cross talks between liganded ER{alpha} and NGF signaling might occur on NGF target genes. Furthermore, transient transfection experiments using the VGF-Luc reporter gene clearly demonstrated that the VGF promoter –271/+47 fragment was sufficient to confer estrogen responsiveness in the presence of ER{alpha}. Because this sequence does not contain any ERE, it is possible that ER{alpha} could act indirectly by interacting with other transcription factors. This mode of action has been previously reported for a number of genes containing elements such as AP-1 sites, cAMP-response elements and Sp1 sites (43, 44, 45). Like several genes involved in growth, the VGF gene is controlled by such DNA elements (22). Additional data seem to corroborate the hypothesis of an estrogenic regulation of the VGF gene based on protein-protein interactions. First, 17βE2-induced cross talk with c-jun or Sp1 proteins is abolished when the A/B domain of ER{alpha} is deleted (46, 47). This is consistent with the absence of stimulation of both neurite outgrowth and VGF promoter activity by 17βE2 when using the ER{alpha} CF construct. The fact that this ER{alpha} CF variant is still able to mediate nongenomic effects of 17βE2 (48) further illustrate the fact that the action of liganded ER{alpha} on PC12 differentiation might be mediated by a mechanism originating at the transcriptional level.

Second, compared with the ER{alpha} CF, the further deletion of the DBD (ER{alpha} DF) restored a stimulation of NGF-induced neurite outgrowth by 17βE2. This implies that ER{alpha} binding to DNA is obviously not required for this process and resembles the situation observed in the case of ER{alpha}/AP-1 or Sp1 cross talks, in which ER{alpha} DBD is dispensable (46, 47). At the transcriptional level, this hypothesis is also reflected by the fact that an ER{alpha} form deleted of the entire DBD (ER{alpha} {Delta}DBD) still mediated the stimulation of the VGF promoter activity (Fig. 6Go). However, this effect was not observed after the transient expression of ER{alpha} DF or an ER{alpha} bearing C202/205H mutations within the first zinc finger of the DBD (ER{alpha} mutDBD). These results are in discrepancy with our hypothesis but might be explained first by the fact that transiently transfected ER{alpha} DF may possess a poor stability. This would explain the troubles we encountered when trying to generate stable PC12 clones expressing this mutant ER{alpha}. Second, the C202/205H mutations destroy the first zinc finger of the DBD and thereby affect the structure of this region and possibly the correct folding of neighboring regions. Importantly, point mutations within the first zinc finger have various effects on ER{alpha}/AP-1 or ER{alpha}/Sp1 cross talk (47, 49).

The hypothesis that the action of liganded ER{alpha} on PC12 differentiation might originate from a transcriptional ERE-independent mechanism is lastly illustrated by the results obtained when using the ER{alpha} {Delta}D mutant. Indeed, 17βE2 had no impact on the neurite outgrowth of PC12 clones expressing this protein. Additionally, 17βE2 did not stimulate the activity of the VGF promoter through ER{alpha} {Delta}D, although this construct was transcriptionally active on an ERE-TK-Luc reporter (Fig. 6Go) (50). Accordingly, the D domain of ER{alpha} is critical in mediating physical interactions with c-jun or Sp1 proteins (47, 51).

In conclusion, our data indicate that the ligand-binding status of ER{alpha} might be an important determinant for the physiological and pathological outcome of neurotrophin signaling in neurons. Indeed, whereas ER{alpha} mediates a neurotrophic effect of estrogen, unliganded ER{alpha} inhibits NGF-induced neuronal differentiation, a process that is evidenced for the first time in this study. This mechanism is likely to be of importance for the understanding of the beneficial effects played by estrogen on age diseases. For instance, after menopause, the declining estrogenic stimulus might confer brain ER{alpha}-expressing neurons to be more susceptible to age-related alterations.


   Acknowledgments
 
We gratefully acknowledge Dr. R. Métivier for his helpful comments and corrections on the manuscript and Dr. S. Rétaux for a final reading of the manuscript. We thank A. Eychène, P. Chambon, and F. Gannon for providing plasmids.


   Footnotes
 
This work was supported by a fellowship from the Association pour la Recherche sur le Cancer (ARC) (Y.M.) and by funds from the CNRS, the University of Rennes 1, the ARC, the Ligue contre le cancer, and the Agence Nationale de la Recherche.

Present address for Y.M.: Unité Propre de Recherche 2197 "Développement, Evolution, Plasticité du Système Nerveux," Institut de Neurobiologie Alfred Fessard, CNRS, Avenue de la Terrasse, 91198 Gif-sur-Yvette, France.

Disclosure Statement: The authors have nothing to disclose.

First Published Online September 4, 2008

Abbreviations: AF, Transactivation function; CREB, cAMP response element-binding protein; DBD, DNA-binding domain; DES, diethylstilbestrol; 17βE2, 17β-estradiol; ER{alpha}, estrogen receptor {alpha}; FCS, fetal calf serum; LBD, ligand-binding domain; MEK, MAPK kinase; NFLc, neurofilament light chain; NGF, nerve growth factor; p, phosphorylated; PI3K, phosphatidylinositol 3-kinase; qPCR, quantitative PCR.

Received April 1, 2008.

Accepted for publication August 27, 2008.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nilsson S, Makela S, Treuter E, Tujague M, Thomsen J, Andersson G, Enmark E, Pettersson K, Warner M, Gustafsson JA 2001 Mechanisms of estrogen action. Physiol Rev 81:1535–1565[Abstract/Free Full Text]
  2. McEwen BS, Alves SE 1999 Estrogen actions in the central nervous system. Endocr Rev 20:279–307[Abstract/Free Full Text]
  3. Toran-Allerand CD, Singh M, Setalo Jr G 1999 Novel mechanisms of estrogen action in the brain: new players in an old story. Front Neuroendocrinol 20:97–121[CrossRef][Medline]
  4. Garcia-Segura LM, Azcoitia I, DonCarlos LL 2001 Neuroprotection by estradiol. Prog Neurobiol 63:29–60[CrossRef][Medline]
  5. Maggi A, Ciana P, Belcredito S, Vegeto E 2004 Estrogens in the nervous system: mechanisms and nonreproductive functions. Annu Rev Physiol 66:291–313[CrossRef][Medline]
  6. Nuclear Receptors Nomenclature Committee 1999 A unified nomenclature system for the nuclear receptor superfamily. Cell 97:161–163[CrossRef][Medline]
  7. Dubal DB, Zhu H, Yu J, Rau SW, Shughrue PJ, Merchenthaler I, Kindy MS, Wise PM 2001 Estrogen receptor {alpha}, not β, is a critical link in estradiol-mediated protection against brain injury. Proc Natl Acad Sci USA 98:1952–1957[Abstract/Free Full Text]
  8. Antal MC, Krust A, Chambon P, Mark M 2008 Sterility and absence of histopathological defects in nonreproductive organs of a mouse ERβ-null mutant. Proc Natl Acad Sci USA 105:2433–2438[Abstract/Free Full Text]
  9. Beato M 1989 Gene regulation by steroid hormones. Cell 56:335–344[CrossRef][Medline]
  10. Tora L, White J, Brou C, Tasset D, Webster N, Scheer E, Chambon P 1989 The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell 59:477–487[CrossRef][Medline]
  11. McKenna NJ, O'Malley BW 2002 Combinatorial control of gene expression by nuclear receptors and coregulators. Cell 108:465–474[CrossRef][Medline]
  12. Edwards DP 2005 Regulation of signal transduction pathways by estrogen and progesterone. Annu Rev Physiol 67:335–376[CrossRef][Medline]
  13. Levin ER 2005 Integration of the extranuclear and nuclear actions of estrogen. Mol Endocrinol 19:1951–1959[Abstract/Free Full Text]
  14. Wade CB, Dorsa DM 2003 Estrogen activation of cyclic adenosine 5'-monophosphate response element-mediated transcription requires the extracellularly regulated kinase/mitogen-activated protein kinase pathway. Endocrinology 144:832–838[Abstract/Free Full Text]
  15. Greene LA, Tischler AS 1976 Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc Natl Acad Sci USA 73:2424–2428[Abstract/Free Full Text]
  16. Cowley S, Paterson H, Kemp P, Marshall CJ 1994 Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation of NIH 3T3 cells. Cell 77:841–852[CrossRef][Medline]
  17. Segal RA, Greenberg ME 1996 Intracellular signaling pathways activated by neurotrophic factors. Annu Rev Neurosci 19:463–489[Medline]
  18. Flouriot G, Brand H, Denger S, Metivier R, Kos M, Reid G, Sonntag-Buck V, Gannon F 2000 Identification of a new isoform of the human estrogen receptor-{alpha} (hER-{alpha}) that is encoded by distinct transcripts and that is able to repress hER-{alpha} activation function 1. EMBO J 19:4688–4700[CrossRef][Medline]
  19. Metivier R, Stark A, Flouriot G, Hubner MR, Brand H, Penot G, Manu D, Denger S, Reid G, Kos M, Russell RB, Kah O, Pakdel F, Gannon F 2002 A dynamic structural model for estrogen receptor-{alpha} activation by ligands, emphasizing the role of interactions between distant A and E domains. Mol Cell 10:1019–1032[CrossRef][Medline]
  20. Busca R, Abbe P, Mantoux F, Aberdam E, Peyssonnaux C, Eychene A, Ortonne JP, Ballotti R 2000 Ras mediates the cAMP-dependent activation of extracellular signal-regulated kinases (ERKs) in melanocytes. EMBO J 19:2900–2910[CrossRef][Medline]
  21. Merot Y, Ferriere F, Debroas E, Flouriot G, Duval D, Saligaut C 2005 Estrogen receptor {alpha} mediates neuronal differentiation and neuroprotection in PC12 cells: critical role of the A/B domain of the receptor. J Mol Endocrinol 35:257–267[Abstract/Free Full Text]
  22. Hawley RJ, Scheibe RJ, Wagner JA 1992 NGF induces the expression of the VGF gene through a cAMP response element. J Neurosci 12:2573–2581[Abstract]
  23. Zentrich E, Han SY, Pessoa-Brandao L, Butterfield L, Heasley LE 2002 Collaboration of JNKs and ERKs in nerve growth factor regulation of the neurofilament light chain promoter in PC12 cells. J Biol Chem 277:4110–4118[Abstract/Free Full Text]
  24. Jackson TR, Blader IJ, Hammonds-Odie LP, Burga CR, Cooke F, Hawkins PT, Wolf AG, Heldman KA, Theibert AB 1996 Initiation and maintenance of NGF-stimulated neurite outgrowth requires activation of a phosphoinositide 3-kinase. J Cell Sci 109(Pt 2):289–300
  25. Marshall CJ 1995 Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation. Cell 80:179–185[CrossRef][Medline]
  26. Ginty DD, Bonni A, Greenberg ME 1994 Nerve growth factor activates a Ras-dependent protein kinase that stimulates c-fos transcription via phosphorylation of CREB. Cell 77:713–725[CrossRef][Medline]
  27. Ahn S, Olive M, Aggarwal S, Krylov D, Ginty DD, Vinson C 1998 A dominant-negative inhibitor of CREB reveals that it is a general mediator of stimulus-dependent transcription of c-fos. Mol Cell Biol 18:967–977[Abstract/Free Full Text]
  28. Murphy LO, Smith S, Chen RH, Fingar DC, Blenis J 2002 Molecular interpretation of ERK signal duration by immediate early gene products. Nat Cell Biol 4:556–564[Medline]
  29. Dominguez R, Jalali C, de Lacalle S 2004 Morphological effects of estrogen on cholinergic neurons in vitro involves activation of extracellular signal-regulated kinases. J Neurosci 24:982–990[Abstract/Free Full Text]
  30. Carrer HF, Cambiasso MJ, Gorosito S 2005 Effects of estrogen on neuronal growth and differentiation. J Steroid Biochem Mol Biol 93:319–323[CrossRef][Medline]
  31. Singh M, Setalo Jr G, Guan X, Frail DE, Toran-Allerand CD 2000 Estrogen-induced activation of the mitogen-activated protein kinase cascade in the cerebral cortex of estrogen receptor-{alpha} knock-out mice. J Neurosci 20:1694–1700[Abstract/Free Full Text]
  32. McClelland RA, Barrow D, Madden TA, Dutkowski CM, Pamment J, Knowlden JM, Gee JM Nicholson RI 2001 Enhanced epidermal growth factor receptor signaling in MCF7 breast cancer cells after long-term culture in the presence of the pure antiestrogen ICI 182,780 (Faslodex). Endocrinology 142:2776–2788[Abstract/Free Full Text]
  33. Acconcia F, Ascenzi P, Bocedi A, Spisni E, Tomasi V, Trentalance A, Visca P, Marino M 2005 Palmitoylation-dependent estrogen receptor {alpha} membrane localization: regulation by 17β-estradiol. Mol Biol Cell 16:231–237[Abstract/Free Full Text]
  34. Simoncini T, Hafezi-Moghadam A, Brazil DP, Ley K, Chin WW Liao JK 2000 Interaction of oestrogen receptor with the regulatory subunit of phosphatidylinositol-3-OH kinase. Nature 407:538–541[CrossRef][Medline]
  35. Castoria G, Migliaccio A, Bilancio A, Di Domenico M, de Falco A, Lombardi M, Fiorentino R, Varricchio L, Barone MV, Auricchio F 2001 PI3-kinase in concert with Src promotes the S-phase entry of oestradiol-stimulated MCF-7 cells. EMBO J 20:6050–6059[CrossRef][Medline]
  36. Wyckoff MH, Chambliss KL, Mineo C, Yuhanna IS, Mendelsohn ME, Mumby SM, Shaul PW 2001 Plasma membrane estrogen receptors are coupled to endothelial nitric-oxide synthase through G{alpha}i. J Biol Chem 276:27071–27076[Abstract/Free Full Text]
  37. Gallo D, Haddad I, Duvillier H, Jacquemotte F, Laïos I, Laurent G, Jacquot Y, Vinh J, Leclercq G 2008 Trophic effect in MCF-7 cells of ER{alpha}17p, a peptide corresponding to a platform regulatory motif of the estrogen receptor {alpha}: underlying mechanisms. J Steroid Biochem Mol Biol 109:138–149[CrossRef][Medline]
  38. Gallo D, Haddad I, Laurent G, Vinh J, Jacquemotte F, Jacquot Y, Leclercq G 2008 Regulatory function of the P295-T311 motif of the estrogen receptor {alpha}: does proteasomal degradation of the receptor induce emergence of peptides implicated in estrogenic responses? Nucl Recept Signal 6:e007
  39. Filardo EJ, Quinn JA, Bland KI, Frackelton Jr AR 2000 Estrogen-induced activation of Erk-1 and Erk-2 requires the G protein-coupled receptor homolog, GPR30, and occurs via trans-activation of the epidermal growth factor receptor through release of HB-EGF. Mol Endocrinol 14:1649–1660[Abstract/Free Full Text]
  40. Alexaki VI, Charalampopoulos I, Kampa M, Vassalou H, Theodoropoulos P, Stathopoulos EN, Hatzoglou A, Gravanis A, Castanas E 2004 Estrogen exerts neuroprotective effects via membrane estrogen receptors and rapid Akt/NOS activation. FASEB J 18:1594–1596[Abstract/Free Full Text]
  41. Toran-Allerand CD 2004 Estrogen and the brain: beyond ER-{alpha} and ER-β. Exp Gerontol 39:1579–1586[CrossRef][Medline]
  42. McInerney EM, Katzenellenbogen BS 1996 Different regions in activation function-1 of the human estrogen receptor required for antiestrogen- and estradiol-dependent transcription activation. J Biol Chem 271:24172–24178[Abstract/Free Full Text]
  43. Sabbah M, Courilleau D, Mester J, Redeuilh G 1999 Estrogen induction of the cyclin D1 promoter: involvement of a cAMP response-like element. Proc Natl Acad Sci USA 28:11217–21122
  44. Kushner PJ, Agard DA, Greene GL, Scanlan TS, Shiau AK, Uht RM, Webb P 2000 Estrogen receptor pathways to AP-1. J Steroid Biochem Mol Biol 74:311–317[CrossRef][Medline]
  45. Safe S 2001 Transcriptional activation of genes by 17β-estradiol through estrogen receptor-Sp1 interactions. Vitam Horm 62:231–252[Medline]
  46. Webb P, Nguyen P, Valentine C, Lopez GN, Kwok GR, McInerney E, Katzenellenbogen BS, Enmark E, Gustafsson JA, Nilsson S, Kushner PJ 1999 The estrogen receptor enhances AP-1 activity by two distinct mechanisms with different requirements for receptor transactivation functions. Mol Endocrinol 13:1672–1685[Abstract/Free Full Text]
  47. Kim K, Thu N, Saville B, Safe S 2003 Domains of estrogen receptor {alpha} (ER{alpha}) required for ER{alpha}/Sp1-mediated activation of GC-rich promoters by estrogens and antiestrogens in breast cancer cells. Mol Endocrinol 17:804–817[Abstract/Free Full Text]
  48. Li L, Haynes MP, Bender JR 2003 Plasma membrane localization and function of the estrogen receptor {alpha} variant (ER46) in human endothelial cells. Proc Natl Acad Sci USA 100:4807–4812[Abstract/Free Full Text]
  49. Bjornstrom L, Sjoberg M 2002 Mutations in the estrogen receptor DNA-binding domain discriminate between the classical mechanism of action and cross-talk with Stat5b and activating protein 1 (AP-1). J Biol Chem 277:48479–48483[Abstract/Free Full Text]
  50. Kumar V, Green S, Stack G, Berry M, Jin JR, Chambon P 1987 Functional domains of the human estrogen receptor. Cell 51:941–951[CrossRef][Medline]
  51. Teyssier C, Belguise K, Galtier F, Chalbos D 2001 Characterization of the physical interaction between estrogen receptor {alpha} and JUN proteins. J Biol Chem 276:36361–36369[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mérot, Y.
Right arrow Articles by Flouriot, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mérot, Y.
Right arrow Articles by Flouriot, G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals