| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Submitted on January 27, 2006
Accepted on June 9, 2006
Department of Medicine and Molecular Science, Graduate School of Medicine, Gunma University, Maebashi, Gunma, Japan 371-8511
* To whom correspondence should be addressed. E-mail: khashi{at}med.gunma-u.ac.jp.
Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether triiodothyronine (T3) regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by RNase protection assays and real-time quantitative RT (RT)-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor (RXR)-
/ thyroid hormone receptor (TR)-
heterodimer bound to Site2 but RXR-
/ liver X receptor (LXR)-
heterodimer could not bind to the site. In vivo chromatin immunoprecipitation (ChIP) assays demonstrated that T3 induced TR-
recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element:Site2.
This article has been cited by other articles:
![]() |
A. Wulf, M. G Wetzel, M. Kebenko, M. Kroger, A. Harneit, J. Merz, and J. M Weitzel The role of thyroid hormone receptor DNA binding in negative thyroid hormone-mediated gene transcription J. Mol. Endocrinol., July 1, 2008; 41(1): 25 - 34. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kamei, S. Miura, T. Suganami, F. Akaike, S. Kanai, S. Sugita, A. Katsumata, H. Aburatani, T. G. Unterman, O. Ezaki, et al. Regulation of SREBP1c Gene Expression in Skeletal Muscle: Role of Retinoid X Receptor/Liver X Receptor and Forkhead-O1 Transcription Factor Endocrinology, May 1, 2008; 149(5): 2293 - 2305. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hashimoto, S. Matsumoto, M. Yamada, T. Satoh, and M. Mori Liver X Receptor-{alpha} Gene Expression Is Positively Regulated by Thyroid Hormone Endocrinology, October 1, 2007; 148(10): 4667 - 4675. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Erion, E. E. Cable, B. R. Ito, H. Jiang, J. M. Fujitaki, P. D. Finn, B.-H. Zhang, J. Hou, S. H. Boyer, P. D. van Poelje, et al. From the Cover: Targeting thyroid hormone receptor-beta agonists to the liver reduces cholesterol and triglycerides and improves the therapeutic index PNAS, September 25, 2007; 104(39): 15490 - 15495. [Abstract] [Full Text] [PDF] |
||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |